diff --git a/Resources/Text mining/bsc_nlp_ppis_cord.tsv b/Resources/Text mining/bsc_nlp_ppis_cord.tsv
new file mode 100644
index 0000000000000000000000000000000000000000..2511dbba64356fbc220d37a8877bb528d3b1de14
--- /dev/null
+++ b/Resources/Text mining/bsc_nlp_ppis_cord.tsv	
@@ -0,0 +1,31715 @@
+#: :namespace=Hsa/feb2014#:type=:double
+#SegID	Associated Gene Name	Literal	Sentence
+SARS:003229cade748c34593401d3f2b61eadeca86de4:abstract:33fac7c8f440a0db6f8e9e17a9fa601a:759..1141:sentences:22c2fa439685a97072b5c5b7a969f910	PHGDH|PSAT1|NES	NLS-1|NLS-2|NES	Experiments using oligopeptides, truncated polypeptides and amino acid-substituted proteins have identified several domains within PRRSV N protein that participate in nucleo-cytoplasmic shuttling, including a cryptic nuclear localization signal (NLS) called NLS-1, a functional NLS (NLS-2), a nucleolar localization sequence (NoLS), as well as a possible nuclear export signal (NES).
+SARS:00352a58c8766861effed18a4b079d1683fec2ec:abstract:1c0cc261f6af1d2cdeef7d3b77076c3f:706..1003:sentences:5dbeb0a449a8f379d98a96672ed03384	USP46|WDR48|WDR48|WDR20	USP46|WDR48|UAF1|WDR20	In this review article, we focus on the role of the DUB USP46 in the nervous system, and illustrate potential mechanisms of regulating DUBs by describing how USP46 is regulated by two WD40-repeat (WDR) proteins, WDR48/UAF1 and WDR20, based on recent structural studies and genetic analyses in vivo.
+SARS:004f0f69464edd5466a947da86d38cea9fe7e4fe:abstract:81f82d8cc086d4342467810947f854f2:372..624:sentences:d5afaa3429d0e4f1125e19e34fba9716	PSG1|PSG5	PSG1|PSG	The present study investigates a potential role for PSG1, the most abundant PSG in maternal serum, as a possible inducer of proangiogenic growth factors known to play an important role in establishment of the vasculature at the maternal-fetal interface.
+SARS:004f0f69464edd5466a947da86d38cea9fe7e4fe:abstract:81f82d8cc086d4342467810947f854f2:626..802:sentences:730d383d9baf3bb94630ee780187d3d4	TGFB1||PGF|PGF|PSG1	TGFB1|vascular endothelial growth factors (VEGFs) A and C|placental growth factor|PGF|PSG1	To this end, we measured TGFB1, vascular endothelial growth factors (VEGFs) A and C, and placental growth factor (PGF) protein levels in several cell types after PSG1 treatment.
+SARS:004f0f69464edd5466a947da86d38cea9fe7e4fe:abstract:81f82d8cc086d4342467810947f854f2:953..1086:sentences:6bc9089acea918589517715e4838196a	PSG1|TGFB1|VEGFA	PSG1|TGFB1|VEGFA	PSG1 induced up-regulation of both TGFB1 and VEGFA in human monocytes, macrophages, and two human extravillous trophoblast cell lines.
+SARS:004f0f69464edd5466a947da86d38cea9fe7e4fe:abstract:81f82d8cc086d4342467810947f854f2:1088..1167:sentences:2a185ad4e8a057e83dedf2a86ce77dc6	VEGFC|PGF|PSG1	VEGFC|PGF|PSG1	We did not observe induction of VEGFC or PGF by PSG1 in any of the cells tested.
+SARS:004f0f69464edd5466a947da86d38cea9fe7e4fe:abstract:81f82d8cc086d4342467810947f854f2:1169..1259:sentences:d41c804e65a0b5f23d007350c8605811	PSG1|VEGFA	PSG1|VEGFA	PSG1 treatment resulted in endothelial tube formation in the presence and absence of VEGFA.
+SARS:0049ba8861864506e1e8559e7815f4de8b03dbed:abstract:a1c700c44003645785b35a78640aca17:944..1086:sentences:9aebe7733cb477e57db59134f755db84	|GPI	scFv|GPI	Among them, GPI-anchored scFv (X5) exhibits extremely potent and broad neutralization activity against multiple clades of HIV-1 strains tested.
+SARS:0049ba8861864506e1e8559e7815f4de8b03dbed:abstract:a1c700c44003645785b35a78640aca17:1088..1217:sentences:07a5c6ef62a109346ee6eec35c51da86	|GPI	scFv|GPI	Moreover, we show that GPI-anchored scFv (4E10) also exhibited more potent neutralization activity than its secretory counterpart.
+SARS:0049ba8861864506e1e8559e7815f4de8b03dbed:abstract:a1c700c44003645785b35a78640aca17:1219..1501:sentences:64333f2a7b7ab6abb08edfbd31f4a108	GPI||CD4	GPI|scFv|CD4	Finally, we demonstrate that expression of GPI-anchored scFv (X5) in the lipid raft of plasma membrane of human CD4(+ )T cells confers long-term resistance to HIV-1 infection, HIV-1 envelope-mediated cell-cell fusion, and the infection of HIV-1 captured and transferred by human DCs.
+SARS:0049ba8861864506e1e8559e7815f4de8b03dbed:abstract:a1c700c44003645785b35a78640aca17:1503..1724:sentences:3ea70d485819b91ff1e2ad21c74e972a	|GPI	scFv|GPI	CONCLUSIONS: Thus GPI-anchored scFv could be used as a general and effective way to identify antibodies that react with transiently-exposed neutralization epitopes in envelope proteins of HIV-1 and other enveloped viruses.
+SARS:0049ba8861864506e1e8559e7815f4de8b03dbed:abstract:a1c700c44003645785b35a78640aca17:1726..1890:sentences:ce9f1676bd4bcf1b13579eb4329240cc	|GPI	scFv|GPI	The GPI-anchored scFv (X5), because of its breadth and potency, should have a great potential to be developed into anti-viral agent for HIV-1 prevention and therapy.
+SARS:005c43980edf3fcc2a4d12ee7ad630ddb651ce6e:fulltext:e601d9828c3cf976bf5d17c1d322c243:11261..11750:sentences:f00d67b17516caf63973ce8fe1867ad2	TNFSF15|TNFSF10	TL1|TL2	As described previously, an application running on the Android operating system was developed to enable non-experts to easily complete a fluorescence immunochromatographic diagnostic test and report its results via wireless communication through step-by-step instructions displayed on the smartphone's touchscreen [13] . After completing the measurements, the test result was obtained by computing the ratio of fluorescence intensity (TL1/CL or TL2/CL).. Strategy to analyze SRDFDS results.
+SARS:005c43980edf3fcc2a4d12ee7ad630ddb651ce6e:fulltext:e601d9828c3cf976bf5d17c1d322c243:11959..12213:sentences:c6b55fdcb9049f434ed3e969fa548c14	TNFSF10|TNFSF15	TL2|TL1	SRDFDS can normalize the positive sample compared to the negative sample using each value of TL/CL [TL1/CL for H5-HA detection with 580 nm emission filter (F580 nm) and TL2/CL for influenza A with 650 nm emission filter (F650 nm)] and the fold of control.
+SARS:005c43980edf3fcc2a4d12ee7ad630ddb651ce6e:fulltext:e601d9828c3cf976bf5d17c1d322c243:12215..12367:sentences:6f815ea22992002d453c43866926e80d	TNFSF15|TNFSF10	TL1|TL2	Finally, all results obtained by SRDFDS can be analyzed with dual fluorescence signals leading to accurate diagnostic result using only TL1/CL or TL2/CL.
+SARS:005c43980edf3fcc2a4d12ee7ad630ddb651ce6e:fulltext:e601d9828c3cf976bf5d17c1d322c243:12435..12678:sentences:a88936e3a26eec959639f9ccb8f8c43b	TNFSF10|TNFSF15	TL2|TL1	The TL2/CL value at 580 nm and TL1/CL value at 650 nm of the positive sample (ii in Figure 3A ) were divided by the corresponding values of the uninfected sample (i in Figure 3A ) to normalize and obtain the final TL/CL value (fold of control).
+SARS:005c43980edf3fcc2a4d12ee7ad630ddb651ce6e:fulltext:e601d9828c3cf976bf5d17c1d322c243:21847..22109:sentences:068b23472f2f141af1f466145f59d521	TNFSF10|TNFSF15|TNFSF10|TNFSF15	TL2|TL1|TL2|TL1	F 580-A, TL2/CL of influenza A taken with the 580 nm emission filter; F 580-H5, TL1/CL of H5 taken with the 580 nm emission filter; F 650-A, TL2/CL of influenza A taken with the 650 nm emission filter; F 650-H5, TL1/CL of H5 taken with the 650 nm emission filter.
+SARS:005c43980edf3fcc2a4d12ee7ad630ddb651ce6e:fulltext:e601d9828c3cf976bf5d17c1d322c243:34061..34258:sentences:cef499e8cce89c431a9cd516f7bec86b	TNFSF15|TNFSF10	TL1|TL2	As this optical leaking did not interfere with TL1/CL or TL2/CL results in patients, clinical readouts to diagnose influenza A and H5 HA measured by SRDFDS could be considered reliable.. Discussion.
+SARS:005c43980edf3fcc2a4d12ee7ad630ddb651ce6e:fulltext:e601d9828c3cf976bf5d17c1d322c243:41122..41283:sentences:e189193ee9abd4b51adaac242bc50467	TNFSF15|TNFSF10	TL 1|TL 2	Two test lines (0.8 g/lane) were coated with anti-influenza H5 subtype (1C5) (Test line 1: TL 1) and anti-influenza A NP (7304) (Test line 2: TL 2), respectively.
+SARS:0072159e1ebecc889e9bcabb58bb45c47e18a403:abstract:b1ec554984a699f1f9016a8c942b9872:122..359:sentences:ddf95829eb00695581da69434a2cc36f	NEDD4|ITCH	Nedd4|ITCH	The filovirus VP40 matrix protein is essential for virus assembly and budding, and its PPxY L-domain motif interacts with WW-domains of specific host proteins, such as Nedd4 and ITCH, to facilitate the late stage of virus-cell separation.
+SARS:00cb1a95986171a256f5ef14701bd8f571221a28:abstract:e68dedd910b150678a07792e6948e10d:385..534:sentences:3aab2d29f68462317523bb8ffbc0b40e	DDX58|IFIH1	RIG-I|MDA5	The intracellular pathogen receptors RIG-I and MDA5 play a central role in detecting flavivirus infections and initiating a robust antiviral response.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:abstract:eed0948a159ef367fd627b710aa2a835:424..578:sentences:b66362dddb9e35e189cf2b18b6f47402	TBK1|TBKBP1|AZI2|TBK1	TBK1|SINTBAD|AZI2|TBK1	SINT-speckles partially colocalize with activated TBK1, and deletion of SINTBAD and the SINT-speckle component AZI2 leads to impaired TBK1 phosphorylation.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:abstract:eed0948a159ef367fd627b710aa2a835:745..926:sentences:f8f2fe772dfd21da8f683a3c13931114	|TBK1	ULK1/2|TBK1	SINT-speckle formation is also inhibited by the autophagy-initiating kinases ULK1/2, and knockdown of these kinases prevented focal TBK1 phosphorylation in a pathway-specific manner.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:abstract:eed0948a159ef367fd627b710aa2a835:928..1185:sentences:bbaa382f3eebeb0a1b98bb5262d89956	ULK1|TBK1	ULK1|TBK1	The phlebovirus-encoded non-structural protein S enhances ULK1-mediated TBK1 phosphorylation and shows a stress-induced translocation to SINT-speckles, raising the possibility that viruses can also target this signaling hub to manipulate host cell functions.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:title:2470c3a9f701d75c27bb83182e1153f2:0..126:sentences:c15e9cf747be8f49315980d987266e70	|TBK1	ULK1/2|TBK1	ULK1/2 Restricts the Formation of Inducible SINT-Speckles, Membraneless Organelles Controlling the Threshold of TBK1 Activation
+SARS:01041a0055287681d22358a256554d8dfa708654:abstract:ebc0b9fd5d736443e59a527313554095:212..355:sentences:dac08a6a20db6a856a29ce2a9338f754	CTSL|CTSB	cathepsin L|cathepsin B	Treatment with chloroquine or cathepsin L inhibitors, but not cathepsin B inhibitors, significantly reduced the replication of PEC, MNV and FCV.
+SARS:01234cee305e37a78cedea8148bf6177d47fe66b:abstract:fc9b2f2f5958c6077cbca59c2815429d:924..1121:sentences:65f4f3bd2472918f9a9fbab1202e1943	KRT14|KRT5	CK14|CK5/6	Double immunolabeling demonstrated cytokeratin (CK) 18 expressing epithelial cells to be the prevailing target cell of MERS-CoV, while CK5/6 and CK14 expressing cells did not co-localize with virus.
+SARS:0104f6ceccf92ae8567a0102f89cbb976969a774:abstract:a329320a940e421f35f0bbb0c0b6636a:536..782:sentences:8cccf8ae88b6f2d675edcdc525caf027	SARS|SARS|HLA-DRB4	SARS|SARS|HLA	METHODS: HLA-class I and II allele typing by PCR-SSOP was performed on 37 cases of probable SARS, 28 fever patients excluded later as probable SARS, and 101 non-infected health care workers who were exposed or possibly exposed to SARS coronavirus.
+SARS:0104f6ceccf92ae8567a0102f89cbb976969a774:abstract:a329320a940e421f35f0bbb0c0b6636a:1091..1359:sentences:cfe639a4b6ee8920ca87c4863b07d29d	HLA-B|HLA-B|SARS	HLA-B|HLA-B|SARS	At first, when analyzing infected SARS patients and high risk health care workers groups, HLA-B*4601 (OR = 2.08, P = 0.04, Pc = n.s.) and HLA-B*5401 (OR = 5.44, P = 0.02, Pc = n.s.) appeared as the most probable elements that may be favoring SARS coronavirus infection.
+SARS:0104f6ceccf92ae8567a0102f89cbb976969a774:abstract:a329320a940e421f35f0bbb0c0b6636a:1361..1631:sentences:4099bad9571b403cd5a3bcfaf1365923	SARS|HLA-B|SARS	SARS|HLA-B|SARS	After selecting only a "severe cases" patient group from the infected "probable SARS" patient group and comparing them with the high risk health care workers group, the severity of SARS was shown to be significantly associated with HLA-B*4601 (P = 0.0008 or Pc = 0.0279).
+SARS:0104f6ceccf92ae8567a0102f89cbb976969a774:abstract:a329320a940e421f35f0bbb0c0b6636a:1787..2004:sentences:15de436655fd53e6cd4531608e3bac3b	HLA-B|HLA-B|SARS	HLA-B|HLA-B|SARS	Up until recently, no probable SARS patients were reported among Taiwan indigenous peoples who are genetically distinct from the Taiwanese general population, have no HLA-B* 4601 and have high frequency of HLA-B* 1301.
+SARS:0104f6ceccf92ae8567a0102f89cbb976969a774:abstract:a329320a940e421f35f0bbb0c0b6636a:2006..2202:sentences:362706d647cafe15e4b9cb10242902e6	HLA-B|SARS	HLA-B|SARS	While increase of HLA-B* 4601 allele frequency was observed in the "Probable SARS infected" patient group, a further significant increase of the allele was seen in the "Severe cases" patient group.
+SARS:0104f6ceccf92ae8567a0102f89cbb976969a774:abstract:a329320a940e421f35f0bbb0c0b6636a:2204..2322:sentences:131584e7bd24360a18acdf3bc2836d17	HLA-B|SARS	HLA-B|SARS	These results appeared to indicate association of HLA-B* 4601 with the severity of SARS infection in Asian populations.
+SARS:0134717f1b5ea99fc7e5ac305d492f5cedc8cd92:fulltext:1ffb5d0773f0125160113451767aef7e:3822..4029:sentences:cd390412ec3eae14ecc18482537b6aec	SLC17A5|GPT	AST|GPT	Glutamate oxaloacetate transaminase (GOT or AST), glutamate pyruvate transaminase (GPT or ALT) and lactate dehydrogenase (LDH) are the enzymes found in heart, liver, kidney, skeletal muscles and erythrocytes.
+SARS:0134717f1b5ea99fc7e5ac305d492f5cedc8cd92:fulltext:1ffb5d0773f0125160113451767aef7e:25711..25865:sentences:fb8f4207cb386bdb1f2dc2f524264b5d	SOD1|H6PD	SOD|G6PDH	[38] reported a dose dependent inhibition of total protein content and significant increase in SOD and G6PDH activities in PLHC-1 cells due to CQ toxicity.
+SARS:01297dffaf94c1314ca46088f7b829b8383c2f73:fulltext:8f1e25bdcd76524aa8bee55a288c65ca:135..359:sentences:3e964744bd6bdf60a6fbce86a193a5e0	ERVW-1|ERVW-1|ENPEP|ITIH4|ERVW-1	Env|Env|gp160|gp120|Env	Env is heavily glycosylated, with glycans composing up to half of its mass [19] . During maturation of Env, the full-length gp160 is cleaved by a protease into gp41 and gp120, which remain associated forming Env heterodimers.
+SARS:018b618ea132d47ffb43b003a6c78cb9eeadc017:abstract:771b166de07b4acc6a008af16c0b8a1c:689..873:sentences:3405002d7a5b07e4d94d6eeaf7367904	SH2D3A|SH2D3C|PRSS57	nsP1|nsP3|nsP4	Results revealed that anti-CHIKV antibodies were neutralizing and the E2 glycoprotein, Capsid, nsP1, nsP3 and nsP4 proteins were targets of the anti-CHIKV antibody response in macaques.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:abstract:cb3cf06882dd316b70dd4336785a587a:284..780:sentences:0438277263481f4eb560644967cb5334	MX1|CRP|CRP|UROD	MxA|C-reactive protein|CRP|PCT	METHODS: Major databases, including MEDLINE and the Cochrane Library, were searched for prospective human clinical studies, including children and/or adults published between January 1966 and November 2017 that evaluated Myxovirus resistance protein A (MxA) as a biomarker for diagnosing viral infections as well as both C-reactive protein (CRP) and procalcitonin (PCT) as potential biomarkers for identifying and differentiating true bacterial upper respiratory infection (URI) from colonization.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:abstract:cb3cf06882dd316b70dd4336785a587a:929..1176:sentences:f6c6dca990300055ba69acf95c7cb75f	UROD|CRP	PCT|CRP	Both systematic review articles, meta-analyses, and randomized controlled clinical trials that examined CRP and/or PCT as a biomarker for identifying clinically significant bacterial infections and supporting antibiotic stewardship were identified.
+SARS:0185df64da339e8d1b822db72fee79a25edeb759:abstract:3e5c9985ccc0e0e666b6a0c1adfdd520:817..966:sentences:cc956df2a02c078e14d254746cd85919	CD8A|CD4	CD8|CD4	It also did not affect the frequency of CD4+ T cells, CD8+ T cells and monocytes/macrophages in the blood and the spleen determined by flow cytometry.
+SARS:01d162d7fae6aaba8e6e60e563ef4c2fca7b0e18:abstract:ba1348582a03549665694181168514f4:1402..1584:sentences:18ace99b7c380c2ab8a2c381fea5a07e	ACE2|CXCL10	ACE2|Renin-Angiotensin System and IP-10	After triggering functional changes in ACE2/AT2R, an imbalance in the steady-state cytokine regulatory axis involving the Renin-Angiotensin System and IP-10 leads to a cytokine storm.
+SARS:020fbcc7ca09802e2b4ee820ff8aef3b989b8fbc:title:46eca08653fd282db1be3a36c0742242:0..74:sentences:ff2aff6b8d7887dee8fdcf2c0299c44f	SRC|VEGFA	Src|VEGF	Role of Src in VEGF mediating the activation of rabbit osteoclasts in vitro
+SARS:01b3d789dbd69fff374842fbe2d7f4150fb3d8f5:fulltext:25b7562763b4c7372bcaba1aab9bcdfb:18141..18273:sentences:61e5609e8837b6bc554de460f8f909e8	C12orf57|BBS9	C10|C18	To this end we substituted G for C20, removed C24 and restored the G2-C18 and C10-G32 base pairs, as present in the SRV-1 pseudoknot.
+SARS:021be4c280d043e92a4a3e03d07d7a684bfac12f:abstract:32c0f64eb7f3f27ff1b69c9d2ec5695d:475..728:sentences:0cb2a8ebfbaa4f0a4051da34cced0efe	CCR7|CCL19|CCL21	CC-motif chemokine receptor (CCR) 7|CCL19|CCL21	CNS stromal cell activation was dominated by a rapid and vigorous production of CC-motif chemokine receptor (CCR) 7 ligands CCL19 and CCL21 by vascular endothelial cells and adjacent fibroblastic reticular cell (FRC)-like cells in the perivascular space.
+SARS:021c6cee4475973338022c029affed87f706de5a:abstract:b8b831256de50fe571603d8462a2855f:169..315:sentences:de779c7bbf794f438ee8bd0126e93364	ACE|ACE2	ACE|ACE2	The present research was to investigate possible roles of angiotensin-converting enzyme (ACE) and ACE2 in lung injury resulted from smoke exposure.
+SARS:021c6cee4475973338022c029affed87f706de5a:abstract:b8b831256de50fe571603d8462a2855f:366..653:sentences:8fe3b8e73045efb4513621670d0d7d40	ACE|ACE2	ACE|ACE2	Histological changes, blood gases, bronchoalveolar lavage fluids (BALF) and wet-to-dry weight were analyzed to evaluate lung injury after smoke inhalation; beside, we also measured the expression of ACE and ACE2 at different time points to explore the possible mechanism of those changes.
+SARS:021c6cee4475973338022c029affed87f706de5a:abstract:b8b831256de50fe571603d8462a2855f:1019..1243:sentences:03c4560695696830dd9a587b448504b5	ACE|ACE2	ACE|ACE2	More importantly, both immunohistochemical staining and Western blot results showed that ACE and ACE2 expression in lungs from the experimental groups significantly increased compared with that of the control group (P <0.05).
+SARS:021c6cee4475973338022c029affed87f706de5a:abstract:b8b831256de50fe571603d8462a2855f:1245..1455:sentences:44feeac28a723d9d5b86c84e54d51892	ACE|ACE2	ACE|ACE2	This study indicated that inflammation pulmonary edema and histological changes resulted from smoke inhalation induced lung injury were possibly attributed to abnormal expression of ACE and ACE2 related pathway.
+SARS:021c6cee4475973338022c029affed87f706de5a:title:394cf1dae4d4e5b50604489eb5118a1f:0..130:sentences:8e81ec73fb14cc78905702c87162bb88	ACE|ACE2	ACE|ACE2	Role of angiotensin-converting enzyme (ACE) and ACE2 in a rat model of smoke inhalation induced acute respiratory distress syndrome
+SARS:019760388ec5fa9151add6cfe32178deda5433eb:fulltext:17d944dd9380b6f50574ca7a4e6be939:7960..8358:sentences:4f80e15b252a3ca5ca7a14496715e536	IVNS1ABP|	NS1|NS2	Mutant and WT BTV-1 viruses were rescued using a 2-step transfection protocol as previously described [19] . Briefly, monolayers of either BSR or BSR4 were initially transfected with the plasmid constructs expressing the sub-core (VP1, VP3, VP4 and VP6) and non-structural (NS1 and NS2) proteins and after 12-18 h cells were transfected for a second time with a complete set of T7 derived BTV mRNAs.
+SARS:02049ffbdb20997055c4def3516af0e6e40dd427:title:1dfa99c18dfef5ed32074b08ade10f6c:0..124:sentences:dc5ce14ae8a02388e0bbed5ebb52e83a	RNASEL|ADAR	Ribonuclease L|ADAR1	Ribonuclease L mediates the cell-lethal phenotype of double-stranded RNA editing enzyme ADAR1 deficiency in a human cell line
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:4785..5071:sentences:533e1246b2e841de740b6159a79d6c23	TEK|CRP	Tek|CRP	time of sacrifice was used for serum CRP determinations by radial immunodiffusion as described (45) . Initial cell suspensions were plated in 100  15 mm plastic culture dishes (Lux Scientific, Lab-Tek Division, Miles Laboratories, Naperville, IL) at a density of 8-9  106 cells per dish.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:15780..16070:sentences:36a95853a96b0be34c44ed72a3b4adb8	CRP|TF|TF|TF	CRP|Transferrin|transferrin|transferrin	Radiolabeled CRP and albumin present in these same supernates were specifically immunoprecipitated as described previously (47) . Transferrin was precipitated employing 10 #g carrier rabbit transferrin and 50 #1 goat antirabbit transferrin (both from Cappel, Cooper Biomedical, Malvern, PA).
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:16072..16185:sentences:8c358641d94384c6b525bc299503924e	CEBPE|TF	CRP, 1|transferrin	Volumes of supernate used for immunoprecipitation were 2 ml for CRP, 1 ml for albumin, and 0.5 ml for transferrin.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:17202..17425:sentences:19d9f2e5711a423b88cace34be1458fb	CRP|HSPA5|HSPA5|HSPA5	CRP|BiP|grp78|BiP	To investigate the possible association of newly synthesized CRP with BiP (grp78), pulse-labeled cell lysates were incubated with rat monoclonal antihuman BiP (generous gift of Dr. David Bole) under ATP-depleting conditions.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:17984..18252:sentences:c58de8b4367ddf812eb5eaf1606c0820	HSPA5|NACC1	BiP|NaC1	0.5 ml of the supernate was incubated with 100 #1 anti-BiP and 50 ttl protein A-Sepharose (Pharmacia Fine Chemicals, Piscataway, NJ) made up as a 50% suspension in 20 mM Hepes, pH 7,4, 0.15 M NaC1, 0.1% BSA and the suspension was incubated for 1 h at 4 ~ with rotation.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:20802..20963:sentences:f1668ec5cdebfa9a62d6ffeac195d2c6	NACC1|CRP	NaC1|CRP	CRP (500-750 #g/ml) was biotinylated employing a 30-fold molar excess of freshly prepared NHS-LC-biotin (Pierce Chemical Co.) in 0.15 M NaC1, 20 mM Hepes, pH 7.4.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:27487..27610:sentences:86e23687c92ad8d41da350d84e0ddcf6	CRP|TF	CRP|transferrin	In addition to CRP and albumin, transferrin was also studied since it has a relatively long transit time of ,~120 rain (68).
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:28951..29127:sentences:58a0ed09dba52874c7e240b83ee15129	TF|CRP	transferrin|CRP	Radiolabeled albumin, transferrin, and CRP were specifically immunoprecipitated from portions of lysates of fractions and were subjected to SDS-PAGE followed by autoradiography.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:29288..29629:sentences:a2d356d1e84a02b2561f03e9d748478c	HSPA9|TF	CRP = 40|transferrin	To achieve comparable autoradiographic results, the proportions of lysates used for immunoprecipitation of individual proteins (CRP = 40 %, albumin = 20%, transferrin = 10%) was designed to account for differences in methionine composition, relative rates of synthesis, and intracellulax transit times (see Materials and Methods for details).
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:29941..30209:sentences:45dc788843c60c237e094af1ecd375ed	TF|TF|CRP	transferrin|transferrin|CRP	While there was little difference (compared to animal #1) for albumin (82 % of ER cpm lost during the 75-min chase), or for transferrin (50 % increase in chased transferrin from 40 to 59%), a threefold increase in chase of radiolabeled CRP from 12 to 35 % was observed.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:44860..45025:sentences:a64a1d8644b2b4bf96fa9d3d5cbcbf42	HSPA5|HSPA5|CRP	BiP|BiP|CRP	Since we were unable to reproducibly coprecipitate other proteins with anti-BiP, we cannot conclude whether BiP may play a role in the retention of CRP within the ER.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:45027..45252:sentences:2d77c072303b94a67ec8988e3300480f	HSPA5|CRP|CRP	BiP|CRP|CRP	However, it is unlikely that an interaction between BiP and CRP would be undetected by these techniques if it were responsible for a stable intracellular half-life of CRP of 18 h (47) .. Kinetic and Saturation Binding Studies.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:46266..46558:sentences:2a982e9cbcc6d73311616f2df59e14dc	HSPA5|CRP|CRP	BiP|CRP|CRP	Thus, the expression of the 60-kD CRP-binding band, a protein distinct from BiP, correlates well with the results of the binding of CRP to permeabilized microsomal subfractions, as judged by both subcellular localization as well as a decrease in activity in microsomes from stimulated animals.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:47370..47534:sentences:26d1034b1e35c61e111b6ac06f190c15	CRP|HSPA5	CRP|BiP	(c) Specific binding of CRP is greatly diminished in samples from animals undergoing the acute phase response and appears to involve an ER protein distinct from BiP.
+SARS:006be99e337c84b8758591a54f0362353b24dfde:fulltext:6d142f2886d064837cb9f2f3ffebcc56:52137..52730:sentences:7309ace8808cbb655b0d6e5a2b626d3e	IL1B|CRP	IL-1; B|CRP	#M for surface receptors present on phagocytic cells (6, 51, 72, 81) . The Bmax determined for the high affinity site (0.88 pmol CRP/mg microsomal protein) is within the range of values reported for physiologically significant receptors, including receptors for IL-1; B~, = 0.5 pmol/mg membrane protein (56), for inositol trisphosphate; Bin, = 5 pmol/mg protein (69) , and for 5-hydroxytryptamine3; B~, = 1 pmol/mg protein (48) . On the basis of these data, the estimated density of the high affinity site within the ER would be the equivalent of a few thousand cell surface receptors per cell.
+SARS:021fba0f252408868fa29b65686dedb3b3d6bf02:abstract:9e3387b0678ae721853d3aebff28edbc:529..1035:sentences:82c58bacc05111c8b2ba58a8078775e3	ANPEP|MTM1|ACTB|KIAA1161	aminopeptidase N|myotubularin|actin|KIAA1161	Eight binding proteins (luciferin 4-monooxygenase, aminopeptidase N, aminopeptidase N3, nicotinamide adenine dinucleotide health (NADH) dehydrogenase subunit 5, phosphatidylinositol 3-phosphate 3-phosphatase myotubularin, actin, uncharacterized family 31 glucosidase KIAA1161, and 2OG-Fe(2) oxygenase superfamily protein) were obtained and identified through liquid chromatography/quadrupole-time of flight-mass spectrometry (LC/Q-TOF-MS) analysis of the midgut epithelium cells of Mythimna separata larvae.
+SARS:0235dcbc1e22a533d0f9dc85644e83672fb9e8a4:abstract:1b7cc03f72f71abce96045c9ea1a578e:369..464:sentences:bd2b5af872de4f1f0b6a1fb2f1c0a794	ISG15|UBC	ISG15|ubiquitin	Interferon stimulated gene 15 (ISG15) is a ubiquitin-like modifier induced by type I interferon.
+SARS:0239ee460a61e7ec69c58fcd98bd6b4f87d87aeb:abstract:8c4375f11e12d011a99d4703b0a2d85c:284..598:sentences:34ce2f1501876fc5ce6feebbbf4959df	ATM|TP53|MDM2|TP53	ATM|p53|MDM2|p53	The model can successfully be used to simulate the dynamic processes of double-strand breaks (DSBs) generation and their repair, switch-like ataxia telangiectasia mutated (ATM) activation, oscillations occurring in the p53-MDM2 feedback loop, as well as toxins elimination triggered by p53 stress response networks.
+SARS:0241ada1b12eaacadc56a59586bc1728a580583d:abstract:26d2d9f67d2b08e8dd86c696c67868e0:947..1260:sentences:7e910de1a5b22d768c7d5e3009c808d2	HSPG2|HSPG2|MIR7-3HG	PLC|PLC|Huh7	entry plus replication initiation) are cumulatively equivalent or only marginally reduced in PLC and Hep3B cells, later steps of the viral life cycle such as steady-state replication, de novo virus production and/or spread are impaired to different degrees in PLC and Hep3B cultures compared to Huh7 cell cultures.
+SARS:0241ada1b12eaacadc56a59586bc1728a580583d:abstract:26d2d9f67d2b08e8dd86c696c67868e0:1332..1448:sentences:0f69b734b3137e499dc2cdd4d58263e4	IFIT1|HSPG2	ISG56|PLC	ISG56) expression was significantly and differentially up-regulated in PLC and Hep3B cells following viral infection.
+SARS:022abf5f202c04e2bbf88d829db9844746e0fb71:fulltext:0e8d9133efe41ed79664fa9c755ae87a:5389..5729:sentences:991a3f215f31549b5ead194c563301b4	CD4|VHLL	CD4|VLP	However, the most important advantage of the VLP vaccine is that it can stimulate B cells and proliferate CD4 and cytotoxic T-lymphocyte responses [15] . But, the stimulation of B cells by VLPs is strong enough to elicit T cell independent IgM antibody induction [16] .. Virus-like Particle Vaccine for Porcine Circovirus-Associated Disease.
+SARS:02b8dea56378d11fe92d6a60ff37a34b0d6ea63e:abstract:f160899c172899b38c7c0adfd4f18b76:360..600:sentences:4f73f9471c24cb96ef6d21e039485c79	BSG|	CD147|MMPs	The present article studied the expression of CD147, also called extracellular matrix metalloproteinase inducer, on monocytes/macrophages and FLS from RA patients and its potential role in enhancing MMPs and the invasiveness of synoviocytes.
+SARS:02b8dea56378d11fe92d6a60ff37a34b0d6ea63e:abstract:f160899c172899b38c7c0adfd4f18b76:829..901:sentences:ce38f4ffcd8a84d5a79f6fbe79e003b6	BSG|MMP2|MMP9	CD147|MMP-2|MMP-9	The levels of CD147, MMP-2 and MMP-9 mRNA in FLS were detected by RT-PCR.
+SARS:02b8dea56378d11fe92d6a60ff37a34b0d6ea63e:abstract:f160899c172899b38c7c0adfd4f18b76:1339..1452:sentences:4e3ffd53c9774d72a233a061d883b5d0	BSG|MMP2|MMP9	CD147|MMP-2|MMP-9	RT-PCR showed that the expressions of CD147, MMP-2 and MMP-9 mRNA was higher in RA FLS than in osteoarthritis FLS.
+SARS:02b8dea56378d11fe92d6a60ff37a34b0d6ea63e:abstract:f160899c172899b38c7c0adfd4f18b76:1454..1740:sentences:dd5916b7207986d99b69d03736c413ee	MMP2|MMP9	MMP-2|MMP-9	A significantly elevated secretion and activation of MMP-2 and MMP-9 were observed in RA FLS co-cultured with differentiated THP-1 cells or RA synovial monocytes/macrophages, compared with those co-cultured with undifferentiated THP-1 cells or healthy control peripheral blood monocytes.
+SARS:02bfb4c09489a5f48c23e8441e37b055bf7228ee:title:5f8293ed1ae46da668421d9fda1d2a31:0..137:sentences:4eb8a6708b276dd08748e77dab606890	RTN2|CTSB	nsP2|cysteine protease	Chikungunya nsP2 protease is not a papain-like cysteine protease and the catalytic dyad cysteine is interchangeable with a proximal serine
+SARS:025ed2caa0ae1ab7f04d3479116e6ed2a334938d:fulltext:c18f73466aef5fa816f8ea3b32edbe18:1694..1914:sentences:16da60f9d670730d0879523d0e0d7804	APOB|LDLR	APOB-100|low-density lipoprotein (LDL) receptor	The APOB-100 protein is a structural component of very low-density lipoprotein (VLDL) and its metabolic products and serves as the ligand for low-density lipoprotein (LDL) receptor-mediated endocytosis of lipid particles.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:abstract:17a2ee82d3ef2fefb90be29a88099a41:95..212:sentences:260ee5c30e478f734064c4d970e64d91	SIRT7|POLI	SIRT7|Pol I	Previous studies have shown that SIRT7 is required for RNA polymerase I (Pol I) transcription and pre-rRNA processing.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:abstract:17a2ee82d3ef2fefb90be29a88099a41:521..638:sentences:4306c703d8f8cd297246dd8d30487e47	SIRT7|POLI	SIRT7|Pol I	In addition to its role in Pol I transcription, we found that SIRT7 also regulates transcription of snoRNAs and mRNAs.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:abstract:17a2ee82d3ef2fefb90be29a88099a41:640..1066:sentences:bddba2dc4c49b18a4af4afdaa066b7c3	SIRT7|CDK9|SIRT7|KAT2A|CDK9	SIRT7|CDK9|SIRT7|GCN5|CDK9	Mechanistically, SIRT7 promotes the release of P-TEFb from the inactive 7SK snRNP complex and deacetylates CDK9, a subunit of the elongation factor P-TEFb, which activates transcription by phosphorylating serine 2 within the C-terminal domain (CTD) of Pol II. SIRT7 counteracts GCN5-directed acetylation of lysine 48 within the catalytic domain of CDK9, deacetylation promoting CTD phosphorylation and transcription elongation.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:20358..20478:sentences:3edf8b773be455e95fc6b53af7e8212b	TNNI3||INS|IGF1	c-TnI|SAA|insulin|IGF-1	Blood analysis included NT-proBNP, ultra-sensitive troponin-I (c-TnI), serum amyloid A (SAA), insulin, glucose and IGF-1.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:20702..21010:sentences:2b38e6b1086338cad03e5a5a3b74316c	IGF1|TNNI3	IGF-1|cTnI	Test but not control diet showed a significant decrease over time for max-IVSd (P = 0.011), n-IVSd (P < 0.001), sum-IVSd (P < 0.001), M-IVSd (P = 0.023), max-LVWd (P = 0.002), n-LVWd (P = 0.035), sum-LVWd (P = 0.006), M-LVWd (P < 0.001) and n-(IVSd + LVWd) (P = 0.001), IGF-1 (P = 0.005) and cTnI (p = 0.001).
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:21243..21371:sentences:07ee0730150b38cdb4587c6e72acf0de	TNNI3|IGF1	c-TnI|IGF-1	A reverse effect on primary echocardiographic parameters of aHCM, with decreased c-TnI and IGF-1 was observed with the test diet.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:24843..25072:sentences:b12e33d144971e7498cd9478aea37860	CCHCR1|DBP	SBP|DBP	The combined effect of setting and sequence was associated with lower systolic (SBP), mean arterial (MAP) and diastolic BP (DBP) when BP was measured by the owner with the cat in its own carrier last in sequence (all; P < 0.0039).
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:25195..25366:sentences:613d1c76df66924180aa9e3448fa8f50	CCHCR1|DBP	SBP|DBP	When measurements were made with the cat on the examination table, higher coefficients of variation (CVs) were found for SBP, MAP, DBP and HR (all; P < 0.0001).. ESVC-O-12.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:53909..54388:sentences:49d7f2f63a2a9a8715114f3fb3ea3699	HP|||POMC|POMC|POMC	haptoglobin|ALP|GGT|ACTH|ACTH|ACTH	The results of the CS were compared with: serum cortisol concentration pre-trilostane (T0), 3 h-post-trilostane (T3) and 4 h-post-trilostane (1 h-post-ACTH) (T4) administration, plasma ACTH concentration pre-trilostane administration, plasma ACTH/cortisol (T0) ratio, serum haptoglobin concentration (Hp), chemistry variables (ALP, ALT, GGT), urinary cortisol/creatinine ratio and urine specific gravity (from urine of the evaluation's day and from the morning of the day before).
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:56860..57013:sentences:0faf513c972f17f8b3b28aa401fb34c8	PDP1|POMC	PDH|ACTH	pg/mL, 331 to >1250 pg/mL in healthy, OD and PDH cats, respectively; the only cat with ADH showed an ACTH value of 5 pg/mL (detection limit of the assay).
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:57170..57249:sentences:6965ca5713814f6978844750278a1d3b	PDP1|POMC	PDH|ACTH	Cats with PDH and PH had significantly higher ACTH values than the other groups.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:61457..61732:sentences:cce01c9adc34e4265625aed58c77f3ba	MC4R||	MC4R|DSH|DSH	In a previous genome-wide association study (GWAS), 4 single nucleotide polymorphisms (SNPs) were found to be associated with DM in lean Domestic Shorthair (DSH) cats, and a polymorphism in the MC4R gene was associated with DM in overweight DSH cats in a candidate gene study.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:63417..63569:sentences:ec2c1d423e6b23f3f01f6ace5d250f67	DPP10|DPP9|DPP4	DPP10|DPP9|DPP4	These SNPs are located within and close to DPP10 and DPP9 genes, respectively, which are related to DPP4, an enzyme involved in degradation of incretins.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:63731..63905:sentences:76d72f160f8b525c8f705ad922a0f252	DPP9|DPP10	DPP9|DPP10	Both DPP9 and DPP10 have been implicated in metabolic and immune functions, suggesting that further investigation of these genes in the pathogenesis of feline DM is warranted.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:64417..64565:sentences:5f10b8372aa305db15600b79dccbc799	GCG|INS	GLP-1|insulin	The objective of this study was to evaluate GV in cats receiving the GLP-1 analogue exenatide extended-release (EER) additionally to insulin therapy.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:78430..78637:sentences:3161f914b2f1b990d9f3ea5936a3ea77	EGF|NOG|RSPO1	EGF|Noggin|Rspondin-1 and Rock-inhibitor	Cells were subsequently seeded in Cultrex  Basement Membrane Extract and cultured to organoids in Advanced DMEM supplemented with N-acetylcysteine, B-27 supplement, EGF, Noggin, Rspondin-1 and Rock-inhibitor.
+SARS:0036b28fddf7e93da0970303672934ea2f9944e7:fulltext:12f1e47071b596aab19119579eba757a:78835..79032:sentences:54b957975f0d21dd60ba29426f841728	NKX2-1|TTF1|VIM|MKI67	thyroid transcription factor-1|TTF-1|vimentin|Ki-67	Immunohistochemistry (IHC) for thyroid transcription factor-1 (TTF-1), thyroglobulin (Tg), calcitonin, vimentin and Ki-67 was performed on sections of the primary tumors and organoids.. Disclosures.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:3220..3723:sentences:4a5431d5b5902b1268cb170029ba30e5	MX1|MX1|CRP	MxA|MxA|CRP	Myxovirus resistance protein A (MxA), a protein induced by type I interferon, is selectively elevated in patients with viral infections and has the potential to greatly enhance the rapid distinction between viral and bacterial respiratory infections [7, 8] . Combining CRP or PCT with an elevated MxA will help identify patients who most likely have viral infection, allowing physicians to consider reserving antibiotics in this patient population and proceed with a watchful, waiting strategy.. METHODS.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:3725..4249:sentences:eb4bb8be64ae722dedfd2abcf79278d1	MX1|CRP|CRP	MxA|C-reactive protein|CRP	Major databases, including MEDLINE and the Cochrane Library, were searched for prospective human clinical studies, including children and/or adults published between January 1966 and November 2017 that evaluated Myxovirus resistance protein A (MxA) as a biomarker for diagnosing viral infections as well as both C-reactive protein (CRP) and procalcitonin (PCT) as potential biomarkers for identifying and differentiating true bacterial upper respiratory infection (URI) from colonization.. Colonization and the Carrier State.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:8464..9139:sentences:b904dd8d0036a8f8f8cceaac4441eda0	MX1|MX1|IFNA1|TNFSF10|CXCL10|MX1	MxA|MxA|IFN-/|TRAIL|IP-10|MxA	Detection of interferons in serum is difficult and unreliable, mainly due to their short half-life [30] . In contrast, MxA has a long half-life of 2.3 days, low baseline level of less than 15 ng/mL, and a fast induction time of 1-2 hours after infection [32] . The low basal levels of MxA protein in tissues, its exclusive expression by type I IFNs, and its relatively long half-life make it an excellent biomarker for systemic IFN-/ production in viral infections.. Myxovirus Resistance Protein A. Recent studies show that other viral biomarkers, such as TNF-related apoptosis-inducing ligand (TRAIL) and IP-10, are less effective than MxA at differentiating viral infection.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:9141..9405:sentences:ec9b31c12850bb19127fdbe283af3247	TNFSF10|CXCL10|MX1|CRP	TRAIL|IP-10|MxA|C-Reactive Protein	TRAIL and IP-10 show area under the curve (AUC) specifically for viral infection of 0.72 and IP-10 of 0.72 [33] . Other studies further support the superiority of MxA as a biomarker for identifying a viral infection, especially in URI [3, 24] .. C-Reactive Protein.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:10455..11260:sentences:38cf5ebc045329e8d67feac47345059f	MX1|CRP|MX1|MX1|MX1|CRP|CRP|CRP|CRP	MxA|CRP|MxA|MxA|MxA|CRP|CRP|CRP|CRP	Typically, bacterial infection stimulates/elevates CRP while having no impact on MxA levels [29] . CRP elevates within 4-6 hours of infection, doubles every 8 hours, and peaks at approximately 36-50 hours [37] . Although less common than bacterial infection, viral pathogens such as adenovirus, parainfluenzavirus, influenza, respiratory syncytial virus, Epstein-Barr virus, herpes simplex virus, and varicella zoster virus can raise CRP levels significantly over 20 mg/L [7, 24-27, 30, 38] . Therefore, a test system that utilizes both CRP and MxA simultaneously can potentially differentiate viral infections from bacterial disease as the elevated CRP from a viral infection would also be associated with an elevation in MxA, whereas the MxA levels would be normal in bacterial infection.. Procalcitonin.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:16692..17126:sentences:73e9e45666587ec11bbb61464bb54506	MX1|CRP|MX1|CRP	MxA|CRP|MxA|CRP	Several clinical studies have verified that high MxA protein levels are strongly correlated with a systemic viral infection while elevated CRP levels are more closely associated with bacterial disease [3, 7, 8, [24] [25] [26] . Simultaneously performing CRP and MxA should predictably increase sensitivity and specificity for identifying bacterial disease.. The Role for Combining Biomarkers to Guide Outpatient Antibiotic Prescribing.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:17128..17896:sentences:07a8f5eca1d20f0b4d856cd299610ead	MX1|MX1|CRP|CRP	MxA|MxA|CRP|CRP	Combining MxA detection with a marker specific to bacterial infection, such as CRP, could be of greater predictive value and allow more reliable differentiation between viral and bacterial infections than using a marker of bacterial infection alone [7, 8, 24] . A high MxA with or without an elevated CRP would strongly suggest a viral infectious process and the absence of a bacterial infection [24] . Unlike the common occurrence of incidental identification of multiple pathogens in the OP or NP, true active co-infection that leads to a systemic viral and bacterial immune response is not common in URI [1, 8] . If both viral and bacterial pathogens are identified, an associated PCT 0.75 ng/mL or CRP 100 mg/L may support a diagnosis of a true co-infection result.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:17898..18106:sentences:649c3258e2bd0ee086de977b6f1977f5	CRP|MX1	CRP|MxA	Others have suggested that a defined ratio of CRP/MxA would optimize differentiation between a viral and bacterial infection [3] .. The Role for Combining Biomarkers to Guide Outpatient Antibiotic Prescribing.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:18108..18809:sentences:98ed89b533498c922884c23651a742f8	|CRP	CRP and MxA|CRP	Rapid CRP tests are shown to promote more prudent use of antibiotics in primary care and have led to a 19% reduction in antibiotic prescriptions [66] . A prospective, multicenter, cross-sectional study of adults and children with febrile URIs evaluated the diagnostic accuracy of a 15-minute, single-use disposable immunoassay that includes both CRP and MxA (FebriDx; RPS Diagnostics, Sarasota, FL) [8] . During a multicenter, US-based study that enrolled 370 patients, 205 symptomatic patients with URI and 165 asymptomatic patients from 10 clinical sites, including academic emergency departments and community care centers, demonstrated a 97% negative predictive value (NPV) for bacterial infection.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:18811..19370:sentences:1c99cf253c6d4e09c79b5d99e775a441	MX1|MX1|MX1|CRP|CRP|CRP	MxA|MxA|MxA|CRP|CRP|CRP	Also, the use of CRP independent of MxA would have led to overtreatment of 38% of viral infections [8] . The pattern of results from test systems with CRP or PCT combined with MxA may assist health care professionals to identify an immune response to a suspected viral and/or bacterial infection and greatly enhance antibiotic stewardship in the outpatient setting [7, 24] . This was recently demonstrated in a FebriDx study of 21 children and adults (mean age = 46 years) that evaluated the use of MxA plus CRP as a guide for outpatient antibiotic management.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:22144..22330:sentences:8d59de3f839c522969ee5c26b6825c54	MX1|CRP	MxA|CRP	Biomarkers such as CRP, PCT, and MxA respond differently to the host immune response and can help distinguish viral from a bacterial infection, including noninfectious causes of symptoms.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:22498..22894:sentences:1de693d001e770bbe1e8e732e2f9bf26	MX1|MX1|CRP|CRP	MxA|MxA|CRP|CRP	Although PCT and CRP are not specific enough to differentiate a viral from bacterial infection, these biomarkers in combination with MxA substantially improve the differential diagnostic accuracy [7, 9, 24] . The combined interpretation of MxA with either CRP or PCT dramatically improves both sensitivity and specificity for differentiating a viral from bacterial infection [7, 8] .. CONCLUSIONS.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:22896..23027:sentences:2ce60d00a9131f0a57c160a6718eedf2	CRP|MX1	CRP|MxA	A rapid point-of-care test that measures both CRP and MxA is available in Europe and Canada, but not currently in the United States.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:23029..23989:sentences:ee76170b3c852c637f006caf2c21f406	MX1|CRP	MxA|CRP	Utilization results of the FebriDx test in outpatient clinical practice are impressively encouraging, including diagnostic accuracy and positive impact on appropriate antibiotic prescribing [9] . The 97% NPV reduces the clinician's fear of missing a serious bacterial infection and supports watchful waiting, while the ability to demonstrate tangible results at the office visit can relieve patient pressures for antibiotic prescriptions [9] . A recent survey estimates that 85% of US primary care clinicians currently use a rapid strep test and 60% use a rapid flu test, oftentimes in the same patient [71] . A rapid point-ofcare test utilizing detection of both MxA and CRP without any required ancillary reader equipment would likely reduce the need for rapid strep and flu testing and provide direct cost savings while reducing indirect costs related to the cost of unnecessary antibiotics themselves, adverse events, and potential resistance.. CONCLUSIONS.
+SARS:01bc7fe59fc7feb0e3d23c716aa23a694a4362a2:fulltext:0343f317bc40b8d751d2775f7f0f904d:24225..24384:sentences:659c26313c9f4146d0887550a75c68b6	MX1|CRP	MxA|CRP	Incorporating point-of-care testing with a combination of biomarkers such as CRP and MxA can be extremely useful as an important adjunct to traditional methods.
+SARS:02f3b46f8b57185724327ab0f76b351ab2617d92:abstract:c7577b9ae7e3c5aa210ef506391d5cd2:200..348:sentences:63fb18256e96ed1518a2de67fa0d1e66	ISG15|UBC	ISG15|ubiquitin	ISG15, a di-ubiquitin-like protein, is one of the most abundantly induced ISGs and is critical for control of certain viral and bacterial infections.
+SARS:02f3b46f8b57185724327ab0f76b351ab2617d92:abstract:c7577b9ae7e3c5aa210ef506391d5cd2:350..415:sentences:413886733e2af41a5dab6ed41b1d80c5	UBC|ISG15	ubiquitin|ISG15	Like ubiquitin, ISG15 is covalently conjugated to target proteins.
+SARS:0330ede445d96dd0a27f474f945d6ce2e7085f15:abstract:be32bcfa3ff3272d7f1d77ec3d4565a3:522..700:sentences:0eb377848ed0b6d18bbfbe18432b61e8	GBF1|RSAD2|RSAD2	GBF1|viperin|viperin	Through analysis of the viperin-interactome, we identified the Golgi brefeldin A-resistant guanine nucleotide exchange factor 1 (GBF1) as the cellular protein targeted by viperin.
+SARS:0330ede445d96dd0a27f474f945d6ce2e7085f15:abstract:be32bcfa3ff3272d7f1d77ec3d4565a3:702..855:sentences:9b6abefdf8704d6bb11590af9d7f575f	RSAD2|GBF1|GBF1	Viperin|GBF1|GBF1	Viperin-induced antiviral activity, as well as C-particle release, was stimulated by GBF1 inhibition and knockdown and reduced by elevated levels of GBF1.
+SARS:0330ede445d96dd0a27f474f945d6ce2e7085f15:abstract:be32bcfa3ff3272d7f1d77ec3d4565a3:857..1021:sentences:f31a45bfe14c94dfbede20d001e2017a	RSAD2|GBF1	viperin|GBF1	Our results suggest that viperin targets flavivirus virulence by inducing the secretion of unproductive noninfectious virus particles via a GBF1-dependent mechanism.
+SARS:0330ede445d96dd0a27f474f945d6ce2e7085f15:abstract:be32bcfa3ff3272d7f1d77ec3d4565a3:1680..1886:sentences:d504f84eda8f4d7be210727a42bfcc49	RSAD2|GBF1	viperin|GBF1	In this study, we show that viperin induces capsid particle release by interacting and inhibiting the function of the cellular protein Golgi brefeldin A-resistant guanine nucleotide exchange factor 1 (GBF1).
+SARS:0330ede445d96dd0a27f474f945d6ce2e7085f15:abstract:be32bcfa3ff3272d7f1d77ec3d4565a3:1888..2070:sentences:8af4b679a8e745874e885a1bd914b1a9	GBF1|RSAD2|GBF1	GBF1|viperin|GBF1	GBF1 is a key protein in the cellular secretory pathway and is essential in the life cycle of many viruses, also targeted by viperin, implicating GBF1 as a novel putative drug target.
+SARS:0346cb9d0f5b07fe50d9a3cc0378a53f1a87708c:fulltext:fb4ba346274384f4c83c75aec53669e8:1313..1438:sentences:03b4f319f5578d8e84513d6147328060	TLR3|TLR4	TLR3|TLR4	The TLR3 agonist poly(IC) and the TLR4 agonist lipopolysaccharide (LPS) are protective against SARS-CoV infection in mice (1).
+SARS:0346cb9d0f5b07fe50d9a3cc0378a53f1a87708c:fulltext:fb4ba346274384f4c83c75aec53669e8:1624..2024:sentences:53ee359ae510b8d816e1dd40fa1281f5	TLR4|TLR4|MYD88	TLR4|TLR4|MYD88	The protective signaling via TLR4 pathways may be a unique feature in the pathogenesis of coronaviruses compared to other respiratory pathogens, such as influenza viruses (1) .. . Despite the opposite functions of TLR4s in AIV and SARS-CoV infections, MYD88 (myeloid differentiation primary response 88; downstream of TLRs) plays an important role in the survival of respiratory virus infections (Fig.
+SARS:036ad06896fe19b8af2183e9dc840b29da74982a:abstract:5f1f77308e1d1c9596615a81a5aac42d:0..104:sentences:65f8ef27e462c13c0254510bd93e8b76	RP9|KCNA3	PAP-1|Kv1.3	PAP-1 (5-(4-phenoxybutoxy)psoralen), a potent small-molecule blocker of the voltage-gated potassium Kv1.3
+SARS:036ad06896fe19b8af2183e9dc840b29da74982a:abstract:5f1f77308e1d1c9596615a81a5aac42d:1024..1180:sentences:de4df66b2b585907b950d0efa5bd51dd	CYP1A1|CYP3A4|CYP2D6|CYP2E1|CYP2C9|RP9	CYP1A1|CYP3A|CYP2D6|CYP2E|CYP2C9|PAP-1	Inhibitors of rat CYP1A1/2 (alpha-naphthoflavone) and CYP3A (ketoconazole) but not CYP2D6, CYP2E or CYP2C9 blocked the metabolism of PAP-1 in rat microsomes.
+SARS:036ad06896fe19b8af2183e9dc840b29da74982a:abstract:5f1f77308e1d1c9596615a81a5aac42d:1354..1517:sentences:d2d91a6b136c70a51e848521f24803ff	RP9|CYP1A1|CYP3A4	PAP-1|CYP1A1|CYP3A	M1 as the major phase-I metabolite, and suggest that hydroxylation and O-dealkylation are the major pathways of PAP-1 metabolism principally via CYP1A1/2 and CYP3A.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:title:85e3c3dd198c0aa150067b42e3cc294f:0..78:sentences:1cef48becfc0a354219780df4889265f	SIRT7|CDK9	SIRT7|CDK9	SIRT7-dependent deacetylation of CDK9 activates RNA polymerase II transcription
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:3170..4619:sentences:8782df66d5a996ebac3933a153445410	TBK1|IRF3|IRF7|IFNA1|TBK1|IRF3|TBK1|TBK1|TBK1|TBK1|KRAS|TBK1|TBK1	TBK1|IRF3|IRF7|type I interferons (IFN)|TBK1|IRF3|TBK1|TBK1|TBK1|TBK1|KRAS|TBK1|TBK1	TBK1 has been initially identified as a component of the antiviral response based on its ability to phosphorylate and thus activate IRF3 or IRF7 transcription factors, which in turn leads to inducible expression of type I interferons (IFN) (Fitzgerald et al., 2003; Sharma et al., 2003) . TBK1, IRF3, and further components for induced type I IFN signaling are known to translocate to perinuclear punctate structures (Saitoh et al., 2009; Seo et al., 2016) . Recent years have witnessed the identification of many additional TBK1 functions, which range from regulation of mitotic microtubule dynamics to the regulation of tumor necrosis factorinduced cell death (Lafont et al., 2018; Pillai et al., 2015; Xu et al., 2018) . Furthermore, stress-regulated TBK1 functions comprise its role in autophagy, mitophagy, and xenophagy (Heo et al., 2015; Pilli et al., 2012; Wild et al., 2011) . More recent evidence shows that TBK1 directly inhibits the AMP-activated protein kinase to increase energy storage and to repress respiration in adipose tissue, thus mediating a cross talk between immune signaling and metabolism . Basal TBK1 signaling is also required for the development of KRAS-driven cancers (Barbie et al., 2009) . Given the involvement of TBK1 in so many stress signaling pathways, TBK1 is a frequent target of viral proteins affecting its localization or protein-protein interactions (Liu et al., 2018; Onorati et al., 2016) .. INTRODUCTION.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:4712..5471:sentences:2deb19a8ac5e447d74af3e8892220467	TBK1|TBKBP1|TBKBP1|TANK|TANK|AZI2|AZI2|TBK1|AZI2|TBKBP1|TBKBP1|ULK1	TBK1|SINTBAD|TBKBP1|TANK|I-TRAF|AZI2|NAP1|TBK1|AZI2|SINTBAD|SINTBAD|ULK1	One possible answer to this conundrum might rely on the differential association of TBK1 to various adapter proteins, which co-determine its function (Goncalves et al., 2011) . These adapter proteins include SINTBAD (TBKBP1), TANK (I-TRAF), and AZI2 (NAP1) and serve to assist in substrate binding and also affect the subcellular localization of TBK1 (Helgason et al., 2013) . Although the adapter proteins lack any intrinsic enzymatic activity, they can affect biological functions, as exemplified by AZI2-and SINTBAD-regulated intracellular xenophagy of Salmonella (Thurston et al., 2009) . SINTBAD also facilitates activation of the autophagy-initiating kinase ULK1 to control interleukin (IL)-15-induced autophagy in natural killer T cells .. INTRODUCTION.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:5842..6057:sentences:17cba6df1fe311cdd38b6c9ece140f14	ULK1|KAT2A|KAT2A	ULK1|KAT2A|GCN5	The formation of inducible SINT-speckles is inhibited by the constitutive chaperone activity of heat shock proteins (HSPs) and ULK1 signaling, whereas KAT2A (also referred to as GCN5) promotes SINT-speckle formation.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:6059..6191:sentences:7332733481ca9677caaa572040adc011	AZI2|TBKBP1|TBK1	AZI2|SINTBAD|TBK1	The SINT-speckle components AZI2 and SINTBAD determine the threshold of TBK1 activation, which partially occurs within SINT-speckles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:6193..6402:sentences:17baf914b9c45caca153fbb48a0234ef	|TBK1|TBKBP1	ULK1/2|TBK1|SINTBAD	Knockdown of ULK1/2 was sufficient to trigger SINT-speckle formation, but interfered with focal TBK1 activation in a pathway-specific fashion.. Cell Stress Triggers the Formation of SINTBAD-Containing Speckles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:6976..7474:sentences:cc8468b7bd767e778e64039189d74adb	TBKBP1|AZI2|TANK|TBKBP1|TBKBP1|TBKBP1	SINTBAD|AZI2|TANK|SINTBAD|SINTBAD|SINTBAD	A western blot analysis revealed that treatment with heat shock triggered the time-dependent transition of SINTBAD from the soluble to the nuclear/insoluble fraction, whereas this dynamic redistribution between the fractions did not occur for the SINTBAD-related proteins AZI2 or TANK ( Figure 1A) . A similar inducible redistribution of SINTBAD also occurred in arsenite-treated 293T cells ( Figure 1B) , showing that various stressors can trigger the relocation of SINTBAD in different cell types.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:8848..8970:sentences:d4b033fe1c46b6fab7046c05f0184a26	TBKBP1|AZI2|TANK	SINTBAD|AZI2|TANK	Western blot was performed to detect the dynamic relocalization of the endogenous adapter proteins SINTBAD, AZI2, and TANK.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:9849..10137:sentences:a3e7cff0fca1ba1e25fa6c31e122d6d9	TBKBP1|AZI2|TANK	SINTBAD|AZI2|TANK	(D) Double-deficient (sgAZI2/sgSINTBAD) U2OS cells stably expressing FLAG-SINTBAD or transfected to express moderate amounts of FLAG-AZI2 or FLAG-TANK were treated with arsenite (0.5 mM, 1 h) or heat shock (43 C, 1 h) and analyzed by indirect immunofluorescence using anti-FLAG antibodies.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:10798..11127:sentences:6fa6cdd011bd95c21b87b68418614831	TANK|AZI2|TBKBP1	TANK|AZI2|SINTBAD	Staining of FLAG-tagged TANK did not reveal any arsenite or heat shockinduced changes of its cytosolic localization, whereas AZI2 already showed a speckled distribution in unstressed cells that was not further influenced by the indicated stressors ( Figure 1D ).. Cell Stress Triggers the Formation of SINTBAD-Containing Speckles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:11283..11475:sentences:ba402eea4a776823c238b63bb2ec973c	TANK|TBKBP1	TANK|SINTBAD	Cell treatment with arsenite or thermal stress triggered the formation of speckles, whereas TANK remained largely cytosolic and showed only minor colocalization with focal SINTBAD (Figure 2A ).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:11477..11600:sentences:cddde1a12b20e35ac8f77c527dc6c466	AZI2|TANK	AZI2|TANK	The speckled localization of AZI2 in control and stress-exposed cells showed no significant overlap with TANK ( Figure 2B ).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:11602..11892:sentences:7b1675a11803b2af920b9641b3a51be4	AZI2|TBKBP1|TBKBP1	AZI2|SINTBAD|SINTBAD	Interestingly, the coexpression of AZI2 and SINTBAD triggered the formation of speckles even in unstressed cells and displayed a very high degree of colocalization within these MLOs ( Figure 2C ).. Speckle Formation of SINTBAD Is Antagonized by the Chaperone Activity of Heat Shock Proteins.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:12567..13085:sentences:e965f1d8b3945eb35283ddca525aebf1	HSPA4|HSP90AA1|TBKBP1|HSPA4|HSP90AA1|TBKBP1	HSP70|HSP90|SINTBAD|HSP70|HSP90|SINTBAD	As chaperone function prevents aberrant phase transition of SGs (Mateju et al., 2017) it was interesting to test whether well-characterized inhibitors of HSP70 (VER155008, Pifithrin-m) or HSP90 (geldanamycin, radicicol) affect SINTBAD localization (Massey et al., 2010; Roe et al., 1999) . Inhibition of HSP70 or HSP90 function resulted in the formation of speckles even in the absence of stress signals ( Figure 3C ), revealing the importance of continuous chaperone function for the cytosolic localization of SINTBAD.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:13087..13235:sentences:b6a8880cf05b60570ec3e020cb614450	TBKBP1|HSPA4	SINTBAD|HSP70	Coimmunoprecipitation experiments showed the interaction between SINTBAD and HSP70, which was impaired under thermal stress conditions ( Figure 3D ).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:13237..13631:sentences:7f3c0a08590474f4ff16bd0daa0b34e1	TBKBP1|HSP90AA1|TBK1|HSP90AA1|TBK1|TBKBP1	SINT-BAD|HSP90|TBK1|HSP90|TBK1|SINTBAD	The interaction between SINT-BAD and HSP90 was only detectable after coexpression of TBK1 ( Figure 3E ), suggesting a rather indirect interaction that can be controlled by the relative abundance of the known HSP90 interactor TBK1 (Yang et al., 2006) or that the interaction is phosphorylation dependent.. SINTBAD-Containing Speckles Show No Colocalization with Cellular Organelles or Known MLOs.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:13633..14023:sentences:09b18ccf2e6e2a6309529f9ae4daa505	TBK1|TBKBP1	TBK1|SINTBAD	TBK1 and several of its interactors including optineurin and mitochondrial antiviral-signaling protein are known to be recruited to membrane-surrounded organelles such as mitochondria (Fang et al., 2017; Moore and Holzbaur, 2016) or upon RNA virus infection to the Golgi apparatus (Pourcelot et al., 2016) . Thus, we asked whether SINTBAD would be found in association with these organelles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:14347..14604:sentences:95ee2d0b4427e990be78eec85f4c3d94	EIF4G1|G3BP1|DCP1A	eIF4G|G3BP1|DCP1a	These experiments showed colocalization of speckles neither with the SG marker proteins eIF4G ( Figure 4B ) or Ras GTPaseactivating protein-binding protein 1 (G3BP1) nor with the P body marker DCP1a ( Figures S7A and S7B) . . Identification of SINT-Speckles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:16138..16237:sentences:c403f85668bb6dcfb2805a969f91d8df	HSP90AA1|MYC|TBK1	HSP90|Myc|TBK1	(E) 293T cells were transfected to express FLAG-HSP90 together with HA-SINTBAD or Myc-TBK1 as shown.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:16466..16674:sentences:20ad3d4f64b306b9906ce6d1dd8fa9ac	TBKBP1|PTPN23|AMBRA1	SINTBAD|PTPN23|AMBRA1	These experiments confirmed the results of the mass spectrometry analysis and are exemplified for the interaction of SINTBAD and the tyrosine phosphatase PTPN23 or the autophagy regulator AMBRA1 ( Figure 5B ).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:16676..16928:sentences:4cff69b04e064843c22df86100962bb9	TNIP2|TNIP2|TBKBP1|TBKBP1	ABIN2|TNIP2|SINTBAD|SINTBAD	Also, binding of ABIN2 (A20-binding inhibitor of nuclear factor-kB activation 2, also referred to as TNIP2) to SINTBAD was confirmed, and mapping experiments revealed the importance of the N-terminal region of SINTBAD for this interaction ( Figure 5C ).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:16930..17056:sentences:c020497ca6f5cc53387e394b1fa82700	TBKBP1|TNIP2	SINTBAD|ABIN2	Interestingly, expression of SINTBAD and all of its mutants led to an increase in ABIN2 protein levels by an unknown mechanism.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:18031..18263:sentences:814411510b778ee65f0625c15de5db3d	PTPN23|TBKBP1|PTPN23	PTPN23|SINTBAD|PTPN23	These experiments revealed that some of the proteins such as PTPN23 exactly mirrored the behavior of SINTBAD, as shown in Figure 5F . PTPN23 localizes in the cytosol of control cells and forms speckles after induction of cell stress.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:18265..18466:sentences:89e15ee9359a606ac7af8a2255391d9b	TBKBP1|PTPN23	SINTBAD|PTPN23	Costaining with SINTBAD revealed a complete colocalization in speckles after treatment with heat shock ( Figure 5F ) or arsenite ( Figure S8B ), confirming PTPN23 as a bona fide constituent of speckles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:18468..18654:sentences:007848b97398c886317c12c6689e89de	TBKBP1|KAT2A|	SINTBAD|KAT2A|ULK1/2	According to the ability of SINTBAD to bind and colocalize with further proteins we term these speckles inducible SINT-speckles.. Regulation of SINT-Speckle Formation by KAT2A and ULK1/2.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:19213..19408:sentences:482f1a235d5972e0d61e2960bb290e8a	TNIP2|PTPN23|AZI2|TBKBP1	ABIN2|PTPN23|AZI2|SINTBAD	The dominant effect of ABIN2 also occurred for PTPN23 ( Figure 6B , lower) and resembles that of AZI2, which was sufficient to trigger incorporation of SINTBAD into speckles (see Fig Figure S10 ).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:19581..19793:sentences:d570dcb9d6b4016cdd181c6c34838654	TBKBP1|ULK1	SINTBAD|ULK1	Coexpression of the kinase-inactive mutant with SINTBAD resulted in the formation of SINTspeckles even in unstressed cells, emphasizing the importance of ULK1 kinase activity for controlling SINTspeckle formation.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:19795..20232:sentences:024a4b77d032d5d988ded85248b78c5c	ULK1|ULK2	ULK1|ULK2	To determine the consequences of ULK knockdown on SINT-speckle formation we interfered with the expression of ULK1 and also ULK2, as both kinases can have redundant functions (Lee and Tournier, 2011; Li et al., 2016) . Loss of both kinases already triggered the formation of SINTspeckles even in unstressed cells ( Figure 6E ), supporting the finding that constitutive ULK signaling is important for restriction of SINT-speckle formation.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:20640..20779:sentences:9f70b9cdb1fa04d61fcf41379337b615	ULK1|TBK1|ULK1|TBK1	ULK1|TBK1|ULK1|TBK1	As expression of ULK1 can trigger TBK1 phosphorylation , we tested the effect of ULK1 expression on the localization of phosphorylated TBK1.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:20781..20988:sentences:cd011b02a6d438750e81180c041cac16	ULK1|TBK1|ULK1|TBK1	ULK1|TBK1|ULK1|TBK1	ULK1-expressing cells lacked any areas with focal TBK1 phosphorylation, as the activated kinase was found in the cytosol ( Figure 7A ), revealing that ULK1 can control the distribution of phosphorylated TBK1.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:20990..21172:sentences:84418b25b2fe2bab0c0e6c6f40a63a44	ULK1|ULK2|TBK1	ULK1|ULK2|TBK1	To test whether loss of ULK1 and ULK2 affects TBK1 phosphorylation in response to thermal stress, the expression of both kinases was downregulated with specific siRNAs ( Figure S11 ).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:21353..21539:sentences:45e5f285b3b354eb1253f527c63db1d0	|TBK1	ULK1/2|TBK1	Downregulation of ULK1/2 largely inhibited the heat shock-induced phosphorylation of TBK1 ( Figure 7B ), suggesting an important contribution of these kinases for this activation pathway.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:21541..21866:sentences:036b6bb739e82265553798446262627a	TBK1|ULK1|TBK1|TBK1	TBK1|ULK1|TBK1|TBK1	In contrast, arsenite-induced TBK1 phosphorylation was not changed by ULK1/2 knockdown and occurred to a significant part in SINTspeckles ( Figure 7B) , showing that the ULK kinases control phosphorylation of TBK1 in a pathway-specific manner.. SINT-Speckle Components Control the Amplitude and Localization of Activated TBK1.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:22200..22453:sentences:1250c6d2d339faf49035340f67b90ab9	TBKBP1|TBK1|TBKBP1|AZI2|TBK1	SINTBAD|TBK1|SINTBAD|AZI2|TBK1	To investigate a possible contribution of SINTBAD for the activation of TBK1, SINTBAD and AZI2 double-deficient U2OS cells were treated for various periods with arsenite and TBK1 activation was assessed with a phospho-specific antibody by immunoblotting.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:22455..22615:sentences:9a96a61264109f80f3e43943ef5b5ce1	TBKBP1|TBKBP1|AZI2|TBK1	SINTBAD|SINTBAD|AZI2|TBK1	Knockout of SINTBAD alone had no effect (data not shown), whereas cells lacking SINTBAD and AZI2 ( Figure S2 ) showed reduced TBK1 phosphorylation ( Figure 7D ).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:22617..22820:sentences:af5c6c990e8c24c950ab360c14e718a6	TBKBP1|AZI2|ULK1|TBK1|ULK1|TBKBP1|AZI2	SINTBAD|AZI2|ULK1|TBK1|ULK1|SINTBAD|AZI2	To investigate the contribution of SINTBAD and AZI2 for ULK1-induced TBK1 phosphorylation by an independent experimental approach, cells were transfected to express ULK1 together with SINTBAD and/or AZI2.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:22822..23050:sentences:5dec6552f560613013fbe57245dafac3	ULK1|TBK1|TBKBP1|AZI2|TBK1	ULK1|TBK1|SINTBAD|AZI2|TBK1	Immunoblotting revealed that ULK1-triggered TBK1 phosphorylation was further enhanced by SINTBAD and AZI2 ( Figure 7E ), corroborating the finding that both adaptor proteins contribute to control of the TBK1 activation threshold.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:23052..23157:sentences:21030e460c7ffed56c3657ae39701e65	TBKBP1|AMBRA1	SINTBAD|AMBRA1	(B) 293T cells were transfected to express hemagglutinin (HA)-SINTBAD along with GFP-AMBRA1 or GFP-PTPN23.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:23420..23618:sentences:3e25a6b59dc6ded7d164db4e5c6712a7	TNIP2|TBKBP1	ABIN2|SINTBAD	(C) An expression plasmid encoding HA-tagged ABIN2 was transfected into 293T cells together with various FLAG-SINTBAD truncation mutants (DN1: 106-615 amino acid [aa], DN2: 165-615 aa, DC: 1-520 aa).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:24578..24785:sentences:80ddb43453cc407b0f5fc2fc5e0d40ee	TBKBP1|PTPN23|PTPN23	SINTBAD|PTPN23|PTPN23	(F) U2OS cells were transfected to express the SINTBAD interactor PTPN23 alone and were left untreated or exposed to heat shock, followed by the analysis of GFP-PTPN23 localization by fluorescence microscopy.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:24787..24884:sentences:dc1e670150d915a21c572a4e087bc4af	PTPN23|TBKBP1	PTPN23|SINTBAD	In addition, cells cotransfected to express GFP-PTPN23 and FLAG-SINTBAD were treated the same way.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:25100..25357:sentences:2b45ffcf765b39ce01404f2a03e6fd00	TBKBP1|KAT2A|KAT2A	SINTBAD|KAT2A|KAT2A	. Characterization and Regulation of SINT-Speckles (A) U2OS cells were transfected to express the SINTBAD interactor KAT2A alone and were left untreated or exposed to heat shock, followed by the analysis of FLAG-KAT2A localization by fluorescence microscopy.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:25461..25779:sentences:f41c9411ebd03728c14291c8c8ee8f2f	TNIP2|NFKB1|TNIP2	ABIN2|p105|ABIN2	The severe fever thrombocytopenia syndrome phlebovirus non-structural protein S (NSs) targets the ABIN2/p105 complex to activate proviral signaling cascades (Choi et al., 2019) . As ABIN2 is a core component of SINT-speckles it was interesting to investigate whether the NSs protein also can be recruited to these MLOs.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:26751..27198:sentences:162ab3918b42545addef2544eed14fd3	TNIP2|AZI2|TBKBP1	ABIN2|AZI2|SINTBAD	Core components of constitutive SINT-speckles such as ABIN2 and AZI2, and also the inducible interactor SINTBAD, are predicted to harbor long intrinsically disordered regions ( Figure 9A , Table S1 ), which are typical for MLO-resident proteins (Elbaum-Garfinkle et al., Nott et al., 2015; Uversky and Dunker, 2010) . Accordingly, about one-third of the SINT-speckle proteins (47 from 150) are predicted to have >40% disordered regions (Table S1 ).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:27377..27853:sentences:271c7a95c29e1800b6023ca08c742cce	TNIP2|TNIP2|TNIP2|TNIP2|AZI2	ABIN2|ABIN2|ABIN2|ABIN2|AZI2	Another possible mechanism could involve the bridging of two ABIN2 dimers by binding to M1-linked tri-ubiquitin chains, which might facilitate ABIN2 assembly to higher-order signaling complexes (Lin et al., 2017) . Also, changes in the relative expression levels of ABIN2 speckle components affect the formation of these MLOs, explaining the abundant finding that expression of a given protein such as ABIN2 or AZI2 can affect the intracellular localization of its interactors.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:27855..28174:sentences:ab1f016fd427120b4bb52a32e1524667	TIA1|G3BP1	TIA1|G3BP1	This behavior is characteristic for MLO formation, and accordingly, also overexpression of SG components such as TIA1 or G3BP1 is sufficient to trigger formation of SGs (Kedersha and Anderson, 2007) . This implies that physiological variations in the amounts of SINTspeckle proteins can already affect speckle formation.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:28176..28474:sentences:5c7d63adae4b2e9c80c6c5800db2b1a0	TNIP2|MAP3K8|	ABIN2|TPL2|IKKa/b	Regulation of ABIN2 protein levels occurs in the presence of increased glucose levels or by the kinases TPL2 or IKKa/b (Chen et al., 2013; Leotoing et al., 2011; Nanda et al., 2018) , and it will thus be interesting to investigate whether these situations will affect the formation of SINT-speckles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:29113..29289:sentences:f9258e6004bb05bbe4eae567b5883e26	KAT2A|TBKBP1	KAT2A|SINTBAD	Interestingly, a recent study showed that, vice versa, SINTBAD Figure 6 . Continued cotransfected to express FLAG-KAT2A and hemagglutinin (HA)-SINTBAD were treated the same way.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:29413..29557:sentences:7573e9e566957db7ac1d7832e6e17a2e	TNIP2|TBKBP1	ABIN2|SINTBAD	(B) Upper: The experiment was done as in (A) with the difference that HA-ABIN2 was expressed either alone or together with FLAG-SINTBAD as shown.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:29559..29727:sentences:4021552627ab1f0894163ebe4521e4ed	PTPN23|TNIP2	PTPN23|ABIN2	Lower: Cells were cotransfected to express GFP-PTPN23 and HA-ABIN2, followed by exposure to heat shock and the analysis of colocalization by immunofluorescence as shown.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:29764..29850:sentences:d2d481227efc59fc1b3f9d1a0493fbe6	ULK1|TBKBP1	ULK1|SINTBAD	(C) U2OS cells were transfected to express HA-ULK1 alone or together with FLAG-SINTBAD.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:30169..30330:sentences:699310537d1dd401ca9775cf40560d4d	TBKBP1|ULK1|ULK2	SINTBAD|ULK1|ULK2	(E) Reconstituted SINTBAD-deficient U2OS cells were treated for three days with siRNAs specifically targeting ULK1 and ULK2 or alternatively with a control siRNA.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:30475..30761:sentences:3a380c3a4bba5c2cca069447fb2feef0	TBKBP1|TBK1	SINTBAD|TBK1	(F) Reconstituted SINTBAD-deficient U2OS cells were exposed to arsenite or heat shock, and FLAG-SINTBAD was costained with antibodies against phosphorylated TBK1 (S172) as a centrosome marker (Pillai et al., 2015) . The DNA was stained with Hoechst, and only mitotic cells were analyzed.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:31390..31811:sentences:f7e124d656fddfaf74c03055587890ca	HIPK1|HIPK2|DYRK3|TBKBP1|PML	HIPK1|HIPK2|DYRK3|SINTBAD|PML	The related kinases HIPK1 and HIPK2 decrease the size and number of PML-NBs during the cell cycle (Berchtold et al., 2018) , and active DYRK3 facilitates the dissolution of several types of MLOs during mitosis (Rai et al., 2018) . Kinase-dependent mechanisms might also contribute to the elimination of SINT-speckles during mitosis, a process that is accompanied by massive SINTBAD phosphorylation (Figures S12A and S12B).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:32774..32913:sentences:8dbd05ef707d5752a81c856d50d6d1da	AZI2|TBK1|TBKBP1	AZI2|TBK1|SINTBAD	SINTBAD together with AZI2 controls the threshold of TBK1 phosphorylation, as revealed by loss-of-function and gain-of-function experiments.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:34123..34786:sentences:45d496502392a4bd1efe337b22d84706	TBK1|TBK1|TBKBP1|TANK|AZI2|TBK1|TBK1|IRF3	TBK1|TBK1|SINTBAD|TANK|AZI2|TBK1|TBK1|IRF3	This local enrichment of phosphorylated TBK1 is frequently seen by immunofluorescence and can occur in diverse subcellular localizations (Moharir et al., 2018; Pourcelot et al., 2016) . The localization of TBK1 is also controlled by differential interaction with adaptor proteins including SINTBAD, TANK, and AZI2, which compete for binding to a C-terminal interaction domain in TBK1 (Goncalves et al., 2011) . Contrary to the initial assumption that the TBK1 adaptor proteins control the antiviral function of the kinase, recent publications have shown their dispensability for IRF3 activation (Fang et al., 2017) .. Possible Functions of Inducible SINT-Speckles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:34947..35379:sentences:1a1aced3198f57d2a67421ef9fb3f19e	TBKBP1|TBK1|ULK1|TBK1	SINTBAD|TBK1|ULK1|TBK1	The smallest group of SINTBAD interactors comprises the expected group of innate immune regulators, but interestingly the largest group is formed by enzymes and Figure 7 . Regulation of TBK1 Phosphorylation by Inducible SINT-Speckles (A) U2OS cells were transfected to express hemagglutinin (HA)-ULK1 and stained for the localization of HA-ULK1 and phosphorylated TBK1 (S172) as shown.. Possible Functions of Inducible SINT-Speckles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:35381..35547:sentences:8a4a02561d752e1c601bb43b8dfd78d0	TBKBP1|ULK1|ULK2	SINTBAD|ULK1|ULK2	(B) U2OS cells stably expressing FLAG-SINTBAD were treated for 3 days with siRNAs specifically targeting ULK1 and ULK2 or alternatively with a scrambled siRNA (siSCR).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:35549..35752:sentences:2832b54ae6d98ead586b26ab3cb67359	TBKBP1|TBK1	SINTBAD|TBK1	Cells were left untreated or exposed to arsenite or heat shock and analyzed by immunofluorescence microscopy for the intracellular distribution of SINTBAD and phosphorylated TBK1 with specific antibodies.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:35931..36109:sentences:de0329ddc5beef0e4af776b6f7dbaac1	TBKBP1|TBK1	SINTBAD|TBK1	(C) U2OS cells stably expressing FLAG-SINTBAD were treated with arsenite or heat shock and stained for the intracellular localization of SINTBAD and TBK1 with specific antibodies.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:36243..36450:sentences:44c63192dc999f5400a113e231b69506	TBKBP1|AZI2	SINTBAD|AZI2	(D) U2OS wild-type (WT) cells and two U2OS cell clones (DKO #1 and #2) lacking SINTBAD and AZI2 expression due to CRISPR/Cas9-mediated gene editing were treated for the indicated periods with 0.5 mM arsenite.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:36452..36619:sentences:61214052394c6e0a2320f0f945d1b99f	TBK1|MAPK1|	TBK1|p38|ERK1/2	Phosphorylation of TBK1 and MAP kinases (p38, ERK1/2) was determined by immunoblotting with phospho-specific antibodies as shown, to ensure successful cell stimulation.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:36734..36842:sentences:2faa1228395f1609c32d4cc06c3c32d3	ULK1|TBKBP1|AZI2	ULK1|SINTBAD|AZI2	(E) 293T cells were transfected to express HA-tagged ULK1 WT along with FLAG-tagged SINTBAD or AZI2 as shown.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:37145..38970:sentences:becfc1fdb9daba6df11fd7d2320a223f	TNIP2|TBKBP1|IL15|TBK1|TRAF6|TBKBP1|TBK1	ABIN2|SINTBAD|IL-15|TBK1|TRAF6|SINTBAD|TBK1	This might indicate a role of SINT-speckles in metabolic regulation as a mediator of the cross talk between innate immunity and metabolism (Hotamisligil, 2017; Joseph et al., 2018; Jung et al., 2019) . Interestingly, the ULK kinases have also been implicated in the regulation of glucose metabolic fluxes and lipid metabolism (Ro et al., 2013) . In addition, metabolic processes co-determine effector functions and cell fate decisions of cells from the innate and adaptive immune systems (Ganeshan and Chawla, 2014; Odegaard and Chawla, 2013) . Vice versa, immunomodulatory signals such as cytokines directly regulate metabolic hormones or pathways (K nner and Br ning, 2011; Matsuki et al., 2003) . The second largest group is formed by proteins involved in vesicle trafficking and autophagy, which is consistent with a previous study identifying ABIN2 as a hub protein binding to components of the endosomal sorting complex (Banks et al., 2016) . This set of interactors might be also relevant for the recently uncovered role of SINTBAD as a regulator of IL-15-induced autophagy , adding to the emerging role of innate immune signaling proteins such as TBK1 and TRAF6 for the formation of autophagosomes Pilli et al., 2012; Shi and Kehrl, 2010; Thurston et al., 2009) . The third largest group of the SINTBAD interactome comprises regulators of mitosis and components of the cytoskeleton, in line with previous reports, documenting a function of TBK1 as a centrosome-associated regulator of mitotic microtubule dynamics (Pillai et al., 2015; Kim et al., 2013) . Although this study focuses on the identification and cell biological characterization of SINT-speckles, future studies must comprehensively characterize the function(s) of constitutive and inducible SINT-speckles.. Possible Functions of Inducible SINT-Speckles.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:39947..40574:sentences:5009af8e742b5c57d4491056863ae849	TBK1|TBK1|TBKBP1	TBK1|TBK1|SINTBAD	Interestingly, partial loss of TBK1 causes protein misfolding diseases, namely, familial amyotrophic lateral sclerosis and frontotemporal dementia (Freischmidt et al., 2015; Gijselinck et al., 2015) . Also, mutations in TBK1 and its substrate protein optineurin contribute to frontotemporal lobar degeneration (Le Ber et al., 2015; Pottier et al., 2015) . This disease is also associated with an elevated SINTBAD expression (Broce et al., 2018) , and it will be very interesting to reveal in future studies whether the formation and function of SINT-speckles is affected in neurodegenerative diseases.. Limitations of the Study.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:40576..40716:sentences:3e144b3d512672d81aaee14223736d70	|KAT2A	ULK1/2|KAT2A	In the present study we define components of constitutive and inducible SINT-speckles and reveal their regulation by ULK1/2, HSPs, and KAT2A.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:43978..44224:sentences:9e9a26e0afff057fbe6711786420d2f6	TNF|TLR4	TNF|TLR4	In addition, HEK-TLR4 cells were treated with 1 g/ml LPS (1, 2, 4 h), U2OS cells with 10 ng/ml IL-1 (0.5, 1.5, 5 h) and HEK293 cells with 20 ng/ml TNF (30, 60, 90 min).. Generation of CRISPR/Cas9-mediated knockout cells and reconstitution of them.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:44226..44522:sentences:f6f72ab9f404ed5e4a9a07a2c9fe75ee	TBKBP1|AZI2|TBKBP1|TBKBP1	SINTBAD|AZI2|SINTBAD|SINTBAD	In order to generate SINTBAD-and/or AZI2-deficient U2OS cells, CRISPR/Cas9-mediated genome editing technology was performed as described (Ran et al., 2013) . The target site for human SINTBAD was designed as an anti-sense sgRNA (5-CGTAGACTTTGAGGCGGCGT-3) within the first exon of the SINTBAD gene.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:45001..45056:sentences:b1271c0777c226e6cdfffadca9b3258f	TBKBP1|AZI2	SINTBAD|AZI2	These clones were picked and analyzed for SINTBAD, AZI2.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:45307..45450:sentences:b024d961ead57bfc27df3b9bdcf50d7c	TBKBP1|AZI2|TBKBP1	SINTBAD|AZI2|SINTBAD	To obtain SINTBAD/AZI2 double-deficient cells, a SINTBAD-deficient cell clone was transfected with px459-sgAZI2 and selected as described above.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:45636..45726:sentences:324d48fe66ce5c102cfb0a64e350684f	ULK1|ULK2	ULK1|ULK2	Singlecell clones were picked an analyzed by Western blotting.. Knockdown of ULK1 and ULK2.
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:45728..46035:sentences:5a3ea54ec50539788229a86eb83d36b9	TBKBP1|ULK1|ULK2	SINTBAD|ULK1|ULK2	Reconstituted U2OS cells stably expressing Flag-SINTBAD were treated with 1 M ULK1 and ULK2-specific Accell siRNAs (Dharmacon #A-005049-13-0005 and #A-005396-14-0005) or with a scrambled control RNA (Seibert et al., 2019) according to the protocol using Accell siRNA Delivery Media (Dharmacon #B-005000-500).
+SARS:00d4ff0cfe5582b3f2746b2a33d67f6bd4307e98:fulltext:7c4f66a202a3bbb00031a55306b24b3b:46037..46517:sentences:41b68f7c1a7989d96b9f08a5c53b3661	ACTB|ULK1|ULK2	ACTB|ULK1|ULK2	Three days after siRNA transfection, half of the cells were seeded on coverslips and used for immunofluorescence staining and the remaining cells were analyzed for efficient knockdown by real time qPCR, using the following primers specific for ACTB (5-CATGTACGTTGCTATCCAGGC-3, 5-CTCCTTAATGTCACGCACGAT-3), ULK1 (5-ACCCCATTACTGCGAACCTGGA-3, 5-GCACGAACAGCAGCGTGAAGC-3) and ULK2 (5-TCTGCATCACCATGTGCAAGAA-3, 5-AACATCTCATCCAGGGCT-3).. Cell lysis protocols and subcellular fractionation.
+SARS:03d40dcd5d29728439528bd955afcba42bc0c2b9:abstract:02b143a057ca6187b3f8de981b557f65:845..1038:sentences:a5140c6ae6e573697f919fb0ff018fed	HMHA1|FANCB	HA1|Fab	Further, we found that this HA1-specific human mAb can efficiently block both virus-receptor binding and post-attachment steps, while its Fab fragment exerts the post-attachment inhibition only.
+SARS:03b459a3edd40cbc8e647159775772456caf2d01:abstract:7d3b24e37d0acfad4e1b4f5a341f9d0e:474..673:sentences:8796db0d234e482068199ff574323384	HAVCR2|HAVCR2|CD14|FCGR3B|NCAM1	Tim-3|Tim-3|CD14|CD16|CD56	Results Tim-3 expressions on peripheral CD3+ T cells and CD8+ T cells in ICH patients are significantly downregulated, while Tim-3 expressions on CD14+ monocytes and CD16+CD56+ NK cells are increased.
+SARS:040765d9c62b33f0a74bb4d3732d4d345f7d6c30:abstract:310d95b841f0be0dd1108ad2c24b51f4:418..581:sentences:cffcc68908acae72f248ba2c57061827	|STX1A|STX1A|STX1A|STX2|STX2|STX2	K99/STa|Stx1|Stx1|Stx1|Stx2|Stx2|Stx2	Virulence factors of Escherichia coli were identified in 103 strains: eae (7), K99/STa (7), Stx1 (7), Stx1/eae (36), Stx1/Stx2/eae (2), Stx2 (43), and Stx2/eae (1).
+SARS:040765d9c62b33f0a74bb4d3732d4d345f7d6c30:abstract:310d95b841f0be0dd1108ad2c24b51f4:583..773:sentences:9fc050db8c6456be03fa96ce02900490	STX1A|STX2	Stx1|Stx2	There was statistical association between diarrheic animals carrying E. coli Stx1/eae (+) in their feces at 2 and 4 weeks of age (P = 0.003) and E. coli Stx2 (+) at 5 weeks of age (P = 0.03).
+SARS:0435b8c5081db34e2c6c62b8f7b998927fa28776:abstract:071bef0b5539e32d30b1ffea33a21408:418..576:sentences:9d1f9f3dd3a4e7b89cd7e105e51fea03	G6PD|INS	G6PD|insulin	Altered G6PD activity is associated with pathophysiology, such as autophagy, insulin resistance, infection, inflammation, as well as diabetes and hypertension.
+SARS:0440e70beeefb9c36921bb8032ac02816f3c27a3:title:9690a30c84b671da833ecbfd25bc3944:0..136:sentences:38c2c747a403708002115884fce87d4e	INS|GH1	insulin|growth hormone	Alterations of growth hormone, cortisol, luteinizing hormone, and insulin concentrations in early-postnatal calves affected with diarrhea
+SARS:04510f144938a17bf2c2a9683ce3479ff0246b94:abstract:edeb6235bf1175a72878f3394634d824:118..293:sentences:8a8c094697f6347d4b1b0f3f262debcd	MAP2K3|MAPK14	MAP2K3|P38 MAPK	We previously demonstrated microRNA-21 has potential inhibitory effect on the MAP2K3 which locates upstream of P38 MAPK and was upregulated in mouse hearts upon CVB3 infection.
+SARS:04510f144938a17bf2c2a9683ce3479ff0246b94:abstract:edeb6235bf1175a72878f3394634d824:386..712:sentences:77c7f4a2b24b0fbde0d3771e05768b1a	MIR21|MAPK14|MAPK14|MIR21	miRNA-21|P38 MAPK|P38|miRNA-21	METHODS: We detected continuous changes of cellular miRNA-21 and P38 MAPK proteins expression profiling post CVB3 infection in vitro within 12 h. P38 MAPK signaling was inhibited by the specific inhibitor, small interfering RNA and miRNA-21 mimic in vitro, CVB3 replication, cell apoptosis rate and proliferation were detected.
+SARS:04510f144938a17bf2c2a9683ce3479ff0246b94:abstract:edeb6235bf1175a72878f3394634d824:898..1051:sentences:8610e1eb2d29f4072708fa543fd5ff07	MIR21|MAP2K3|MAPK14	miRNA-21|MAP2K3|P38 MAPK	RESULTS: We observed significant upregulation of miRNA-21 expression followed by suppression of the MAP2K3/P38 MAPK signaling in CVB3-infected Hela cells.
+SARS:04510f144938a17bf2c2a9683ce3479ff0246b94:abstract:edeb6235bf1175a72878f3394634d824:1053..1270:sentences:aac6ec60d2b5ea11de3856ca67c1fdd0	MAP2K3|MAPK14|MAPK14|MAP2K3|MIR21	MAP2K3|P38 MAPK|P38|MAP2K3|miRNA-21	The inactivation of the MAP2K3/P38 MAPK signaling by P38 MAPK specific inhibitor, small interfering RNA against MAP2K3, or miRNA-21 overexpression significantly inhibited viral progeny release from CVB3-infected cells.
+SARS:04510f144938a17bf2c2a9683ce3479ff0246b94:abstract:edeb6235bf1175a72878f3394634d824:1631..1966:sentences:95073dc0169afe9eb85e2156459325ec	MIR21|MAP2K3|MAPK14	miRNA-21|MAP2K3|P38 MAPK	In the in vivo study, when compared with control miRNA, miRNA-21 pretreatment remarkably inactivated the MAP2K3/P38 MAPK signaling in mice and protected them against CVB3 infection as evidenced by significantly alleviated cell apoptosis rate, reduced viral titers, necrosis in the heart as well as by remarkably prolonged survival time.
+SARS:04510f144938a17bf2c2a9683ce3479ff0246b94:abstract:edeb6235bf1175a72878f3394634d824:1968..2328:sentences:f5a1dd43b46a54cc06dca0996d457f19	MIR21|MAPK14|MIR21|MIR21|MAP2K3|MAPK14	miRNA-21|P38|miRNA-21|miRNA-21|MAP2K3|P38	CONCLUSIONS: miRNA-21 were reverse correlated with P38 MAPK activation post CVB3 infection, miRNA-21 overexpression significantly inhibited viral progeny release and decreased myocytes apoptosis rate in vitro and in vivo, suggesting that miRNA-21 may serve as a potential therapeutic agent against CVB3 infection through targeting the MAP2K3/P38 MAPK signaling.
+SARS:044b6504465e3d1b00fcc328c6731bcd034b1691:abstract:a020fb741c2f15e48bf5bfe4bcadd106:1114..1424:sentences:f210bf8f4a7138c9e1aa9cb9f350f26f	HNRNPA1|EIF4G1	hnRNPA1|eIF4G1	Based on the comparative analysis, we proposed that different changes induced by YN13 and YN144 in heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1), eukaryotic initiation factor 4G1 (eIF4G1), and some members in the heat shock protein (HSP) family, may be responsible for differences in their pathogenicity.
+SARS:04510f144938a17bf2c2a9683ce3479ff0246b94:title:81d734a16abcb0d0ec101dcd0143998f:0..125:sentences:7c3f295ee0f44a7e3cb5d2ad577d553d	MAP2K3|MAPK14	MAP2K3|P38	The protective role of microRNA-21 against coxsackievirus B3 infection through targeting the MAP2K3/P38 MAPK signaling pathway
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:420..696:sentences:9a8eb7a832175b06694dec410450c949	IVNS1ABP|NPTX1	NS1|NP1	HBoVs are small nonenveloped single-stranded DNA viruses of about 5300 nucleotides, consisting of three open reading frames encoding the first two the non-structural protein 1 (NS1) and nuclear phosphoprotein (NP1) and the third the viral capsid proteins 1 and 2 (VP1 and VP2).
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:7084..8560:sentences:1e9f5aeec99fb466b537e51d007e5e69	|IVNS1ABP|NPTX1|ASZ1|IVNS1ABP|HFM1|IVNS1ABP|NPTX1	ORF1|NS1|NP1|ORF3|NS1|helicase|NS1|NP1	Meanwhile, the HBoV2-C2 circular genome (5307 nt, of which 520 nt represent the non-coding terminal region) has been detected as well [41] . A recent study demonstrated that the replicative form of the HBoV4 genotype comprises a head-to-tail nucleotide sequence in circular form [40] . Future research efforts delving deeper into the HBoV replication mechanism are likely to improve our comprehension of the pathogenetic role of HBoV substantially [37] . The genome of HBoV is organized in three open reading frames (ORFs): ORF1, encoding two forms of the non-structural (NS) protein NS1; ORF2, encoding an additional NS protein, the nuclear phosphoprotein NP1 [38, 42] ; and, ORF3, encoding the two structural viral capsid proteins VP1 and VP2, which are generated as a result of alternative splicing events [1] . The non-coding regions contain palindromic sequences, commonly known as inverted terminal repeats, that are essential for viral replication [37, 43] . NS1 is a multifunctional protein that has various sites with differing functions in the N-terminus (binding and endonuclease), C-terminus (transactivation) and middle region (ATPase and helicase) [44, 45] . Furthermore, NS1 has a role in DNA replication, and, similar to NP1, its function is essential for DNA replication of CMV and minute virus of mice [46] . This non-structural protein also participates in apoptosis, cell-cycle arrest and gene transactivation in B19V [47, 48] .. CLASSIFICATION AND BIOLOGY.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:8562..8833:sentences:e718bb61beba3ccdb703188070181df8	SOS1|KRAS|	NS4|NS3|NS2	Recently, novel small NS proteins (NS2, NS3 and NS4) have been identified in HBoV1 through studies based upon transfection of an HBoV1 infectious proviral plasmid and viral infection of polarized human airway epithelium cells cultured at an air-liquid interface (HAE-ALI).
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:9018..9207:sentences:bace90055215c7cdd1aa3bb984551e7f	NPTX1|	NP1|NS2	NS2 plays a critical role in HBoV1 replication in HAE-ALI cultures as well [49] . NP1 is also a small non-structural protein, but for which the function(s) still need to be fully elucidated.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:9209..9965:sentences:2efc8dcc9908c7aa8bd1bc140d80ef98	NPTX1|PLB1	NP1|phospholipase A2	Initially, NP1 from HBoV1 was shown to induce cell cycle arrest and apoptosis after transfection in HeLa cells [50] . Recent studies, however, have shown that HBoV1 NP1 plays a critical role in the expression of viral capsid proteins [51] and demonstrated its direct involvement in viral DNA replication at the replication origin (OriR) [52] . VP1 and VP2 share a C-terminal region and differ only in the N-terminal region of VP1 (VP1u) [53] . VP1u exerts phospholipase A2 activity, which is essential for infectivity and is facilitated by release of the virus from endocytic compartments to the nucleus of the host cell [42] . To date, the mechanism underlying the viral cell entry and in vivo host-range remains unclear [36] .. CLASSIFICATION AND BIOLOGY.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:10021..10290:sentences:e69093919e171e1682dc2ca048e69a4c	NPTX1|IVNS1ABP	NP1|NS1	is 1928 nt long and encodes a polypeptide of 643 amino acid (aa) residues, much shorter than the NS1 of CMV and of BPV [46, 54] . The HBoV1 NP1 gene is 660 nt long and its encoded protein varies in length among the different strains, ranging from 214 to 219 aa residues.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:10913..11055:sentences:5161efcf33ecc3b0f2a22d7d860b5961	IVNS1ABP|NPTX1	NS1|NP1	Remarkably, HBoV3 NS1 and NP1 sequences cluster with the homologous sequences of the HBoV1 strain, and the same holds true for HBoV2 and HBoV4.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:12324..12543:sentences:c6a950a107227ce27a80b8551c12b05a	IVNS1ABP|NPTX1	NS1|NP1	were obtained using the Illustrator of Biological Sequences software package [55] . The genes encoding the protein NS1 (non-structural protein), NP1 and VP1/VP2 (capsid proteins) and their nucleotide positions are shown.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:19326..19912:sentences:4d2f7cbdb3338cd7313c860fd32baca7	IL2|IL4|	interferon-gamma (IFN-), interleukin (IL)-2|IL-4|IL-10 and tumour necrosis factor-alpha	Their direct activities are exerted via their production of antiviral cytokines, whereas their indirect activities are mediated via the Th patterns that promote B cells and cytotoxic T cells [95] . In a study of NPA from children with acute bronchiolitis, Chung et al [96] demonstrated higher concentrations of interferon-gamma (IFN-), interleukin (IL)-2 and IL-4 in the HBoV-positive subjects, compared to the asymptomatic controls; however, the cytokine levels of IL-10 and tumour necrosis factor-alpha were lower than those found in RSV-positive children.. CLASSIFICATION AND BIOLOGY.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:19914..20145:sentences:61cba41a4d17a3dd08bad509fe6edc98	IL10|IL13|NELFCD	IL-10|IL-13|Th1	Furthermore, other studies demonstrated that HBoV1 induces IFN- against HBoV VP2 VLPs, IL-10 and IL-13 (Th2 cells) in CD4+ T cells [97, 98] . These findings suggest that HBoV infection can induce production of Th1 and Th2 cytokines.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:24071..24999:sentences:4c04483cd126a6fe5cb2d9dd72991a52	NPTX1|IVNS1ABP|NPTX1|IVNS1ABP	NP1|NS1|NP1|NS1	At first, the main method to detect HBoV infections in respiratory and gastrointestinal samples was represented by a direct tool, namely conventional PCR [5] [6] [7] 13, 19, 61, 62, 72, 80, [105] [106] [107] [108] [109] [110] [111] [112] [113] [114] , which was followed by nested and real-time (RT)-PCR [8, 10, 11, 33, 35, 61, 67, 70, 73, 81, 112, [115] [116] [117] . PCR techniques enable isolation of viral genome fragments from NPA, broncho-alveolar, stool, serum and urine specimens through amplification of NP1, NS1 or/and the VP1/2 gene regions [9] , or via other nucleic acid-based detection HBoV diagnosis methods [118] [119] [120] . NP1 and NS1 are more conserved than VP1/2, and thus are commonly targeted for PCR-based detection of the virus [13, 111, 121] . RT-PCR has an advantage over conventional PCR, being more specific and rapid, but its requirement for higher-cost oligoprobes is limiting [11] .. DIAGNOSTICS.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:fulltext:333f07173252b9f38e6cbb4da9b4d2a5:28266..28580:sentences:3c6ea0e688f37af5c6c850e9db0022b7	SOS1|KRAS|	NS4|NS3|NS2	For instance, only recently were three novel small NS proteins (NS2, NS3 and NS4) identified; among these, only one NS protein is critical to the replication of the virus in polarized human bronchial airway epithelium [49] . The role of the other proteins remains rather uncertain.. CONCLUSION AND FUTURE CHALLENGE.
+SARS:04a253fd34bd82b3cf7868fca967469c66e392ab:title:b8a3c2eac6fddd39dd4dccb69cdc8bcd:0..66:sentences:f6dc4bc9bbb2341f0bb32cfd81365e2b	TLR3|DHX58	TLR3|RLR	RO 90-7501 Enhances TLR3 and RLR Agonist Induced Antiviral Response
+SARS:0491da5ae5c2fa38824350bde5462ed82ebc24e7:abstract:4fb63443f6c6732e8c8f7960be1dcfdf:1308..1746:sentences:a73b817b9bc7492450ebcc4b81af6901	CD4|ITIH4	CD4|gp120	Interestingly, the polyvalent vaccine group had the highest proliferative immune responses and showed a substantial proportion of cross-subtype CD4 reactivity to HIV-1 subtypes B, C, and A/E CONCLUSION: Although the polyvalent approach achieved only a modest increase in the breadth of humoral and cellular immunity, the qualitative change in the vaccine (14 vs. 1 gp120) resulted in a quantitative improvement in vaccine-induced immunity.
+SARS:049364026266fb6b0b8d8a626844823a3036e5b0:fulltext:a8ff15b7df22e79b51882500b78b336c:26411..26558:sentences:5b6e74d275b819c16c59f0b28a47df3e	|KRAS|IVNS1ABP	NS2|NS3|NS1	The BTV genome is divided into 10 dsRNA segments which encode seven structural (VP1-VP7) and four non-structural (NS1, NS2, NS3, and NS3a) proteins.
+SARS:049364026266fb6b0b8d8a626844823a3036e5b0:fulltext:a8ff15b7df22e79b51882500b78b336c:45124..45388:sentences:816b405f72ccb28fde4abd556ccbf404	RAF1|KRAS|IVNS1ABP	NS5|NS3|NS1	Of them, three (C, E, and M) form part of the structure of the virion, and the rest (NS1, NS2a, NS2b, NS3, NS4a, NS4b, and NS5) are so-called "non-structural" and play important roles in the intracellular processes of replication, morphogenesis, and virus assembly.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:1233..1995:sentences:d2c960c365de6c4dd956994bf672b510	GORASP2|GORASP1|GORASP2|GORASP1|GORASP2|GORASP1|GRASP	GRASP55|GRASP65|GRASP55|GRASP65|GRASP55|GRASP65|GRASP	The exact mechanism of Golgi stack formation is not fully understood, but the two Golgi reassembly and stacking proteins (GRASPs), GRASP55 and GRASP65, are the only Golgi stacking proteins identified so far (Barr et al., 1997; Shorter et al., 1999; Xiang and Wang, 2010; Zhang and Wang, 2015) . GRASP55 and GRASP65 localize at the medial-/trans-and cis-Golgi, respectively, form transoligomers through the N-terminal GRASP domain to hold the cisternae together into stacks (Wang et al., 2005) , and link Golgi stacks into a ribbon (Puthenveedu et al., 2006) . The C-terminal serine-proline-rich domains of GRASP55 and GRASP65 are more divergent, but both are phosphorylated in mitosis to dissociate the protein trans-oligomers and disassemble the Golgi structure.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:1997..2490:sentences:e4b22d3b1815a8ef08737cc3dbc545d5	GRASP|GOLGA2|BLZF1|GRASP	GRASP|GM130|Golgin 45|GRASP	In telophase, Golgi tubules and vesicles are divided equally between daughter cells, where they are reassembled into stacks and ribbons upon dephosphorylation of GRASP proteins (Vielemeyer et al., 2009; Tang et al., 2012) . Therefore, GRASPs are essential proteins for maintaining an intact and dynamic Golgi structure Wang, 2015, 2016) . In addition to GRASPs, GRASP-interacting proteins such as GM130 and Golgin 45 may also facilitate Golgi stack formation (Lee et al., 2014) .. INTRODUCTION.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:2664..3548:sentences:388435efbec309485f683af43c3618ee	GORASP1|CD8A|CTSD|GRASP|GRASP	GRASP65|CD8|cathepsin D|GRASP|GRASP	We have inhibited Golgi stacking by microinjecting GRASP65 antibodies (Wang et al., 2003 (Wang et al., , 2008 , by depleting both GRASPs in cells via knockdown (Tang et al., 2010; Xiang and Wang, 2010) , and by GRASP knockout (KO) (Bekier et al., 2017) . These caused accelerated trafficking of several marker proteins, including CD8, Vesicular stomatitis virus G-protein, cathepsin D, and integrins (Wang et al., 2008; Xiang et al., 2013; Bekier et al., 2017) . Furthermore, GRASP depletion significantly decreased both global N-linked glycosylation and glycan complexity and changed the glycolipid composition at the cell surface (Xiang et al., 2013; Bekier et al., 2017) . A plausible explanation is that stacking reduces the accessibility of coat proteins to Golgi membranes, which decreases the rate of vesicle budding and transport but ensures accurate glycosylation and sorting.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:3930..4385:sentences:47853abdf6bfe7e63ef6679ee08f7be5	GRASP|CTSD	GRASP|cathepsin D	An ordered structure and a controlled cargo flow through the Golgi are likely required to carry out precise, sequential modifications as cargo proteins pass between cisternae (Zhang and Wang, 2015; Huang and Wang, 2017) . In addition, GRASP depletion also caused missorting of the lysosomal enzyme cathepsin D to the extracellular space (Xiang et al., 2013) , suggesting that stacking may ensure that sorting occurs only when cargo molecules reach the TGN.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:7277..7584:sentences:02175778695feecaac25d1e6401b8f27	GORASP1|GORASP2	GRASP65|GRASP55	We observed that, when examined under a phase-contrast microscope, HeLa cells depleted of GRASP65 or both GRASPs spread less well on the dish, and they also formed clusters and appeared to be rounder compared with cells transfected with control or GRASP55 small interfering RNA (siRNA) (Figure 1, C and D vs.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:7586..7752:sentences:894641dde9c13d09669cf5d9d272ee80	FN1|GRASP	fibronectin|GRASP	A and B, and E) . To further assess the effect of GRASP depletion on cell adhesion, we detached the cells using EDTA and placed the cells on fibronectin-coated plates.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:7846..8030:sentences:11af778cc278c52751710163b761fab3	GORASP2|GORASP1	GRASP55|GRASP65	Compared with the control, in which 55  4% of cells were attached to the dish, only 38  1% of GRASP55depleted cells and 31  3% of GRASP65-depleted cells bound to the dish ( Figure 1F ).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:8032..8153:sentences:6470c68052cb7a721e4a6b8aa4d063a6	GORASP2|GORASP1	GRASP55|GRASP65	When both GRASP55 and GRASP65 were depleted, the percentage of attached cells was further reduced to 22  4% ( Figure 1F ).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:8155..8307:sentences:9f0b9693446e11aa26b6b11ab345908a	GORASP1|GORASP2	GRASP65|GRASP55	This effect was rescued by the exogenous expression of green fluorescent protein (GFP)-tagged GRASP65 or GRASP55, but not GFP alone (Figure 1 , G and H).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:8599..8890:sentences:83eb0be4fe80e635e8008e8d47376cfa	GORASP2|GORASP1	GRASP55|GRASP65	To determine the effect of Golgi unstacking on cell migration, we first used a well-established wound-healing assay using the human breast cancer cell line MDA-MB-231 (Liang et al., 2007) . Both GRASP55 and GRASP65 could be readily depleted by siRNA treatment in this cell line ( Figure 2A ).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:9420..9630:sentences:c0fa24443ad04ffdd0c223884821d1a7	GORASP2|GORASP1	GRASP55|GRASP65	Control siRNA-treated cells migrated 39  1 m/h, while cells depleted of GRASP55, GRASP65, or both migrated at 33  1, 25  2, and 19  2 m/h, respectively, significantly slower than the control cells ( Figure 2C ).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:9772..9959:sentences:7b059a1cedbeaffcc9e7aaccf788bb29	GORASP2|GORASP1	GRASP55|GRASP65	Cells depleted of GRASP55, GRASP65, or both migrated at 22  2, 16  2, and 15  2 m/h, respectively, significantly slower than the 32  3 m/h of wild-type (WT) cells (Supplemental Figure 2 ).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:9961..10072:sentences:2857fbc8f70a119011b46659955f1590	GORASP1|GORASP2	GRASP65|GRASP55	This defect was rescued by the expression of GFP-tagged GRASP65 or GRASP55, but not GFP alone ( Figure 3 , A-C).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:10074..10310:sentences:6447fc61b328909eb3d0b95c75afbbd7	GORASP2|GORASP1|GRASP	GRASP55|GRASP65|GRASP	Interestingly, the level of the cell adhesion molecule 5 integrin appeared to be lower in GRASP-KO cells and was rescued by the expression of GRASP55-GFP and GRASP65-GFP in the corresponding knockout cells ( Figure 3C , lanes 6 and 7 vs.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:10831..11017:sentences:1f770f4c54a182180fc79ac881d7f639	GORASP2|GORASP1	GRASP55|GRASP65	The results showed that the migration rate was significantly reduced by the knockout of GRASP55 or GRASP65, while double deletion of both GRASPs had a more severe effect (Figure 4 , A-C).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:11019..11252:sentences:e9b25362605a104ca1b505b230352ba0	GORASP2|GORASP1	GRASP55|GRASP65	In the control, 184  3 cells migrated to the lower side of the membrane per field of view, while GRASP55, GRASP65, and double-knockout cells had 94  15, 100  15, and 59  28 cells migrate to the bottom side, respectively ( Figure 4C ).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:11254..11394:sentences:cd5668d5e310c60e74bc271c68883b8c	GORASP1|GORASP2|GRASP	GRASP65|GRASP55|GRASP	Exogenous expression of GFP-tagged GRASP65 or GRASP55 rescued the migration defect in GRASP-KO cells ( Figure 4D and Supplemental Figure 3 ).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:12198..12310:sentences:ddd086d7f46c0f8183a81d5a2dd4e7b1	GORASP1|GORASP2	GRASP65|GRASP55	3 Integrin was reduced only in GRASP65 KO cells, while the 3 level was slightly reduced only in GRASP55 KO cells.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:12312..12495:sentences:2f58cbef640f86997df6cd8240823679	GORASP1|GORASP2|GORASP1	GRASP65|GRASP55|GRASP65	Consistent with the results shown in The reduced migration of GRASP55-KO and GRASP65-KO cells was rescued by expressing GRASP55-GFP and GRASP65-GFP, respectively, but not by GFP alone.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:12726..12811:sentences:24ebdb967dcb2f5a050465c1f039200c	GORASP2|GORASP1	GRASP55|GRASP65	5-Integrin heavy chain (5 integrin HC), GRASP55, GRASP65, GFP, and actin were blotted.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:12813..12978:sentences:c7f15068314e0b53833dcdd6bc1a607e	GORASP2|GORASP1|GORASP2|GORASP1	GRASP55|GRASP65|GRASP55|GRASP65	The reduced protein levels of 5 integrin in GRASP55-KO and GRASP65-KO cells were rescued by expressing GRASP55-GFP or GRASP65-GFP, respectively, but not by GFP alone.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:13403..14058:sentences:4b762be8c60db79e64af9344de28e6a0	FN1|GRASP|FN1|GRASP	fibronectin|GRASP|fibronectin|GRASP	The best-characterized integrin complex in HeLa cells is the 51 integrin (Yu et al., 2011; Jia et al., 2016; Hang et al., 2017) , which mediates cell adhesion by binding to fibronectin, and this requires proper N-glycosylation of 51 integrin (Guo et al., 2002; Isaji et al., 2006) . Given the reduced binding of GRASP-depleted cells to fibronectin-coated plates (Figure 1 and Supplemental Figure 1 ), we further examined the effects of GRASP depletion on the protein level of 5 integrin using two antibodies that recognize the N-or C-terminus of the protein, or the heavy (130 kDa) or light (19 kDa) chain of the mature protein, respectively ( Figure 5B ).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:14060..14387:sentences:52ae53578cebb4f5f5dd874bda0b6d54	GRASP|CCRN4L|GRASP	GRASP|Noc|GRASP	Depletion of GRASP proteins by siRNA, or knockout of GRASPs by CRISPR/cas9, both significantly reduced 51-integrin protein levels ( . In contrast to GRASP depletion, disruption of the Golgi structure by nocodazole (Noc) or brefeldin A (BFA) treatment had no effect on the protein level of 51 integrin (Supplemental Figure  4C ).
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:15949..16113:sentences:bef556138dc8db42b7b4970ba6b44828	TFRC|GRASP	TfR|GRASP	Another plasma membrane protein, TfR, was unaffected by GRASP knockout and was also pulled down, while the cytosolic protein actin was not detected in the pull-down.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:16562..16880:sentences:9c2fa48925430dee7a8e2d3600d2824b	GRASP|	GRASP|MG132	To determine whether GRASP depletion reduces 5-integrin level by inducing ER-associated protein degradation (ERAD) or by affecting its maturation, we blocked newly synthesized 5 integrin in the ER by BFA treatment for 2 h and released it for indicated times in the presence of cycloheximide (CHX) and MG132 or monensin.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:26966..27155:sentences:f63b8b7b3af612ec2b7d4a65f3d5cc15	IGF1R|TFRC|GRASP	IGFR|TfR|GRASP	In contrast to the reduced integrin synthesis, total protein synthesis was increased by GRASP depletion, while some other proteins at the cell surface, such as IGFR and TfR, were unaffected.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:27430..27564:sentences:a93a018dfdd1055c84d275bdd140253d	GORASP2|GORASP1	GRASP55|GRASP65	The full-length (FL), heavy-chain (HC), and light-chain (LC) forms of 5 integrin, 1 integrin, GRASP55, GRASP65, and actin were blotted.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:28020..28168:sentences:1a57ae651b345373441074fe4b1f23c2	TFRC|GRASP	TfR|GRASP	GRASP-KO cells were surface biotinylated, this was followed by streptavidin pull-down and Western blotting of 5 integrin, 1 integrin, TfR, and actin.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:28345..28501:sentences:0a922a88c2d060c3202dde47ceef6371	GRASP|	GRASP|MG132	WT and GRASP-KO HeLa cells were pretreated with BFA for 2 h and washed out and then released into CHX for 0, 2, or 4 h or CHX for 4 h with MG132 or monensin.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:32342..32738:sentences:afb9ffd751c6bd9642643ccb2bfa3df4	GORASP2|GORASP1	GRASP55|GRASP65	Most of the cDNA constructs used in this paper were described previously: pEGFP-N1-GRASP55 (WT), pEGFP-N1-GRASP65 (WT), and pEGFP-N1 (Xiang and Wang, 2010; Zhang et al., 2018) . pEGFP-N1-5-integrin (WT) cDNA construct was a kind gift from Jianguo Gu (Tohoku Medical and Pharmaceutical University) . Antibodies used in this study include monoclonal antibodies against actin (Proteintech Group, cat.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:33829..33990:sentences:da73c757bb4675a74c44974be754626a	GORASP2|GORASP1	GRASP55|GRASP65	For knockdown of GRASP55 and/or GRASP65, HeLa cells were plated at 40% confluency in six-well plates and 3 l of a 50 M siRNA stock was added to 250 l of Opti-MEM.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:34283..34470:sentences:9388bab68c84b2fb2cbb8cc6523e92b7	GORASP2|GORASP1	GRASP55|GRASP65	siRNAs for human GRASP55 (AACTGTCGAGAAGTGATTATT) and GRASP65 (CCTGAAGGCACTACTGAAAGCCAAT) (Xiang and Wang, 2010; Xiang et al., 2013) were purchased from Ambion and Invitrogen, respectively.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:34641..35095:sentences:5c0f43c960018197bba185ffbbbcdfb9	GRASP|GORASP1|GORASP2|GRASP	GRASP|GRASP65|GRASP55|GRASP	For expression of exogenous GRASP proteins, HeLa cells of 60% confluency were transfected with the indicated GRASP constructs (Tang et al., 2010; Xiang and Wang, 2010) . For a 10-cm plate, 10 g of pEGFP-N1-GRASP65 (WT) construct or 15 g of pEGFP-N1-GRASP55 (WT) construct was mixed with 30 l of polyethylenimine (PEI) and 1 ml of serum-free medium for 15 min at room temperature and then added to the cells in 9 ml of DMEM containing 10% super calf serum.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:35928..36095:sentences:0b2ba43f65cde763474a12b55a5e3824	CCRN4L|	Noc|MG132	For drug treatment, 5 g/ml BFA, 500 ng/ml Noc, 100 g/ml CHX, 50 M MG132, or 2 M monensin was directly applied to the medium alone or in combination for indicated times.
+SARS:02450c2c82a1511cb5e1639d3b8438f69bbe11f0:fulltext:e0155817ddfe5280ee1d723f417d35e2:36172..36335:sentences:878529407b1e5cde9640b00bc5775191	GRASP|FN1	GRASP|fibronectin	For cell attachment, a total of 3  10 5 control or GRASP siRNA-treated cells were seeded on fibronectin-coated plates and incubated in serum-free medium for 30 min.
+SARS:046b480f92a27f809d67c98c77752037f3342d2a:abstract:77f035cd8ed02acf0c58b81bad7ec633:410..687:sentences:c9545de1ed7080736ea0cf1fa300305c	IVNS1ABP|NPTX1	NS1|NP1	HBoVs are small non-enveloped single-stranded DNA viruses of about 5300 nucleotides, consisting of three open reading frames encoding the first two the non-structural protein 1 (NS1) and nuclear phosphoprotein (NP1) and the third the viral capsid proteins 1 and 2 (VP1 and VP2).
+SARS:04bc03c90437934a75fc6fdc228817234ef84c3a:title:adffa860323ab1fc5e5cf55234a658fe:0..146:sentences:a0f0856456a5a12da2d9a89ed9a9c36e	CD4|FOXP3|CD8A	CD4|FoxP3|CD8	A New Immunosuppressive Molecule Emodin Induces both CD4(+)FoxP3(+) and CD8(+)CD122(+) Regulatory T Cells and Suppresses Murine Allograft Rejection
+SARS:046a56d635edc933ed8f30ccf1ae9fd488dfe645:title:ca5d3d80a337966a837426565785cf33:0..94:sentences:82f14eed8d9f6d85110df61fe93ca2fa	CLEC4G|CRX	LSECtin|CRD	Tat Peptide-Mediated Soluble Expression of the Membrane Protein LSECtin-CRD in Escherichia coli
+SARS:04f96d7efac08e6f80db66cb2d32ba39ee94dbe1:abstract:152b4c1d31c7bda07302039b54d159e8:458..745:sentences:5fbcba112c1fc30d7399a2b0d3dc3efc	CD4|CD8A	CD4|CD8	Recently, it has emerged that memory CD4(+) and CD8(+) T cells are present in the lung airways, and evidence is mounting that these cells play a key role in pulmonary immunity to pathogen challenge by immediately engaging the pathogen at the site of infection when pathogen loads are low.
+SARS:04f96d7efac08e6f80db66cb2d32ba39ee94dbe1:abstract:152b4c1d31c7bda07302039b54d159e8:747..967:sentences:97395eff3da944a8eb915aed1d894901	CD4|CD8A	CD4|CD8	For example, in the case of respiratory virus infections, there is evidence that both CD4(+) and CD8(+) memory cells in the lung airways mediate substantial control of a secondary respiratory virus infection in the lungs.
+SARS:04bc03c90437934a75fc6fdc228817234ef84c3a:abstract:779e38de916c9418559bac676ce17e64:848..1147:sentences:f055b589706c2d3487355c229af4171e	CD4|CD8A|CD8A|CD44	CD4|CD8|CD8|CD44	We found that emodin significantly extended skin allograft survival and hindered CD3(+) T cell infiltration in the allograft, accompanied by an increase in CD4(+)Foxp3(+) and CD8(+)CD122(+) Treg frequencies and numbers but a reduction in effector CD8(+)CD44(high)CD62L(low) T cells in recipient mice.
+SARS:04bc03c90437934a75fc6fdc228817234ef84c3a:abstract:779e38de916c9418559bac676ce17e64:1218..1495:sentences:a3ba103029352dc54b87c94a933fd88c	CD4|CD8A|CD4|IL2RA|IL2RA	CD4|CD8|CD4|CD25|CD25	However, CD4(+)CD25(+), but not CD8(+)CD122(+), Tregs derived from emodin-treated recipients were more potent in suppression of allograft rejection than those isolated from control recipients, suggesting that emodin also enhances the suppressive function of CD4(+)CD25(+) Tregs.
+SARS:04bc03c90437934a75fc6fdc228817234ef84c3a:abstract:779e38de916c9418559bac676ce17e64:1936..2135:sentences:f661e32c4415e326a108b8033f571b76	MTOR|CD4|CD8A	mTOR|CD4|CD8	Therefore, emodin may be a novel mTOR inhibitor that suppresses alloimmunity by inducing both CD4(+)FoxP3(+) and CD8(+)CD122(+) Tregs, suppressing alloantibody production, and hindering DC maturation.
+SARS:049d68aa5279d807e4125c33a3d563f6df987cb4:abstract:a03fa8f3f6f03b062f8dcee16cf7a426:437..622:sentences:647a0760f9c8cfa443de669980c5a05a	HMGB1|CCL2	HMGB1|MCP-1	HMGB1 gradually increased in the alveolar fluid after the onset of acute exacerbation, in positive correlation with monocytes chemotactic protein-1 (MCP-1), a potent fibrogenic mediator.
+SARS:049d68aa5279d807e4125c33a3d563f6df987cb4:abstract:a03fa8f3f6f03b062f8dcee16cf7a426:624..951:sentences:05f3414d456988a4b8231da30bdcefea	HMGB1|THBD|HMGB1	HMGB1|thrombomodulin|HMGB1	In the lung tissues of eight IPF patients autopsied after acute exacerbation, intense cytoplasmic staining for HMGB1 was observed in the alveolar epithelial cells in alveolar capillary augmented lesions, where the capillary endothelial cells remarkably reduced the expression of thrombomodulin, an intrinsic antagonist of HMGB1.
+SARS:049d68aa5279d807e4125c33a3d563f6df987cb4:abstract:a03fa8f3f6f03b062f8dcee16cf7a426:953..1058:sentences:d6b8c999cbf3d101dfe11f5692f7037b	HMGB1|CCL2	HMGB1|MCP-1	These results suggest pathogenic roles for HMGB1 and MCP-1 in the late phase of acute exacerbation of IPF.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:927..1127:sentences:48a00a2086178e18de76528b16125de7	GTPBP1|GP2	GP1|GP2	The GP1 subunit contains an Nterminal receptor-binding domain [5] and interacts with host cell factors, and the GP2 subunit drives fusion of the viral membrane with the membrane of host cell endosomes.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:1129..1749:sentences:3121c9e62cbad78014dae6022ef26e1d	GTPBP1|NPC1|GP2	GP1|NPC1|GP2	Cellular entry of ebolaviruses is thought to commence upon viral binding to incompletely defined factors expressed at the host cell surface, followed by uptake of virions and processing of GP by endosomal cysteine proteases [6] . Processed GP1 then interacts via its receptor-binding domain with the cholesterol transporter Niemann-Pick C1 (NPC1) [7, 8] . Finally, an incompletely characterized additional stimulus activates GP2 for membrane fusion [9] , resulting in delivery of the viral nucleocapsid into the host cell cytoplasm.. . Several host cell factors have been implicated in the cellular entry of ebolaviruses.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:1751..2450:sentences:b689f175f0d9e02e70d82d235b4252ee	TYRO3|AXL|MERTK	Tyro3|Axl|Mer	First, binding of lectins such as dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN) [10, 11] Presented in part: Sixth International Symposium on Filoviruses, Galveston, Texas, 30 March to 2 April 2014.. . to glycans on GP can enhance GP-driven entry [12] . In addition, certain integrins were found to promote GP-mediated entry, and evidence of GP binding to these factors has been obtained [13] . Furthermore, TAM receptor tyrosine kinases (Tyro3, Axl, Mer) were shown to promote GP-mediated entry [14] , possibly by stimulating viral uptake via macropinocytosis [15] . Direct interactions between TAM receptors and GP have not been detected, to our knowledge.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:2452..2736:sentences:e7564afba8bb0f40bd4247b9f4e03dfa	HAVCR1|HAVCR1|TIMD4|HAVCR1|HAVCR1	TIM|TIM-1|TIM-4|TIM-1|TIM-1	Two members of the T cell immunoglobulin and mucin domain (TIM) protein family, TIM-1 and TIM-4, were also shown to promote viral entry, and binding of GP to TIM-1 has been demonstrated [16] . However, binding to GP might not account for TIM-1-mediated augmentation of GP-driven entry.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:2738..3102:sentences:647715ab66bc67aea5805d93b27a5fac	HAVCR1|NPC1	TIM|NPC1	Thus, TIM proteins directly [17] and TAM receptors indirectly [18] bind to phosphatidylserine (PtdSer) on apoptotic cells, and binding to PtdSer on the virion surface was shown to be important for augmentation of GPdriven entry [15, [19] [20] [21] [22] [23] . Finally, NPC1 has been identified as an endosomal binding partner for GP [7] [8] [9] , as outlined above.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:4495..4726:sentences:5dcf80fc635f03f2ecfbfdb0f18d8ad9	CLEC5A|NPC1|HAVCR2|ACE2	CLEC5A|NPC1|TIM-3|angiotensin-converting enzyme 2	Expression plasmids for viral GPs [24, 25] , lectins [24, 26] , Ctype lectin domain family 5 member A (CLEC5A) [27] , NPC1 [7] , TIM-3 [28] , angiotensin-converting enzyme 2 [24] , and folate receptor  [29] were described elsewhere.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:4781..4975:sentences:ba72103310bbd2b5b77741e28305c340	HAVCR1|TIMD4|MSR1	TIM-1|TIM-4|SR-A	Expression plasmids for human TIM-1, TIM-4, and scavenger receptor A (SR-A) were generated by reverse-transcriptase polymerase chain reaction (RT-PCR) and cloning of products into plasmid pCAGGS.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:5776..5987:sentences:bf9dc8e6e6bd3e3c075b5efe4ee3ab23	GLI2|MERTK|MERTK	THP-1|Mer|Mer	For Mer expression, THP-1 cells were differentiated into macrophages and small interfering RNA (siRNA) transfected, as described below, and then incubated for 24 hours followed by FACS analysis of Mer expression.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:6511..6751:sentences:aeacb3bd717ef2f2634ecc902493934e	HAVCR1|AXL|NPC1	TIM-1|Axl|NPC1	For detection of TIM-1, Axl, and NPC1 transcripts with quantitative RT-PCR, RNA was extracted from cell lines and MDMs and analyzed using an ABI 7500 FAST real-time PCR system (Applied Biosystems), TaqMan and Hs99999908_m1 [-glucuronidase]).
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:6753..7018:sentences:b1a12a470af254cd1d9345bee0863bd5	HAVCR1|AXL|NPC1	TIM-1|Axl|NPC1	The mean cycle threshold (Ct) value for each individual assay was calculated from triplicate measurements and mean Ct values calculated for TIM-1, Axl, and NPC1 were normalized by subtraction from the Ct values obtained for the housekeeping reference -glucuronidase.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:9278..10068:sentences:5c1eaaafd66cd7345d89eef37a415355	HAVCR1|HAVCR1|AXL|HAVCR1	TIM|TIM|Axl|TIM-1	TIM proteins and TAM receptor tyrosine kinases are expressed on certain EBOV target cells and were previously implicated in host cell entry of these viruses [10, 14, 16] . To confirm and extend these observations, we compared the ability of lectins, TIM proteins, and the TAM family member Axl to augment EBOV-GP-driven entry into 293T cells, which can be efficiently transfected and are highly susceptible to transduction mediated by ebolavirus GPs [11] . For transduction, we opted for pseudotypes bearing the GP of the highly pathogenic EBOV and an EBOV-GP variant lacking the mucin domain (EBOV-GPmuc), which was reported to yield higher vector titers than the wild-type (WT) protein [30] .. Directed Expression of Lectins and TIM-1 Increases EBOV-GP-Driven Entry Into Susceptible Cells.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:10070..10905:sentences:7f302dcbc033224daa0aba5bd4dd39ea	ASGR1|ASGR1|CLEC4G|HAVCR1|TIMD4|AXL|HAVCR2|CLEC5A	DC-SIGN-Related, asialoglycoprotein receptor 1|ASGPR-1|LSECtin|TIM-1|TIM-4|Axl|TIM-3|CLEC5A	Expression of the C-type lectins DC-SIGN, DC-SIGN-Related, asialoglycoprotein receptor 1 (ASGPR-1), and liver and lymph node sinusoidal endothelial cell C-type lectin (LSECtin) increased EBOV-GP-and EBOV-GPmuc-mediated transduction up to 37-fold but had no effect on entry mediated by vesicular stomatitis virus glycoprotein (VSV-G) ( Figure 1A ), as expected [10, 11, 24, 26] . An increase in transduction efficiency was also observed on expression of TIM-1, whereas expression of TIM-4 and Axl had no effect on transduction mediated by EBOV-GP but slightly enhanced transduction driven by EBOV-GPmuc ( Figure 1B) . Finally, expression of folate receptor  (which does not augment GP-driven entry [29, 31] ), TIM-3, and CLEC5A (a lectin that interacts with dengue virus [32] ), did not modulate transduction under all conditions tested.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:10907..11175:sentences:0bc6d7b6e895cc7a24151a8f40f0a810	HAVCR1|HAVCR1|AXL	TIM-1|TIM-1|Axl	These results demonstrate that expression of certain lectins and TIM-1 on a susceptible cell line can increase EBOV-GP-driven entry, supporting a role for these proteins in host cell entry of EBOVs.. DC-SIGN but not TIM-1 and Axl Bind to the GP1 Subunit of the EBOV-GP.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:11899..12264:sentences:8fae17564d12a27eef7d9d9c934714d5	HAVCR1|AXL|GTPBP1|HAVCR1|AXL	TIM-1|Axl|GP1|TIM-1|Axl	Thus, augmentation of GP-driven host cell entry by lectins but not by TIM-1 and Axl might rely on efficient binding to the GP1 subunit, in keeping with the concept that the latter factors augment EBOV-GP-driven entry by binding to PtdSer in the viral envelope [20, 23] .. Endogenous TIM-1 and Axl Promote EBOV-GP-Driven Entry Into a Subset of Susceptible Cell Lines.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:12406..12574:sentences:d037e66464c2c1a6ee028e05fb0867bc	HAVCR1|AXL	TIM-1|Axl	Therefore, we focused our subsequent analyses on TIM-1 and Axl, which are broadly expressed on cell lines, as confirmed by FACS analysis (Figure 3A) , and primary cells.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:12576..12919:sentences:d6284d314ddf3be3cb1002da2ca38c9b	HAVCR1|AXL|AXL|HAVCR1	TIM-1|Axl|Axl|TIM-1	However, a comparison between endogenous TIM-1 and Axl expression on cell lines and susceptibility to EBOV-GP and EBOV-GPmuc-driven transduction revealed no correlation ( Figure 3B) . Similarly, the effect of siRNA-mediated knockdown of Axl and TIM-1 expression ( Figure 3C ) on transduction efficiency was dependent on cell type ( Figure 3D ).
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:12921..13150:sentences:cb0547646202a0a6ffc8450f3f2b619d	AXL|HAVCR1|NPC1	Axl|TIM-1|NPC1	Thus, augmentation of EBOV-GP-mediated transduction by Axl and TIM-1 is restricted to certain cell lines, a finding that matches previous results [15, 16] .. NPC1 Expression is Universally Required for EBOV-GP-Driven Transduction.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:13233..13343:sentences:603258a47aec8e3b0ea17dee4b895098	NPC1|AXL|HAVCR1	NPC1|Axl|TIM-1	We asked whether NPC1, in contrast to Axl and TIM-1, is universally required for EBOV-GP-mediated transduction.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:14344..14773:sentences:c927408c80e13f3e0446c2ab9a0e7460	NPC1|NPC1|NPC1|HAVCR1|AXL	NPC1|NPC1|NPC1|TIM-1|Axl	Moreover, we found that NPC1 messenger RNA (mRNA) was readily detectable in C8166 T lymphocytes and Raji B cells ( Figure 4C ), which were resistant to EBOV-GP-driven transduction ( Figure 4D ), indicating that lack of NPC1 does not account for the well-documented resistance of lymphocytes to EBOV-GP-mediated entry [35] .. NPC1 but Not TIM-1, Axl or Mannose-Specific Lectins Promote EBOV-GP-Mediated Transduction of Macrophages.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:14775..14945:sentences:b9247d4d26126c6fc00876b884a10572	AXL|HAVCR1|NPC1	Axl|TIM-1|NPC1	Macrophages are targeted early and throughout EBOV infection [36, 37] . Therefore, we next asked whether Axl, TIM-1, and NPC1 contribute to GP-driven transduction of MDMs.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:14947..15093:sentences:683e9259c43a0e886c41c42d8c655c06	AXL|HAVCR1|MIR7-3HG	Axl|TIM-1|Huh7	Quantitative RT-PCR analysis revealed that MDMs express only low amounts of Axl and TIM-1 compared with the cell lines HeLa and Huh7 ( Figure 5A ).
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:15095..15257:sentences:daad068a629622a6119ef0d7e42f85ed	AXL|HAVCR1	Axl|TIM-1	In keeping with this finding, siRNA-mediated knock-down of Axl and TIM-1 expression had no appreciable effect on EBOV-GP-driven transduction of MDMs ( Figure 5B ).
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:15259..15363:sentences:f2123ced7ea976b49721edf9a03d03ca	NPC1|SLURP1	NPC1|MDM	In contrast, knock-down of NPC1 significantly reduced MDM transduction mediated by EBOV-GP but not VSV-G.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:15605..16230:sentences:15797a0d311b5429a64c477711d21405	NPC1|MIR7-3HG	NPC1|Huh7	Finally, the mannose-polymer mannan, which inhibits ligand binding to DC-SIGN and related lectins, did not inhibit GP-driven transduction of MDMs, although it markedly reduced transduction of 293T cells expressing DC-SIGN ( Figure 5D ), indicating that mannose-specific lectins do not promote GP-dependent entry into macrophages.. Figure 4. Expression of endogenous Niemann-Pick C1 (NPC1) promotes Ebola virus (EBOV) glycoprotein (GP)-driven entry in a cell-line independent fashion.. A, HeLa and Huh7 cells were transfected with the indicated small interfering RNAs (siRNA) and then transduced with the indicated pseudotypes.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:16982..17196:sentences:96b88cbc13abce38bea2aca78fdf3b51	MIR7-3HG|NPC1	Huh7|NPC1	C, Total RNA isolated from Huh7, 293T, and the lymphocytic cell lines C8166 and Raji was analyzed for NPC1 expression by reverse-transcriptase (RT) polymerase chain reaction, in the presence (+) or absence () of RT.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:17563..17736:sentences:7f7a36159c522d3cb1ac0fd43be48a3b	MSR1|MERTK	SR-A|Mer	Abbreviation: VSV-G, vesicular stomatitis virus glycoprotein.. Evidence That Integrin V, SR-A and Mer Expression is Required for EBOV-GP-Mediated Transduction of Macrophages.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:17900..18176:sentences:97e991f5d63d4be61d2f365377a28e97	AXL|HAVCR1	Axl|TIM-1	Notably, 2 factors required for optimal transduction of cell lines, Axl and TIM-1, are intimately involved in the recognition of apoptotic cells [17, 18] . Therefore, we asked whether EBOV-GP might exploit other cellular factors with a comparable activity for macrophage entry.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:18178..18992:sentences:b2b4576db722bbda8bbd586bb3299a82	CD14|CD36|OLR1|MSR1|MSR1|MSR1|NPC1|MERTK|MSR1|NPC1|MSR1|MERTK|MERTK|MERTK|MERTK|MERTK	CD14|CD36|LOX-1|SR-A|SR-A|SR-A|NPC1|Mer|SR-A|NPC1|SR-A|Mer|Mer|Mer|Mer|Mer	We focused our analysis on integrin V, CD14, CD36, LOX-1, SR-A, and Mer, all known to be expressed in macrophages and to play a role in the detection of apoptotic cells [38] . Moreover, integrin V and Mer were previously implicated in EBOV-GP-mediated entry [13, 14] . Transfection of siRNAs directed against integrin V, SR-A, and Mer expression significantly reduced EBOV-GP-but not VSV-G-mediated transduction of MDMs ( Figure 6A, left) . Moreover, a combination of siRNAs against Mer, SR-A and NPC1 reduced transduction more efficiently than the single siRNAs ( Figure 6A, right) , suggesting that Mer, SR-A, NPC1, and integrin V might all be required for robust EBOV-GPmediated transduction of macrophages.. Specificity of Inhibition of EBOV-GP-Driven Transduction of Macrophages by siRNAs Against SR-A and Mer.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:18994..19100:sentences:51a13109d6f52208829d8ab9b4644ebe	MSR1|MERTK	SR-A|Mer	We next assessed the efficiency and specificity of the siRNAmediated knock-down of Mer and SR-A expression.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:19102..19333:sentences:32ec38296c0d284697a7cedd44a95ac9	MERTK|GLI2|MERTK	Mer|THP-1|Mer	We analyzed the effects of siRNA transfection on Mer expression using THP-1 cell-derived macrophages, because Mer protein was readily detected on these cells but not on MDMs, owing to high background signals measured for the latter.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:19335..19545:sentences:f11e7c249f860f9b8cd9c829f75fa1bc	NPC1|MSR1|MSR1|MSR1|NPC1|MERTK|MERTK	NPC1|SR-A|SR-A|SR-A|NPC1|Mer|Mer	Mer expression was modestly reduced upon transfection of Mer-specific but not NPC1-or SR-A-specific siRNA ( Figure 6B) . Similarly, expression of SR-A in MDMs was reduced by siRNA specific for SR-A but not NPC1.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:19547..19817:sentences:eed92f86a6058416779f1b41ddc59a60	MSR1|MSR1|MERTK	SR-A|SR-A|Mer	Transfection of siRNA directed against Mer had a slight but reproducible effect on SR-A expression ( Figure 6B ), suggesting that full expression of SR-A might ; results on the right, the mean of 3 independent experiments; error bars indicate standard errors of the mean.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:20176..20258:sentences:aff318b1bbc1b5a4041c97738b475029	MSR1|MERTK	SR-A|Mer	Expression of Mer and SR-A in cells transfected with control siRNA was set at 100%.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:20260..20355:sentences:2b1aae12023425dbf42e3d2f21ae1cbb	MSR1|MERTK	SR-A|Mer	Results represent the mean of 4 (Mer expression) to 6 (SR-A expression) independent experiments.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:20357..20506:sentences:80a19dcd3f4986a057b6b75ee12cd012	MSR1|MERTK	SR-A|Mer	C, HeLa cells, which do not express endogenous Mer or SR-A, were transfected with the respective siRNAs and transduced with the indicated pseudotypes.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:21193..21358:sentences:ea4f3bb45f4d8388903c277f2459f04e	MSR1|MERTK	SR-A|Mer	Abbreviation: VSV-G, vesicular stomatitis virus glycoprotein.. Specificity of Inhibition of EBOV-GP-Driven Transduction of Macrophages by siRNAs Against SR-A and Mer.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:21360..21554:sentences:a6de663c422f19936603667cc96d9e73	MSR1|MERTK	SR-A and Mer|Mer	depend on parallel expression of Mer, a scenario in keeping with published findings [39] .. Specificity of Inhibition of EBOV-GP-Driven Transduction of Macrophages by siRNAs Against SR-A and Mer.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:21556..21786:sentences:e126ce633ef63554d52328835b76e350	MSR1|NPC1|MERTK	SR-A|NPC1|Mer	To assess the specificity of entry modulation by siRNAs, we investigated HeLa cells, which are negative for SR-A [40] and Mer [41] .NPC1-specific siRNA markedly reduced EBOV-GP-but not VSV-G-driven entry ( Figure 6C ), as expected.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:22350..22619:sentences:bfd1e84dbdf7635f33922a1bf3483a66	MSR1|MSR1|MSR1|NPC1|MERTK|MERTK	SR-A|SR-A|SR-A|NPC1|Mer|Mer	Collectively, these results are in keeping with a role of SR-A and Mer in EBOV-GP-dependent macrophage transduction, although offtarget effects of the SR-A siRNA cannot be excluded.. Interference With Mer, SR-A, and NPC1 Expression Reduces EBOV Infection of Macrophages.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:22736..22859:sentences:4f19f777b8ab72077318ac82733f1771	MSR1|SLURP1|MERTK	SR-A|MDM|Mer	Therefore, we assessed whether the siRNAs directed against Mer and SR-A reduced MDM infection by replication-competent EBOV.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:22911..23299:sentences:9cc665a2fadb79615d022eaa43eaccbc	MSR1|NPC1|NPC1|MERTK	SR-A|NPC1|NPC1|Mer	Transfection of single siRNAs slightly but reproducibly decreased infection efficiency, and a marked drop in the infection rate was observed upon parallel knock-down of Mer, SR-A and NPC1 (Figure 7) , indicating that the expression of NPC1, together with several factors involved in the phagocytosis of apoptotic cells, is required for efficient EBOV infection of macrophages.. DISCUSSION.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:23301..23471:sentences:3d0d141c2d401d723c724026b28dc31e	HAVCR1|AXL	TIM-1|Axl	The present study confirms that TIM-1 and Axl can promote EBOV-GP-driven entry into certain cell lines and shows that these proteins do not augment entry into macrophages.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:23558..23684:sentences:d029f9b4978873c6788ec01c03baaa83	MSR1|MERTK	SR-A|Mer	Finally, evidence was obtained that also Mer, integrin V, and possibly SR-A promote EBOV infection of macrophages.. DISCUSSION.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:24155..24486:sentences:e44a55cda8fa903ed3bd0e25741fbaee	CLEC4G|ASGR1	LSECtin|ASGPR-1	Nevertheless, one should keep in mind that lectins such as human macrophage C-type lectin specific for galactose and N-acetylgalactosamine, LSECtin, and ASGPR-1, which recognize carbohydrates other than mannose and augment EBOV-GP-driven infection in cell culture [24, 26, 43] , might affect viral cell tropism in vivo.. DISCUSSION.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:24663..24770:sentences:4e658fe50c0a9d3ce6ee95d37c367991	HAVCR1|HAVCR1|AXL	TIM-1|TIM|Axl	Upon expression in 293T cells, TIM-1, but no other TIM proteins or Axl, increased EBOV-GP WT-mediated entry.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:24772..25063:sentences:ecc02cc76bc83083ab22593293c27271	HAVCR1|AXL|TIMD4	TIM-1|Axl|TIM-4	Augmentation of GPdriven entry upon TIM-1, Axl, and TIM-4 expression was either more pronounced or exclusively observed for EBOV-GPmuc compared to EBOV-GP WT, suggesting that the presence of the mucinlike domain might modulate augmentation of GPdriven transduction by PtdSer-binding proteins.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:25065..25403:sentences:8f5c95f402b56d0c2db93c64b62142fb	HAVCR2|HAVCR1	TIM-3|TIM-1	The inability of TIM-3 to augment entry is due to inadequate presentation of its PtdSer-binding domain [45] . In contrast, it is currently unclear why TIM-1 augments entry driven by EBOV-GP but not VSV-G (and a few other viral GPs), a finding also reported by others [19] , and several hypotheses have been proposed [19, 23] .. DISCUSSION.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:25405..25655:sentences:8c3afafc809bc1666c99e517e9f13746	HAVCR1|AXL	TIM-1|Axl	Our finding that endogenous expression of TIM-1 and Axl augments GP-driven entry into a subset of susceptible cell lines matches previous reports [16, 22] and raised the questions whether these factors contribute to GP-mediated entry into macrophages.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:25657..25878:sentences:4cb0a0dceadc5e0df057484960328a0d	AXL|HAVCR1	Axl|TIM-1	Quantitative RT-PCR revealed that less Axl and TIM-1 mRNA is produced in MDMs compared with susceptible cell lines, and siRNA-knock-down showed that expression of these factors is dispensable for GP-driven entry into MDMs.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:25880..25995:sentences:69be1a7e82bafc7689faefd8f18021d3	AXL|MERTK	Axl|Mer	In contrast, Mer but not Axl expression was required for efficient GPdriven transduction and EBOV infection of MDMs.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:25997..26208:sentences:4ab48602ad2102b8782585eb2ddf2fee	AXL|TYRO3|MERTK|MERTK	Axl|Tyro3|Mer|Mer	Similarly, Mer but not Axl or Tyro3 was found to be essential for efficient phagocytosis of apoptotic cells by macrophages [46] , indicating that Mer is the TAM receptor kinase active in macrophages.. DISCUSSION.
+SARS:02522a1b4512e4d2880a6a551a8dff589d4cb393:fulltext:c99917d7c39f9247780cb0d7d77bc608:27137..27870:sentences:a9aaac58852a1cf244a001ff295d187a	GAS6|CTSL|NPC1	growth arrest-specific protein 6|cathepsin L|NPC1	Integrins V3 and V5 interact with milk fat globule-EGF factor 8, which in turn recognizes PtdSer [47] , suggesting that these factors might promote GP-driven entry in a fashion similar to TAM receptor kinases and their PtdSerbinding ligands growth arrest-specific protein 6 or protein S [44] . Such a scenario could be reconciled with a previous study reporting that recombinant 51 integrin or antibodies against 1 integrin interfere with GP-driven entry [13] . However, subsequent work indicated that expression of 51 integrin is required for full activity of cathepsin L, which processes GP for binding to NPC1 [13, 48] . Integrin V expression might thus promote macrophage entry of ebolaviruses via several mechanisms.. DISCUSSION.
+SARS:055543ff5e0e0aa6403554e1bff5e996eb5a0ed2:abstract:f03d556414073fc364d37e0b1b4951b1:455..640:sentences:7e48e05d6e52ffc628073f412c02dd4c	APP|APCS	APP|SAP	Although high APP levels have been broadly associated with bacterial infections, there is a growing body of evidence revealing increased PTX, CRP and SAP expression upon viral infection.
+SARS:0568c55234a6ad2585fe3ac5f3c51260194af7ec:fulltext:cef047382dc5c02bb66299dcc4bd39ba:2486..3178:sentences:def95b65009e4a2d2c16e74e0a93f589	RAF1|KRAS|IVNS1ABP	NS5|NS3|NS1	A number of specific real-time and conventional RT-PCR assays targeting the envelope (E), premembrane (prM), nonstructural proteins 1 (NS1), NS2B, NS3, and NS5 gene coding regions of the ZIKV genome have been described [18] [19] [20] [21] [22] [23] [24] . However, most of these assays were developed before the ZIKV epidemic occurred in the Americas, and there are up to 10 potential nucleotide mismatches between the sequences of the individual assays' primers and current epidemic virus strains [25] . The low sensitivity in these assays may also lead to false-negative results in up to 20-80% of patients, especially those with low viral loads in their blood or urine [25] .. INTRODUCTION.
+SARS:0568c55234a6ad2585fe3ac5f3c51260194af7ec:fulltext:cef047382dc5c02bb66299dcc4bd39ba:5012..5146:sentences:fa9c5d677854d32de62c2487019a2396	ERVW-1|IVNS1ABP	Env|NS1	The Sf9 cells were transfected with pAcGP67a-NS1-his and pAcGP67a-Env-his vector by polyfect-mediated method (Hilden, Qiagen, Germany).
+SARS:05835441ec99d4688f532f74e9610bae494d03ba:abstract:e96ff0ec304b628064e2570c32767986:471..547:sentences:bc0b1c0227eaa1c9baa5ad3d0ab93c5e	PPIG|FKBP9	Cyp|PPIase	Both Cyp and FKBP have peptidyl-prolyl cis-trans isomerase (PPIase) activity.
+SARS:05835441ec99d4688f532f74e9610bae494d03ba:abstract:e96ff0ec304b628064e2570c32767986:549..719:sentences:fcf9d79d37c3a4ab770e182dc48232a8	PIN1|PIN4	Pin1|parvulin	However, protein interacting with NIMA (Pin1), a member of the parvulin subfamily of PPIases that differs from Cyps and FKBPs, is essential for various signaling pathways.
+SARS:05b8deee7f76cda7511eb605e2ba84a8f46bc10f:abstract:8118f495df73d1ac43c34cc369ac79d5:455..598:sentences:0425adcce04c114674d32a12f8ce88bc	ERCC8|PPIA|PPIA	CsA|CypA|CypA	Finally, Cyclosporin A (CsA), the main inhibitor of CypA, inhibits influenza virus replication through CypA-dependent and -independent pathways.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:7405..7632:sentences:b565f7cf4d6901b360199fe0866ac698	|MUC5AC|MUC5B|MUC1|MUC4|MUC12|MUC13|MUC15|MUC20	Mucin|MUC5AC|MUC5B|MUC1|MUC4|MUC11|MUC13|MUC15|MUC20	Mucin is not a homogeneous protein but a family of glycoproteins that may either be secreted (such as MUC5AC and MUC5B) or membrane associated, that may function as cellular receptors (MUC1, MUC4, MUC11, MUC13, MUC15 and MUC20).
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:7634..8021:sentences:1f3785c398807ed00715b0475d83a935	MUC5AC|MUC5B|MUC5B|MUC1|MUC4	MUC5AC|MUC5B|MUC5B|MUC1|MUC4	There are a number of excellent reviews on the different types of these mucins available [28, 29] . The first set of mucins are normally secreted by goblet cells of the surface epithelium (MUC5AC and MUC5B) and submucous glands (MUC5B) present in the trachea and bronchi, and the membrane associated mucins, such as MUC1 and MUC4, are present at the apical surface of ciliated cells (Fig.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:11128..11596:sentences:80ecd761281b9fba77f631f9b020cc0c	SFTPA1|HOXD13	SP-A|SP-D	SP-A is sialylated and so acts as a decoy receptor (so called -inhibition) -thus its ability to prevent influenza infection is not dependent on the degree of HA glycosylation [38] . In contrast SP-D binds mannose type oligosaccharides and has been demonstrated to interact with influenza virus HA involved in haemagglutination inhibition, and is also able to mediate aggregation of viral particles and inhibit HA activity through interaction of the viral HA or NA (Fig.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:14325..14492:sentences:d0c22c5a95df9519dfddcfa2b6bf17e4	DDX58|TRIM25|MAVS|TBK1	RIG-I|TRIM25|MAVS|TBK-1	The viral RNA binds to RIG-I and is then ubiquitinated by TRIM25 allowing binding to MAVS followed by activation of TBK-1, IKK pathways and transcription of interferon.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:17805..18131:sentences:dc4fea30834095bb0798ae074434be98	DDX58|NLRP3	RIG-I|NLRP3	The three main pathways that are triggered leading to an interferon response are the toll like receptor pathway (TLR), retinoic acid inducible gene I (RIG-I) like receptors (RLR), and nucleotide oligomerization domain (NOD)-like receptor pathway pyrin domain containing 3 (NLRP3) (reviewed in van de Sandt [54] ).. TLR pathway.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:18372..18750:sentences:3df4f99ffa09189fca3e938cfbdae558	|TLR4|TLR4|MYD88|TICAM1	TLR2 and 4|TLR4|TLR4|MyD88|TRIF	Shinya and colleagues previously demonstrated that prestimulation of TLR2 and 4 had a protective effect in mice when challenged with HPAI and that this protective effect was also seen after pre-treatment with lipopolysaccharide (LPS) which is a ligand for TLR4 [55] . This TLR4 binding resulted in the activation of 2 independent pathways -one involving MyD88 and the other TRIF.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:18752..19046:sentences:450081eb4df23abaa31818a2fc856772	MDM2|CD14|LY96|CD14	MDM2|CD14|MD2|CD14	This pathway also required 2 surface molecules MDM2 and CD14, and additional studies demonstrated that cultures lacking either MD2 or CD14 had no change in H5N1 replication after LPS stimulation [56] . Interestingly, while LPS alone did not affect the expression of interferon stimulation genes.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:19048..19298:sentences:580a836d3fceda3937d9a186113e5278	TLR3|TLR4|TICAM1|TLR3	TLR3|TLR4|TRIF|TLR3	It did lead to an upregulation of the expression of other antiviral molecules, and TLR3 was found to be upregulated in this TLR4-TRIF pathway, thus demonstrating that the suppression of H5N1 infection was aided by the synergistic upregulation of TLR3.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:20030..20205:sentences:d9308fc2240732a9254c5e4029c56dcd	TLR7|VTRNA1-1|TLR7	TLR7|vRNA|TLR7	16. Thus TLR7 appears to play a dual role -the recognition of vRNA in early infection and then in terms of immunization TLR7 is activated in the MHC class II endocytic pathway.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:20207..20349:sentences:19513bf36180134300b9191a60400d53	DDX58|NLRX1|DDX58|VTRNA1-1	RIG-I|NLR|RIG-I|vRNA	As a backup to the late endosomal compartment there are 2 other pathways that recognize vRNA in the cytosolic component -RIG-I and NLR.. RIG-I.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:20545..20700:sentences:825588267751100b132ae5d596e5d1de	DDX58|IFIH1	RIG-I|MDA5	The intracellular detection of this RNA was ascribed to two cytoplasmic helicases called RIG-I and melanoma differentiationassociated gene 5 product (MDA5).
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:20833..21037:sentences:b4f6b44b901fe67cd9f0de3f3bc15998	DDX58|IFIH1|DDX58|IFIH1|DDX58	RIG-I|MDA5|RIG-I|MDA5|RIG-I	3) . Knockout studies showed that RIG-I and MDA5 were able to discriminate between different strains of virus -RIG-I for the ortho, paramyxo and rhabdoviruses and MDA5 for the picornaviruses [62] .. RIG-I.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:21256..21662:sentences:7efd9b379097bdfece3a8c60706633f4	DDX58|VTRNA1-1|DDX58|TRIM25|DDX58	RIG-I|vRNA|RIG-I|TRIM25|RIG-I	The recognition of viral RNA by RIG-I is enhanced when there is a 5'-triphosphate (PPP) present on the RNA, acting as a 'hook', as removal of this PPP reduced interferon induction [63, 64] . Once the triphosphate terminated vRNA is recognized by RIG-I, the complex undergoes a conformation change in which the CARDs are able to be ubiquitinated by TRIM25 which adds a Lys-63 linked ubiquitin chain to RIG-I.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:21664..22028:sentences:86b0506a404cdc74c9cfd0ffc45ebd90	DDX58|DDX58|DDX58|MAVS|DDX58	RIG-I|RIG-I|RIG-I|MAVS|RIG-I	The Lys172 in the second CARD of RIG-I appears crucial for effective function [65] . Unlike many other results of ubiqutination, the change in RIG-I does not lead to degradation in the proteasome but actually is a critical step for subsequent interaction of RIG-I with MAVS though the exact mechanism how this is facilitated is not clearly understood [61] .. RIG-I.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:22030..22578:sentences:6961607dafd4780cfe4d1b3ba2a9b87d	TRIM25|DDX58|NF1|TRIM21|IRF3|TRIM27|NF1|IRF3|IRF7	TRIM25|RIG-1|NF1|TRIM21|IRF3|TRIM27|NF1|IRF3|IRF7	The TRIM proteins are called such because they have a TRIpartite Motif and even though there have been over 70 genes encoding TRIM described, only a small number have been well characterized [61] . Since it was demonstrated that genes encoding TRIM were upregulated by type-1 interferons their role has been further investigated [66] . As mentioned above TRIM25 ubiquitinates and activates RIG-1, TRIM30 inhibits NF1, TRIM21 stabilizes IRF3 and TRIM27 inhibits NF1, IRF3 and IRF7, thus affecting the downstream activation pathway in viral infection.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:22580..22932:sentences:c61a1e07f2c49a0eaeb0390bc009d7f7	MAVS|IRF3|IRF7	MAVS|IRF3|IRF7	Once CARDs are expressed and ubiquitnated they are able to interact with the CARDs of the adaptor protein Mitochondrial AntiViral Signaling (MAVS) on mitochondria leading to activation of the IKK-IKK-IKK complex and the downstream NF, IRF3 and IRF7 complexes followed by transcription of type 1 interferons.. Interferon signaling and antiviral activity.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:23154..23369:sentences:d1c889b513e8c4b624fe48bcdfc6101c	IFNA1|IL6|TNF	type 1 interferons (IFN- and IFN-)|IL-6|TNF	In influenza infection the type 1 interferons (IFN- and IFN-) are the major cytokines that limit viral replication with TNF, IL-1 and IL-6 recruiting immune cells to the sites of infection and producing inflammation.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:23371..23737:sentences:537b43c9be7173a5918fdfc382a9bbcb	TYK2|TK2|JAK1|JAK1|	Tyrosine Kinase 2|TK2|Janus Kinase 1|JAK1|STAT1/2	The type-1 interferons act on INF/ receptors present on the same cell and on adjacent cells to activate the antiviral signaling cascade, including the Tyrosine Kinase 2 (TK2) and Janus Kinase 1 (JAK1), phosphorylation of STAT1/2 that indues transcription of hundreds of genes containing interferon stimulating response elements (IRSE)(reviewed by van de Sandt [54] ).
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:23739..23861:sentences:8b020523bf2b24d206869a53c6c2b03b	IFNA1|MX1|RSAD2|BST2|SMOC1	IFN|MxA|viperin|tetherin|OAS	These IFN stimulated genes encode other TRIM proteins plus other antiviral proteins such as MxA, viperin, tetherin and OAS.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:24751..25602:sentences:aa34d9bc9d5bcf6b64f98c659e5bacf2	|ZEB2|ZEB2|CCL2|CCL5|ITGAM|IFNA1|IFNA1|CCL2|IL6|TNF	SIP1-5|SIP1|SIP1|CCL2|CCL5|CD11b|IFN|IFN|CCL2|IL6|TNF	This is a metabolite of sphingolipid and a ligand for G-protein coupled receptors SIP1-5 [69] . The role of these receptor ligands was shown by Marsolais and colleagues who used SIP ligands and found that they reduced the cytokine response using a mouse adapted influenza virus [70] . Further work demonstrated a level of SIP1 expression on lymphatic and vascular endothelial cells and that treatment with an agonist of SIP1 was able to reduce the production of chemokines CCL2, CCL5 and CD11b+ cells and decrease IFN  secretion but did not affect IFN, CCL2, IL6 or TNF, thus showing that endothelial cells are able to actually modulate the inflammatory response [71] . It is possible that these SIP analogs may have a use in further therapies in dampening the excessive innate immune response [72] .. Influenza hijacking of the innate immune response.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:26449..26843:sentences:d958500444405178b1f3bcba14f7cd6b	PTPN11|IFNA1|PTPN11|TRIM25|IFNA1	NS1|IFN|NS1|TRIM25|IFN	Within the cell it has been found for a long time that influenza has evolved a strategy to evade the powerful IFN defence mechanism [73] but in 1998 Garcia-Sastre and colleagues showed that the production of recombinant influenza lacking a gene called non-structural protein (NS1) was able to suppress this IFN pathway [74] . NS1 employs this strategy at many levels, including targeting TRIM25.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:26845..26961:sentences:f14f4df366add95ee40b267f2676cf3b	TRIM25|DDX58|IFNA1	TRIM25|RIG-I|IFN	It will be remembered that TRIM25 is required to ubiqutinate and activate RIG-I leading to subsequent IFN production.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:26963..27077:sentences:60072a176a1336bb8f9a19ad802e9d70	TRIM25|PTPN11	TRIM25|NS1	For TRIM25 to perform this function it needs to be oligomerized and NS1 inhibition of this abolishes this activity.
+SARS:035dc4021101af0a19152cb5ea7b40b0c57ed76d:fulltext:073b190b87a65b3fa58bb314e9b3acbc:27079..27508:sentences:b171f7f21c705012cdb01d84492d5bd8	TRIM25|PTPN11|EIF2AK2|ELF2	TRIM25|NS1|PKR|elF2	All influenza strains have this interaction with TRIM25, possibly because of the conserved Glu96 and Glu97 but the D92E change in H5N1 may affect function [75] . NS1 also functions to impair the interferon induced protein PKR which it will be recalled can shut down translation by sustained phosphorylation of the translation factor elF2 thus inhibiting virus propagation [76] .. Influenza hijacking of the innate immune response.
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:abstract:13a5175b959b55d70225cdb156fed1f9:0..243:sentences:b4c8795de3178ef6a9847910c36c7c01	USF2|CSF2|CSF2|USF2	FIP|CSF|CSF|FIP	To investigate the utility of cerebrospinal fluid (CSF) anti-feline coronavirus (FCoV) antibody test for diagnosis of feline infectious peritonitis (FIP), the antibody titers were tested in CSF and sera from 271 FIP-suspected neurological cats.
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:abstract:13a5175b959b55d70225cdb156fed1f9:600..717:sentences:37e771ce7e56fe0c862c9c3d924917f5	USF2|CSF2	FIP|CSF	Our findings indicate that CSF titer of 1:640 or higher may be served as a candidate for the index for diagnosing FIP.
+SARS:0597b458ac250cffe02827f4448a2bfd4e5e05f3:abstract:9db570902eb8e42e6fc051e758d73789:1405..1523:sentences:f562f0c27a1c56d70f484750798657b7	ABCB1|APOB	ABCB1|ApoB	ABCB1 rs1045642 mutations have a protective effect against SONFH, and ApoB rs693 and rs1042031 increase the SONFH risk.
+SARS:05d0b2ce8152a4b6d1dcede7cf2ea4c9f7d99f3a:abstract:38bbfce80397fa16c3a96f77b7ca6eed:1115..1275:sentences:819af226c28e5513607aae0952e6c16e	CHN2|CCR1	CHN2|CCR1	These include the PIKfyve kinase inhibitor Apilimod, cysteine protease inhibitors MDL-28170, Z LVG CHN2, VBY-825, and ONO 5334, and the CCR1 antagonist MLN-3897.
+SARS:05e5a2bca07922fe0bd52185f4ccaae1b8b154f6:fulltext:4bd278cdf282492e0f6e1d29e8884a30:9126..9416:sentences:c7104c9db3a85a7d8e19c4155f39bc83	|CWC15	ORF1|ORF5	Among these 11 unique amino acid differences, four were found in ORF1ab (E1059D, P1951L, P2269S, and M6117I), three were found in the S1 domain of the spike protein (S28P, S459T, and P710S), and one each was found the proteins encoded by ORF4b, ORF5, the envelope gene and ORF8.. DISCUSSION.
+SARS:05cf81cc55f7a6f80902a671cac49d85af9782ed:fulltext:c1321f54db0033acbf9b04577557db0e:5273..5472:sentences:9739b12860fab2faa630ebafd49ae9a9	TNF|TNF|CXCL10	tumor necrosis factor alpha|TNF|CXCL10	In particular, HCoV-229E is found to be more capable of inducing proinflammatory gene expression, including tumor necrosis factor alpha (TNF-) and CXCL10, than the more pathogenic human coronaviruses.
+SARS:05e18c649273a9124cbb290861443e9a6946a553:abstract:c77bfaa50a6e15b68d2841c8cc2ed8d7:668..965:sentences:69c9883d4174d9f292100ce1375afc98	|S100A10	P60|P10	The S genes contained typical insertions and deletions that were also found in other recently isolated highly virulent PEDV strains from China and other countries and had two neighboring unique insertion mutations, which resulted in four amino acid changes in the S1 region of passages P10 and P60.
+SARS:05a12a1fb4a86a4158ad027b911092cfc25bc40b:fulltext:95e2acfefe40f5beb94f99e44b14295b:17746..18244:sentences:9106f131dd9c8e74373c0dab0cb13e18	TNF|IL6|CSF2|CSF2|IL1A|IL18	TNF|IL-6|granulocyte macrophage colony-stimulating factor|GM-CSF|interleukin-1|interleukin-18	showed that whereas the nanospheres and the nanocubes induced tumor necrosis factor- (TNF-), IL-6, IL-12, and granulocyte macrophage colony-stimulating factor (GM-CSF), the nanorods induced interleukin-1 and interleukin-18 via an inflammasome-dependent mechanism [104] . This shape-dependent immunological property may be due to the differing surface energies associated with different nanoscale features, which may promote varying levels of stress upon cellular uptake [108] .. Other nanoparticles.
+SARS:05a12a1fb4a86a4158ad027b911092cfc25bc40b:fulltext:95e2acfefe40f5beb94f99e44b14295b:34257..34493:sentences:f361e83d0ae12769be3979bc847d229f	|TLR9	TLR7/8|TLR9	al., synthetic vaccine particles encapsulating resiquimod (R848, a TLR7/8 and TLR9 ligand) augmented humoral and cellular immune responses to both soluble and nanoparticle-delivered proteins compared to that observed with free adjuvants.
+SARS:05a12a1fb4a86a4158ad027b911092cfc25bc40b:fulltext:95e2acfefe40f5beb94f99e44b14295b:34648..35146:sentences:66bbdcab497931cb4d262ed31cf80d6d	IL1A|IFNA1|TLR9|IFNA1	IL-1|IFN|TLR-9|IFN	Moreover, while injection of the nanoformulation led to sustained expressions of IFN-, IL-12, and IL-1 in lymph nodes after 48 hours, free R848 induced only modest levels of IL-12 and IFN- [159] . CpG-ODN, an agonist of TLR-9, is another adjuvant that's frequently coupled with nanocarriers for vaccination studies [11, 67, 100, 101, 160, 161] . Some of the primary advantages of nanoparticle-based CpG formulations include strong T cell responses, dosage sparing, and reduced systemic side effects.
+SARS:05a12a1fb4a86a4158ad027b911092cfc25bc40b:fulltext:95e2acfefe40f5beb94f99e44b14295b:38086..38234:sentences:d93e7a059a750ed946fcc184aff0f034	TLR4|TLR7	TLR4|TLR7	By incorporating multiple distinctive activators of TLRs, including monophosphoryl lipid A (a TLR4 agonist) and R837 (a TLR7 agonist), Kasturi et al.
+SARS:05a12a1fb4a86a4158ad027b911092cfc25bc40b:fulltext:95e2acfefe40f5beb94f99e44b14295b:38956..39812:sentences:ca8a8bd152b2360a67debcd5daae6ba9	CD19|CR2	CD19|CD21	Virus surfaces display antigenic epitopes in an ordered and highly repetitive fashion, and the presentation of repetitively arranged and appropriately spaced antigens on the surface of virus or virus-like particles has been linked to enhanced immune responses [166] . Many reports have shown that numerous components of the mammalian immune system have evolved to respond strongly to the repetitive antigen patterns frequently found on pathogens [167] [168] [169] . In comparison, non-repetitive antigens are usually less effective in inducing immune responses [170] [171] [172] [173] . Repetitive motifs on viral surfaces are also found to activate the complement system [174] engaging the CD19-CD21 complex, which further facilitates B cell activation and amplify other immune processing pathways [175] .. Repetitive antigen display for immune activation.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:347..515:sentences:37d6a082295a7a6d68a76cd9f7d45e97	IFNAR1|IFNAR2	IFN- receptor 1 (IFN AR1|IFN AR2	All members of the type I IFN family signal through a ubiquitously expressed heterodimeric receptor that is composed of the IFN- receptor 1 (IFN AR1) and IFN AR2 chains.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:2241..2413:sentences:d0131544c97efca1c8937a98112d2fbf	CD27|ITGAM|KLRG1	CD27|CD11b|KLRG1	cells were able to mature nearly as well as WT NK cells in response to MCMV infection, as indicated by the down-regulation of CD27 and up-regulation of CD11b and KLRG1 (Fig.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:2842..3190:sentences:648f05de9c97af6b1e27beb8779ad048	STAT1|STAT2|STAT1|STAT1|STAT1|STAT1	STAT1|STAT2|STAT1|STAT1|STAT1|STAT1	1 D) , highlighting the importance of type I IFN signaling, specifically in NK cells, for protective immunity against viral challenge.. . Type I IFNs signal through STAT1-STAT2 heterodimers and STAT1-STAT1 homodimers (Li et al., 1996) . Therefore, we determined the role of STAT1 in the NK cell response to MCMV infection using STAT1-deficient mice.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:3316..3795:sentences:a08295749433d833d73219ba4d474008	STAT1|STAT1|STAT1|IFNA1	Stat1|Stat1|STAT1|IFN	Similar to Ifnar / NK cells, Stat1 / NK cells exhibited a striking defect in expansion during the immune response to MCMV infection ( Fig. 2 A) , even though Stat1 / NK cells were able to mature nearly as well as WT NK cells after infection (Fig. 2, B and C) . These data support the importance of STAT1-mediated type I IFN signaling in NK cells for an optimal antiviral NK cell response.. Type I IFN promotes the activation and effector function in NK cells after MCMV infection.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:3797..4144:sentences:df9ce1c29504333e8c7511af71e3b3f8	CD27|ITGAM|KLRG1	CD27|CD11b|KLRG1	Type I IFN has both direct and indirect effects on NK cell development and maturation (Mizutani et al., 2012; Guan et al., 2014) . In accordance with these prior studies, resting splenic NK cells from Ifnar / mice exhibited an increase in immature NK cells as indicated by CD27, CD11b, and KLRG1 expression when compared with WT (unpublished data).
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:5760..5861:sentences:ac1ba67ac5485cf849e9276c26c09259	IFNAR1|STAT1	IFN AR|STAT1	3 E) . Long-lived NK cells were also diminished in NK cell populations that lack IFN AR or STAT1 (Fig.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:7073..7278:sentences:affb0750a7c852e3ab2a3c061613770f	IFNA1|KLRK1	IFN|NKG2D	Together, these findings suggest that type I IFNs shield activated NK cells from cell death during viral infection.. Type I IFN protects NK cells from fratricide via a perforinand NKG2D-dependent mechanism.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:8415..8671:sentences:c45ea0001a9bd5440dcf955bc7070cc0	NCR1|CD8A	NKp46|CD8	To confirm that the elimination of Ifnar / NK cells in WT mice was caused by host NK cells and not CD8 + T cells or another cell source, we transferred equal numbers of WT and Ifnar / NK cells into WT or NKp46 Cre  R26 DTA hosts and infected them with LCMV.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:9225..9466:sentences:007a3b1866a56532f90fac0c3f48034a	IFNA1|KLRK1	IFN|NKG2D	Thus, these findings support a perforin-dependent NK cell-mediated elimination of NK cells that are unable to sense type I IFNs during viral infection.. Type I IFN protects NK cells from fratricide via a perforinand NKG2D-dependent mechanism.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:9468..9711:sentences:7ffc963c314b9344077c48aefabc5952	NCR1|KLRK1	NKp46|NKG2D	To further uncover the mechanism behind NK cellmediated fratricide, we investigated NKp46 and NK group 2 member D (NKG2D) triggering in NK cells as potential activating signals involved in the killing of Ifnar / NK cells during viral infection.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:9713..10013:sentences:fbc0f0de620ada1bf75ac7bd0832c8ce	NCR1|NCR1|NCR1|NCR1|CD8A	NKp46|Ncr1|Ncr1|NKp46|CD8	Because NKp46 has been suggested to promote NK cell-mediated killing of CD8 + T cells unable to sense type I IFNs (Crouse et al., 2014) , we tested whether this receptor contributed to NK cell-mediated fratricide using Ncr1 gfp/gfp mice in which the Ncr1 gene, which encodes protein NKp46, is deleted.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:10266..10454:sentences:4f3893c582bc88463ed6afa69202c207	NCR1|IFNA1|KLRK1	NKp46|IFN|NKG2D	5 B) , indicating that NKp46 does not play a role in NK cell-mediated killing of Ifnar / NK cells.. Type I IFN protects NK cells from fratricide via a perforinand NKG2D-dependent mechanism.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:11529..11800:sentences:a944e0b0f313bfb648fffea232d80000	KLRK1|IFNA1	NKG2D|IFN	Collectively, these data indicate that type I IFN acts to combat NK cell-mediated fratricide that is dependent on NKG2D triggering and perforin release.. Type I IFN is dispensable for NK cell survival and memory formation during MCMV infection in mice lacking WT NK cells.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:12110..12272:sentences:179ebc91550f7f628650d4c6845f62f7	RAG2|IL2RG	Rag2|Il2rg	NK cells from mixed chimeric mice were transferred into Rag2 /  Il2rg / hosts (which lack T, B, and NK cells), and the recipient mice were then infected with MCMV.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:12408..12580:sentences:f97349e2ba79c7b59c74dc98353810ab	CD27|ITGAM|KLRG1	CD27|CD11b|KLRG1	6 A) . Activation and maturation of virus-specific Ifnar / NK cells were nearly identical to WT NK cells, as indicated by CD27, CD11b, and KLRG1 expression at day 7 PI (Fig.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:13857..14740:sentences:a57a0dcf9b1aab017c5d209129ceb300	IFNAR1|STAT1	Ifnar1|Stat1	In certain viral systems, such as during vaccinia virus infection, NK cell-dependent and -independent effects of type I IFN have been reported where NK cells were directly harvested from WT and Ifnar1 / or Stat1 / mice (Martinez et al., 2008; Fortin et al., 2013) . Other viral models, using mouse hepatitis virus or dengue virus infection, underscore the importance of type I IFN signaling in innate cells for viral control, with the primary focus being macrophages and dendritic cells (Cervantes-Barragn et al., 2009; Zst et al., 2014) . In the context of MCMV infection, type I IFN has long been known to mediate antiviral effects, partly through its activity on NK cells (Nguyen et al., 2002) . However, the overwhelming majority of previous studies have failed to distinguish between the direct and indirect effects of type I IFNs on NK cells during the course of MCMV infection.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:16142..16502:sentences:2c4fba0bd9ae0ddc4daf6aac6b0a074d	IFNA1|IFNA1|IL15	IFN|IFN|IL-15	These studies relied on the direct infection of IFN-deficient mice (Geurs et al., 2009) , which fails to consider the effects of higher viral loads or administration of IFN-neutralizing antibodies during viral infection (Orange and Biron, 1996) , which could directly affect production of IL-15, a cytokine known to influence NK cell survival and proliferation.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:17067..17595:sentences:968c78ef83434446b253536d2fb272c1	BCL2|IL2|IL15|IL7|BCL2|CD8A|CD8A|IL15	Bcl-2|IL-2|IL-15|IL-7|Bcl-2|CD8|CD8|IL-15	Type I IFN previously has been described to promote the survival of activated CD8 + T cells in a manner that is independent of Bcl-2 (Marrack et al., 1999) , perhaps by enhancing the responsiveness of antigen-specific CD8 + T cells to IL-2 and IL-15 (Le Bon et al., 2006) and by regulating the expression of IL-7 and IL-15 cytokine receptors (Schluns and Lefranois, 2003) . Consistent with this hypothesis, we found no difference in the expression of Bcl-2 between WT and Ifnar / NK cells after MCMV infection (unpublished data).
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:17920..18379:sentences:13295b45504db1a23534c31df31bc771	CD8A|CD8A|NCR1|CD8A	CD8|CD8|NKp46|CD8	Recently, type I IFN has been shown to protect antiviral CD8 + T cells from NK cell-mediated killing, as two independent studies observed the selective elimination of Ifnar / CD8 + T cells after LCMV infection (Crouse et al., 2014; Xu et al., 2014) . This preferential elimination of Ifnar / CD8 + T cells was a consequence of the differential expression of inhibitory (MHC class I; Xu et al., 2014) and activating (NKp46; Crouse et al., 2014) NK cell signals.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:19453..19685:sentences:747a48cc11872f348207d32148798262	NCR1|CD8A|NCR1	NKp46|CD8|NKp46	Expression of NKp46 ligands was another mechanism suggested to trigger NK cell-mediated killing of Ifnar / CD8 + T cells (Crouse et al., 2014) ; however, we found no role for NKp46 in NK cell-mediated elimination of Ifnar / NK cells.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:19687..19883:sentences:18c7707c6fac78862ab3de8f99738860	NCR1|CD8A	NKp46|CD8	Thus, unlike with NK cellmediated killing of CD8 + T cells, our data do not support a role for MHC class I molecules or NKp46 ligands in NK-NK cell fratricide during viral infection.. DIS CUSSI ON.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:19885..20336:sentences:b9bd8e68a2f8873d65705e1671b2e268	STAT4|ZBTB32|IL12RB1	STAT4|Zbtb32|Il12rb	We previously demonstrated that the proinflammatory cytokine IL-12 and downstream signaling components STAT4 and Zbtb32 are critical for the clonal-like proliferation of Ly49H + NK cells during MCMV infection (Sun et al., 2012; Beaulieu et al., 2014) . Interestingly, the expansion defect in Ifnar / NK cells is nearly as pronounced as that of the Il12rb / NK cells, demonstrating a nonredundant role for these cytokines in promoting NK cell expansion.
+SARS:04421db3d34e7fd7c7486d66d21b34978a1fb362:fulltext:558e10191475ce142d5726f452a1cc48:21315..21478:sentences:7410f7ca9d1345bd0be1d5f5a5022bf0	IFNAR1|STAT1|PRF1	Ifnar1|Stat1|Prf1	Taconic), Ifnar1 / (Mller et al., 1994) , Stat1 / (Meraz et al., 1996) (Gazit et al., 2006) , Prf1 / (The Jackson Laboratory), and R26 DTA (The Jackson Laboratory).
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:219..675:sentences:ddc3beb5409c89b44af2d48e5152066c	USF2|USF2|USF2|	FIP|FIP|FIP|FIP [1, 2	FCoV is transmitted by the fecal-oral route and usually causes mild to inapparent enteritis, and FIP is considered to be induced by a virulent mutant of the enteric FCoV [16, 22] . It is divided into 2 clinical forms, effusive FIP, in which effusion is observed in body cavities, and non-effusive FIP [1, 2] . Non-effusive FIP lacks specific clinical signs, with lesions presented mainly in the eyes, central nervous system (CNS), and parenchymatous organs.
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:677..984:sentences:c2131ff7895c4794c0513350de821259	USF2|USF2|USF2|CSF2	FIP|FIP|FIP|CSF	Clinical signs associated with CNS disease in cases of FIP are observed in about 10% of all FIP cases and 25-33% of non-effusive FIP cases [1, 2, 9] . Recently, image diagnosis is often performed especially for neurological instances in veterinary medical field, and CSF sample can be collected at that time.
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:986..2280:sentences:5749663b9174189490e860356a1e2d29	USF2|USF2|USF2|USF2|CSF2|CSF2|CSF2|CSF2|CSF2|USF2	FIP|FIP|FIP|FIP|CSF|CSF|CSF|CSF|CSF|FIP	Detection of FCoV-specific antibody in CSF, which is produced by local replication of FCoV in brain tissue, is useful for the ante-mortem diagnosis of neurologic-form FIP [9] . Several studies have reported the anti-FCoV antibody titers in CSF, but the number of clinical cases reported is small, and no diagnostic index of FIP has been proposed [4, 10, 20] .. . Substances with a molecular weight smaller than 160,000, such as immunoglobulin G antibodies and albumin, enter the brain relatively easily from circulating blood, and their levels reportedly range from 1/256 to 1/2,048 of that in serum in subjects with a normal blood brain barrier (BBB) [5, 11, 21] . Hence, CSF antibody should be simultaneously examined with serum antibody.. . In this study, for determination of diagnostic criteria of FIP for CNS infected cases using the FCoV antibody test, we examined anti-FCoV antibody titers in CSF and sera from cats with neurological signs.. . CSF and serum samples obtained from 271 clinically FIP-suspected cats with neurological signs under general anesthetic during image diagnosis, which had been submitted to a veterinary clinical laboratory (Marupi Lifetech, Osaka, Japan) from veterinarians between 2006 and 2016 for diagnosis of FIP, were examined for anti-FCoV antibody titers.
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:2331..2826:sentences:59e24de62664c4bdba95d269ecb11a9a	USF2|CSF2	FIP|CSF	The antibody titers were performed employing an indirect fluorescent antibody method [15, 17] . Briefly, confluent monolayers of Crandell-Rees feline kidney cells were infected with FIP virus strain 79-1146 (American Type Culture Collection, Rockville, MD, U.S.A.) in a 96-well tissue culture plate and allowed to incubate for 20 hr, then the plate was fixed with a methanol-acetone solution, with CSF and serum samples subjected to 2-fold serial dilutions started at 1:10 and 1:80, respectively.
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:3200..3540:sentences:60f70b555f6b8c616e0d64178d287621	CSF2|USF2|FIP1L1|CSF2|CSF2|CSF2|CSF2	CSF|FIP|FIP [1, 8|CSF|CSF|CSF|CSF	In addition, CSF samples from 24 CSF antibody-positive and 21 CSF antibody negative cats were subjected to FCoV RT-PCR using the P205-P211 primer pair [13, 18] for definitive diagnosis of FIP, as the demonstration of FCoV RNA in CSF is highly suggestive of FIP [1, 8] . The anti-FCoV antibody was detected in CSF samples from 28 cats (10.3%)
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:4720..5073:sentences:d0c2e34fc0e3dfbaafa5709b1ece8fda	USF2|FIP1L1|CSF2|CSF2	FIP|FIP [1, 8|CSF|CSF	It is considered that when FCoV RNA is detected in CSF, that animal is very likely to have FIP [1, 8] . Furthermore, the S/C of Group B cats (8 or lower) was markedly lower than normal range (256-2,048) [5, 11, 21] . Based on above findings, we propose that a CSF antibody titer of 1:640 or higher is served as a candidate for the index of FIP diagnosis.
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:5075..5760:sentences:27b3f54599c7ae1240a31ef1874a913e	USF2|CSF2|USF2|USF2|CSF2	FIP|CSF|FIP|FIP|CSF	Our results would suggest that FIP may be able to be often diagnosed by an antibody test, which allows relatively stable measurement, without genetic examinations such as RT-PCR, in which the contamination of amplicon and ribonuclease to a test sample can lead to any erroneous test result, and expensive equipment and a high level skill are required for performance.. . However, method for CSF anti-FCoV antibodies in cats with neurological FIP have a low level of sensitivity [1] , and FIP cases with neurological signs with a normal S/C have been reported [14, 20] . In this study, the RNA was detected in two Group A cats, even though the CSF antibody titer was low (1:10 and 1:20).
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:5830..6019:sentences:7eae8d80c34280302f5f575ad0a50169	USF2|CSF2	FIP|CSF	Furthermore, no cases with CSF antibodies at titers of 1:160 and 1:320 were detected in this study, and we could not verify a relationship between the antibody titers and FIP in these cases.
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:6145..6426:sentences:a3b1964729241dbf9b3944d6912115e2	USF2|CSF2	FIP|CSF	Therefore, it is considered that even if the antibody in the CSF is negative or low, FIP cannot be ruled out.. . We were not able to obtain more detailed information, such as other examination results and clinical signs, from the attending veterinarians regarding the cats examined.
+SARS:05cc87a56d714cc75ce393c73f3076d3f8a463b5:fulltext:36e2c34ffba5b72e192de80c63526b38:6428..7142:sentences:caccfea5f277d6397de7ac88cc69d343	USF2|USF2|USF2|CSF2|CSF2	FIP|FIP|FIP|CSF|CSF	Additional epidemiological investigations are necessary to more accurately and efficiently diagnose FIP using anti-FCoV antibody testing of CSF samples.. . The S/C may also decrease due to a nonspecific collapse of the blood-brain barrier causing excess contamination of CSF with blood, even though the CNS is not infected [12] . In fact, it has been reported that non-FIP cases with CNS involvement showed marked reduced S/C [4, 14, 20] . A comparison of that ratio of antibodies against viruses other than the target virus or albumin may be useful to diagnose various viral infections [3, [5] [6] [7] 19] . It may be necessary to investigate the usefulness of addition of such reference tests when diagnosing FIP.
+SARS:05b5ca303bd262f2a8e7d9d05d203f023867d0ed:fulltext:903d6f5623eb579ddb91adde547385c8:6726..7050:sentences:80b84b1cafdcab6e0b715b64e078e8a7	CD8B|LGALS2|LGALS2|CD8B|CD8B|CD8B|CD8B|CD8B	LEU2|gal2|gal2|LEU2|LEU2|LEU2|LEU2|LEU2	The following S. cerevisiae strains were used in this study: SF838-1D-8A1 (MATch, phoSA ::LEU2, ade6, gal2) , pho8A::LEU2, ade6, gal2, , JHRY20-1A-13 AgA (MATot, steJ3A::LEU2, dap2A:: HIS3, , JHRY20-1ASA1 (MATtx, phoSA::LEU2, , phoSA::LEU2, and CRY2-8A (MATot, kex2A::URA3, pho8A:: LEU2, trpl) .. Yeast Strains and Materials.
+SARS:05b5ca303bd262f2a8e7d9d05d203f023867d0ed:fulltext:903d6f5623eb579ddb91adde547385c8:7225..7452:sentences:2b4808076d5bf083a48c8ff3b8b0aa98	ALPP|DNAH8|ALPP	ALP|ATPase.|alkaline phosphatase	(Costa Mesa, CA); glusalase was 1. Abbreviations used in this paper: ALP, alkaline phosphatase; CEN, yeast centromere; DPAP, dipeptidyl aminopeptidase; V-ATPase, vacuolar protontransloeating ATPase.. Yeast Strains and Materials.
+SARS:05b5ca303bd262f2a8e7d9d05d203f023867d0ed:fulltext:903d6f5623eb579ddb91adde547385c8:18652..19019:sentences:37bacdb7f51b27d2947213bbf80ef7ac	FANCB|ALPP	Fab|ALP	(1991) and involved the following incubations: (a) I:10 dilution of rabbit anti-ALP, (b) 10 #g/ml Fab fragment of goat-anti-rabbit IgG (H + L), (c) 1:50 dilution of rabbit anti-Kex2p, (d) 1.5/~g/ml mouse anti-rabbit IgG (H + L), and (e) 1.5 ~g/ml each of rhodamine-conjugated rabbit anti-goat F(ab')2 and FITC-conjugated rabbit anti-mouse F(alY)2.. lmmunofluorescence.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:13109..13460:sentences:ceb91d3746b053d26ce7777576bfdc71	JUN|FOS	c-Jun|c-Fos	Two different-sized Ag-NPs (10 and 100 nm) exposed to HepG2 cells induced the proliferation of cells, activation of mitogen-activated protein kinase (MAPK), and upregulation of c-Jun and c-Fos mRNA [86] . Other cell lines including A2780, MCF-7, and MDA-MB 231 showed differential toxicity when exposed to Ag-NPs (40 nm) at a concentration of 10 mg/mL.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:14115..14757:sentences:beef90c44363cdba8d7e79a37683bf79	CASP3|AKT1	caspase-3|Akt	Biologically synthesized spherical Ag-NPs that are 50 nm in size and at a 500-nM concentration inhibited cell survival, VEGFinduced cell viability, cell proliferation, and migration through the activation of caspase-3 and suppression of Akt phosphorylation in bovine retinal endothelial cells (BRECs) [88, 89] . The exposure of rat brain microvessel endothelial cells to Ag-NPs (25, 40, or 80 nm) resulted in significant BBB inflammation and permeability, suggesting that Ag-NP toxicity may be characterized by the particle size, surface area, dose, and exposure time for the particular cell model [90] .. Effects of particle size variability.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:29913..30289:sentences:f6039991a9716e252d3f44d6e6bf7351	ALB|UBC|ALB	serum albumin|ubiquitin|serum albumin	Various investigations have been conducted on various types of corona effects, examining the interactions of structure based (cube, sphere, wire, and triangle) silver nanoparticle with fetal calf and bovine serum (FBS), bovine serum albumin (BSA), human blood plasma, human serum albumin (HSA), tubulin, ubiquitin (cytoskeletal protein), and hyaluronan-binding protein in situ.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:37552..37760:sentences:7779631a18de6b0573188f3bd287fe20	ATF6|NLRP3|NLRP3	ATF-6|NLRP-3|NLRP-3	reported that Ag-NPs target and induce ATF-6 degradation, leading to activation of the NLRP-3 inflammasome and pyroptosis, which provides a new link between ER stress and activation of the NLRP-3 inflammasome.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:46722..47848:sentences:77317d4173c192c709b92f6a8ae4f9fd	MMP3|MMP3|MMRN1	MMP3|MMP|ECM	However, excessive ROS can collapse the antioxidant defense system, leading to the damage of DNA, proteins, and lipids [75] . Mitochondria mainly release ROS, leading to oxidative stress, disruption of ATP synthesis, DNA damage, and eventually apoptosis [173] . Likewise, Ag-NPs usually generate ROS after entering into the cell [172] . As ROS levels increase, the GSH level decreases dramatically and at the same time LDH increases in the medium, which ultimately induces apoptosis [174] . Increased levels of ROS ensure oxidative stress that might cause calcium dysregulation or neurodegeneration in neuronal cell [96, 175] . Oxidative stress resulting from Ag-NPs can damage the antioxidant defense capacity of the cell, damage DNA, and finally lead to apoptosis, especially in human cell lines [172, 174, [176] [177] [178] [179] . Intracellular oxidative stress causes MMP3to secret a specific amount of MMP, an extracellular matrix (ECM) digester protease [180, 181] . Moreover, ROS generation also affects redox homeostasis at the intracellular level, and as a result, lipid peroxidation and protein carbonylation occurs.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:48252..48693:sentences:c1f6ab82232db531f57736c094fbb624	TP53|AKT1|AKT1|MAPK14	p53|AKT|AKT|p38	Several studies have shown that Ag-NPs induced toxicity is triggered by the increase of ROS generation [183] . In vitro instillation of Ag-NPs into the cell could generate overproduction of intracellular ROS, which activates cell death-regulating pathways such as p53, AKT, and MAPK signaling apoptotic pathways [184] . Over production of ROS causes the down regulation of total AKT, which increases the expression of proapoptotic kinase p38.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:48695..48927:sentences:30a8330c5848985ecd5907a19f1481fb	PARP1|PARP1|CASP3|TP53|TP53|TP53	PARP|poly ADP ribose polymerase|caspase-3|p53|p53|p53	Meanwhile, decrease in PARP (poly ADP ribose polymerase) expression resulting significant increase of caspase-3, H2X, p-p53, and total p53 expressions [184] . Thus nanosilver can induce apoptosis following p53 signaling pathway (Fig.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:49037..49350:sentences:e55b698843d1257d33f58f7beba42bf8	MAPK8|BCL2|BAX|CYCS	JNK|Bcl-2|BAX|cytochrome c	Effect of Ag-NPs on mitochondrial membrane permeability could cause loss of mitochondrial integrity, which may regulate JNK mediated caspase dependent apoptosis [60] . Loss of mitochondrial membrane potential (DW) regulate down-regulation of Bcl-2, upregulation of BAX and release of cytochrome c into the cytosol.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:49352..49429:sentences:d7a15412279e020fa7a228d3f8c504e0	BCL2|MAPK8|JUN	Bcl-2|JNK|Jun	Down-regulation of Bcl-2 can be influenced by JNK (Jun aminoterminal kinases).
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:49431..49558:sentences:c4b73fa68541c68c223aa7dc6562401f	MAPK8|BCL2|BCL2	JNK|Bcl-2|Bcl-2	JNK is a member of MAPK family, which participate in apoptosis via phosphorylation of Bcl-2, consequences inactivation of Bcl-2.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:49560..49800:sentences:bfa86528b1398c974ccd77efaa6227d8	CYCS|CASP9|MAPK8	cytochrome c|caspase 9|JNK	Release of cytochrome c into the cytosol initiates a cascade that leads to the initiation of caspase 3 through apaf-1 and caspase 9 [185] . Thus Ag-NPs can induce apoptosis via mitochondria and caspase dependent pathway mediated by JNK (Fig.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:49930..50147:sentences:a373ee2c805600ee3df8e3ba684ddb2a	TP53|	p53|p21	[113] . Ag-NPs could have effect on the cell cycle and induc-tion of DNA hypermethylation following the p53 or p21 pathway, which may have effect on epigenomic level [113] .. Different toxicological pathways of Ag-NPs.
+SARS:05af85c50dd5c80a25fc3dd985d31f0d563d0019:fulltext:09076cfc18c6b5d660c635926f4950a7:52190..52653:sentences:367a1de1c2b398e9e11a7f6af7d48d4d	NFE2L2|KEAP1|NFE2L2|NFE2L2	Nrf2|Keap-1|Nrf2|Nrf2	Nrf2 can play a central role in protecting the cell from oxidative, electrophilic, and nitrosative stress, especially in the intestinal cell, through the induction of antioxidant-responsive genes and genes of the phase II detoxifying enzyme [187] [188] [189] [190] . Oxidation of Keap-1 dissociates Nrf2 and it is then translocated into the nucleus and ultimately activated [191] . Thus, activation of Nrf2 influences the generation of cytoprotectors such as HO-1.
+SARS:069bf4da8f0f4f540b9f6a16021e007442e7e027:title:ce9b929b64bd2caff389e69b8a05282e:0..141:sentences:e9e496244aeb71466a31d0e9305a689d	MYD88|IRF5|NOS2	MyD88|Irf5|Nos2	MyD88-dependent influx of monocytes and neutrophils impairs lymph node B cell responses to chikungunya virus infection via Irf5, Nos2 and Nox2
+SARS:0666ca679df1885492aa1420fd995790d363b8a5:abstract:de2ba1bff6152066ba7dc2e7dc9d5c2c:548..726:sentences:38cb8f1f7b11c7c96d7312ec6557a175	ERVW-1|CD4	Env|CD4	This includes understanding how the Envelope (Env) protein of these virions interacts with the T-cell receptor CD4, which supports attachment and entry of HIV-1 into target cells.
+SARS:0666ca679df1885492aa1420fd995790d363b8a5:abstract:de2ba1bff6152066ba7dc2e7dc9d5c2c:1448..1690:sentences:2a771fc683c7763ce49015a13850077d	ERVW-1|CD4|CD4	Env|CD4|CD4 receptor	To substantiate this, we engineered an early HIV-1 Env to have high, medium, or low binding affinity to CD4, and we show that it loses the ability to enter cells via the CD4 receptor of many primate species as the binding affinity gets weaker.
+SARS:06c89f69aa7b5f9648d2c1543b8246fe9c3610cf:fulltext:8baaa909c4bbbeba590f2d3ebd7a6e78:2490..2867:sentences:f963351fc66172356069147a0317e193	ACE2|SARS|SARS|SARS	ACE2|SARS|SARS|SARS	The genome sequence of 2019-nCoV is about 89% identical to bat SARS-like-CoVZXC21 and 82% identical to human SARS-CoV [7] . It has been reported that 2019-nCoV uses the same cell entry receptor, ACE2, to infect humans, as SARS-CoV [8] , so clinical similarity between the two viruses could be expected, E-mail address: jieliangchen@fudan.edu.cn. . Transmissibility of 2019-nCoV.
+SARS:06c89f69aa7b5f9648d2c1543b8246fe9c3610cf:fulltext:8baaa909c4bbbeba590f2d3ebd7a6e78:8242..8486:sentences:1e1d698e0a0311a2cd772879204ccd1e	ACE2|SARS	ACE2|SARS	Notably, ACE2, the receptor protein of both SARS-CoV and 2019-nCoV, is abundantly present in humans in the epithelia of the lung and small intestine [15] , and coronaviruses can infect the upper respiratory and gastrointestinal tract of mammals.
+SARS:06c16fa82eea996e285bd1611bc929d57dfb0a8f:abstract:e86174a267a9a498694716593481f87d:582..699:sentences:054df48938828ae740bff4c37e1263f6	CDKN1A|CDK1|CDK2|CDK4|CCNA2	p21|cdc2|cdk2|cdk4|Cyclin A	PEDV infection up-regulates the levels of p21, cdc2, cdk2, cdk4, Cyclin A protein and down-regulates Cyclin E protein.
+SARS:06c16fa82eea996e285bd1611bc929d57dfb0a8f:abstract:e86174a267a9a498694716593481f87d:701..933:sentences:479ae7474e89da77bf5cbc3de789c5d2	TP53|CDKN1A|PCNA	p53|p21|Cyclin	Further research results showed that inhibition of p53 signaling pathway can reverse the cell cycle arrest in G0/G1 phase induced by PEDV infection and cancel out the up-regulation of p21 and corresponding Cyclin/cdk mentioned above.
+SARS:065497953c64b5163eb29e9a4fe78534f244ca26:fulltext:a36ca0b8061aa9f0458a58284f69b490:9611..9758:sentences:74c1e3fbbf86fd6667b7c8a2153191fd	|ENPP3	B1, B2, B3, B6, and B7|B10	Of these eight, five (B1, B2, B3, B6, and B7) developed symptoms during isolation, and three (B8, B9, and B10) developed symptoms during quarantine.
+SARS:066d9708265a90886808c378340547b6460afde9:abstract:33756594fc7ff4405bcd3e2b26c96172:729..789:sentences:9d5f3c0c26ef08e7a63f4e6ce76642de	CD79A|KRT20|NCAM1	CD79a|CD20|CD56	The neoplastic lymphoid cells expressed CD79a, CD20 and CD56.
+SARS:06c4f9daabdf5ee16fb4b581a954e3909d9f17a0:fulltext:12dcdc063ede51e29736e4ae013f1a44:7790..8088:sentences:1877ebf19ca5f245505c3d64331d9b67	|||MRAP|	A24|A1, B8 and B39|A3 and B7|B27|A26	Of the 12 supertypes studied, the largest number of nonamers was found to be recognized by the allele B62 (53), followed by B58 (38) , A2 (36), A24 (24), A1, B8 and B39 (21), B44 (20), A3 and B7 (19) , B27 (17) and A26 (15) , as illustrated in Figure 1 .. Prediction of MHC class I binding peptides.
+SARS:06c4f9daabdf5ee16fb4b581a954e3909d9f17a0:fulltext:12dcdc063ede51e29736e4ae013f1a44:15670..15982:sentences:94c33a9111fb7efa329aba1c739281b1	MRAP|SEC14L2||	B27|transporter associated with antigen processing (TAP)|A26|A24	services/NetCTL/) (40 ) predicts peptides restricted to 12 HLA class I supertypes (A1, A2, A3, A24, A26, B7, B8, B27, B39, B44, B58 and B62), integrated with predictions of HLA binding, proteasomal C-terminal cleavage and transport efficiency by the transporter associated with antigen processing (TAP) molecules.
+SARS:069bf4da8f0f4f540b9f6a16021e007442e7e027:abstract:2f34e5fc1bf15590a25b23cc7c2d3a64:697..833:sentences:3aa4faebd2dbd8030bd8d81428a34f31	NOS2|NOS2|CYBB	inducible nitric oxide synthase|iNOS|Nox2	Both inducible nitric oxide synthase (iNOS) and the phagocyte NADPH oxidase (Nox2) contributed to impaired dLN organization and function.
+SARS:069bf4da8f0f4f540b9f6a16021e007442e7e027:abstract:2f34e5fc1bf15590a25b23cc7c2d3a64:835..957:sentences:f476edc31bf7f5fe15e1acff71b7aaba	IRF5|IFNAR1|TLR7|NOS2	IRF5|IFNAR1|TLR7|iNOS	Infiltrating monocytes expressed iNOS through a local IRF5- and IFNAR1-dependent pathway that was partially TLR7-dependent.
+SARS:072b14ae999cacac8ce8e35bf4b42999dcc6a48a:title:ac78776e9d6360aabfc6e6ac57ddefec:0..85:sentences:da1aa9aa7cf9fb574025fee6853e1328	|TP53	p17|p53	Retardation of cell growth by avian reovirus p17 through the activation of p53 pathway
+SARS:0749cab30d660b29d52b5346b02773a3f36fda0d:abstract:0a32bea7d747467d05be18cb6eec3979:469..742:sentences:cea03ef60801258f97b3ba311431f788	CD9|CD81|DPP4|DPP4|TMPRSS2	CD9|CD81|dipeptidyl peptidase 4|DPP4|TMPRSS2	Using knockout cell lines, we found that the tetraspanin CD9, but not the tetraspanin CD81, formed cell-surface complexes of dipeptidyl peptidase 4 (DPP4), the MERS-CoV receptor, and the type II transmembrane serine protease (TTSP) member TMPRSS2, a CoV-activating protease.
+SARS:0749cab30d660b29d52b5346b02773a3f36fda0d:abstract:0a32bea7d747467d05be18cb6eec3979:1031..1135:sentences:fff771a1fb22c4a718a46ca7f13af244	DPP4|CD9	DPP4|CD9	Thus, we identified DPP4:CD9:TTSP as the protein complexes necessary for early, efficient MERS-CoV entry.
+SARS:0749cab30d660b29d52b5346b02773a3f36fda0d:abstract:0a32bea7d747467d05be18cb6eec3979:1359..1578:sentences:82d303899f612af829474d10c93dfe2d	DPP4|CD9|TMPRSS2|CD9|TMPRSS2	hDPP4|Cd9|Tmprss2|CD9|TMPRSS2	When the rAd5-hDPP4 vectors co-expressed small RNAs silencing Cd9 or Tmprss2, the animals were significantly less susceptible, indicating that CD9 and TMPRSS2 facilitated robust in vivo MERS-CoV infection of mouse lungs.
+SARS:072b14ae999cacac8ce8e35bf4b42999dcc6a48a:abstract:f6cc6014436b3e915a3eb245b8f604be:588..843:sentences:bcdd52fb13345478afc11d1757b8fc50	|CDKN1A|CDKN1A|CDKN2B|CDKN2A	p17|p21cip1|waf1|p15INK4b|p16INK4a	Semi-quantitative RT-PCR and Western blotting revealed that p17-expressing cells induced the expression of CDK inhibitor p21cip1/waf1 in a time- and dose-dependent manner, but the transcripts of CDK inhibitor p15INK4b, p16INK4a, or p27kip were not altered.
+SARS:072b14ae999cacac8ce8e35bf4b42999dcc6a48a:abstract:f6cc6014436b3e915a3eb245b8f604be:845..951:sentences:21004a84474750449e81bf799290f045	|TP53|TP53	p17|p53|p53	In the presence of p17, the p53 protein level and p53-driven reporter activity were elevated significantly.
+SARS:072b14ae999cacac8ce8e35bf4b42999dcc6a48a:abstract:f6cc6014436b3e915a3eb245b8f604be:953..1067:sentences:9794f73a2383ef7f161a9dc87139bed5	TP53|CDKN1A|TP53|	p53|p21|p53|p17	Dominant negative p53 alleviated the p21 accumulation, p53 activation, and growth inhibition effect induced by p17.
+SARS:072b14ae999cacac8ce8e35bf4b42999dcc6a48a:abstract:f6cc6014436b3e915a3eb245b8f604be:1069..1212:sentences:cbbba7a0642ca3fcfb56013af0459adb	|TP53|CDKN1A|CDKN1A	p17|p53|p21cip1|waf1	Taken together, these studies revealed a possible intrinsic function of p17 in growth regulation through the activation of p53 and p21cip1/waf1.
+SARS:0741533a3a9c97880fb1d7f184d569a6e5191ef1:abstract:a27cd34ad938bbef0daac4058a6c7b58:1067..1183:sentences:702b8e82952b1c94b003ffa633e31572	NCR2|NCR1	NKp44|NKp46	The activating receptors repertoire expressed by NK cells was also higher in NPA samples, especially NKp44 and NKp46.
+SARS:07241235ee553a5b165ed19b2091101128eca805:fulltext:33b736f54de819235a9c6a96d3fb43aa:210..718:sentences:a4c5bcb758f423fce1d97b4dc07e944d	IVNS1ABP|NPTX1|ASZ1|NPTX1	NS1|NP1|ORF3|NP1	BoVs were first described in humans (3) and have also been detected in canine, feline, and porcine hosts (4) . They are a genetically diverse group, distinct from the other members of Parvovirinae as they contain three major open reading frame (ORFs), coding for four genes (NS1, NP1, and VP1/2) (5, 6) . The presence of ORF3 is a near exclusive trait of bocavirus species (shared with PPV4), coding for NP1 protein, which is essential in viral propagation (7, 8) . PBoV was first detected by Blomstr m et al.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:360..474:sentences:11da8953399c47231a34ff991afb6ec3	SIRT1|SIRT7	SIRT1|SIRT7	The seven mammalian sirtuins, denoted SIRT1-SIRT7, have distinct cellular locations and target multiple substrates.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:1928..2252:sentences:8b8de6a2fa53ebbf942272d87b88c76c	SIRT7|POLI|POLR1E|POLI|POLR1E|POLI|POLI	SIRT7|Pol I|PAF53|Pol I|PAF53|Pol I|Pol I	SIRT7 is enriched in nucleoli and activates RNA polymerase I (Pol I) transcription by deacetylating PAF53 (Polymerase-Associated Factor 53), a core subunit of mammalian Pol I (12) . Hypoacetylation of PAF53 enhances pre-rRNA synthesis by facilitating the association of Pol I with rDNA, thereby promoting Pol I transcription.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:2375..2729:sentences:1ccf069f1714456757e0adcc8da4fe9e	SIRT7|SIRT7|POLR1E|SNORD15A	SIRT7|SIRT7|PAF53|snoRNA	Reversible acetylation modulates the association of U3-55k protein with U3 snoRNA, deacetylation by SIRT7 enhancing the interaction (13) . Upon exposure to cellular stress, SIRT7 is released from nucleoli and accumulates in the nu-cleoplasm, which leads to hyperacetylation of both PAF53 and U3-55k and defects in transcription and processing of pre-rRNA.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:2731..2934:sentences:c6a79cc5525ece086f6b388d974cb005	SIRT7|SNORD15A	SIRT7|snoRNA	These results indicated that SIRT7 controls ribosome biogenesis through a mechanism involving binding to pre-rRNA and U3 snoRNA as well as nucleolarnucleoplasmic shuttling in response to stress signaling.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:4154..4286:sentences:f1f6629023755eabbe4651f6b930f36b	SIRT7|CDK9	SIRT7|CDK9	Mechanistically, SIRT7 promotes the release of P-TEFb from the inactive 7SK snRNP complex and deacetylates the P-TEFb component CDK9.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:4288..4449:sentences:b7c7ea21be9c7da11d5467c5ae8b73b6	SIRT7|CDK9|	SIRT7|CDK9|CTD	Deacetylation by SIRT7 activates the kinase activity of CDK9, which phosphorylates the C-terminal domain (CTD) of Pol II and facilitates transcription elongation.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:5523..6316:sentences:b2f0354beb2edcf1f35dfc37350e5cc3	UBTF|POLR1E|SIRT7|CDK9|CHD4|CCNT1|DDX21|HEXIM1|HNRNPK|HNRNPU|NPM1|NPM1|TP53	UBF|PAF53|SIRT7|CDK9|CHD4|cyclin T1|DDX21|HEXIM1|hnRNPK|hnRNPU|nucleophosmin|B23|p53	Antibodies against UBF, PAF53, RPA116 and SIRT7 have been described (13, 17, 18) . The following commercial antibodies were used: anti-acetyl lysine (Cell Signaling Technology, 9441), antiactin (Abcam, ab8227), anti-CDK9 (Santa Cruz, sc-484 (C20)), anti-CHD4/Mi2 (Santa Cruz, sc-55606), anti-cyclin T1 (Santa Cruz, sc-10750), anti-DDX21 (Santa Cruz, sc-376953), anti-Flag (Sigma, F3165), anti-HEXIM1 (Bethyl Laboratories, A303-113A), anti-hnRNPK/J (Santa Cruz, sc-32307), anti-hnRNPU (Santa Cruz, sc-32315), antinucleolin (Santa Cruz, sc-13057), anti-nucleophosmin/B23 (Santa Cruz, sc-53175), anti-p53 (Abcam, ab31333), anti-Pol II (Santa Cruz, sc-56767 and sc-899 (N20)), anti-pSer2-Pol II (Active Motif, 6108), anti-pSer5-Pol II (Abcam, ab5408) and anti-tubulin (Sigma, clone B-5-1-2, T6074).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:6492..6789:sentences:901d6bb03b4a3a79e379718407c6ea70	SIRT7|STAC3|	SIRT7|NAM|AM-160	HEK293T cells expressing Flag/HA-tagged SIRT7 were lysed in buffer AM-160 (160 mM KCl, 20 mM Tris-HCl [pH 7.9], 5 mM MgCl 2 , 0.2 mM EDTA, 10% glycerol, 0.5 mM DTT) supplemented with 0.1% NP-40, protease inhibitors (Roche complete) and HDAC inhibitors (500 nM TSA, 5 mM sodium butyrate, 10 mM NAM).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:12359..12466:sentences:e4191da4d89ded0d562f35170c241580	CDK9|CDK9|KAT2A	CDK9|CDK9|GCN5	To monitor deacetylation, HA-CDK9 was immunopurified from HEK293T cells co-expressing HA-CDK9 and Flag-GCN5.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:12572..12831:sentences:0a7e0ae65bb3764357bbdf585d895960	SIRT7|CDK9	SIRT7|CDK9	Flag-SIRT7 was incubated with bead-bound HA-CDK9 for 1h at 30  C in 10 mM Tris-HCl [pH 8.0], 2 mM MgCl 2 , 10% glycerol, 1 M TSA, 0.2 mM DTT and 2 mM NAD + , and acetylation was detected on immunoblots using antiacetyl-lysine antibodies.. P-TEFb release assay.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:13393..13608:sentences:aeeb07e882524a3384ef0b4f5e54974b	POLR2A|CDK9	RPB1|CDK9	Immunopurified Flag-RPB1 or GST-CTD (Sigma) was incubated for 1 h at 30  C in kinase buffer (150 mM KCl, 50 mM Hepes pH [8.0], 10 mM MgCl 2 , 6 mM EDTA, 1 mM DTT, 50 M ATP, 5 Ci  [ 32 P]-ATP) with bead-bound HA-CDK9.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:15080..15265:sentences:953fbd5861dcc5a6d19aff734342c43e	SIRT7|NCL|NPM1|MYBBP1A|DHX9|DDX21	SIRT7|nucleolin|nucleophosmin|MYBBP1A|DHX9|DDX21	Consistent with previous studies (14) (15) (16) , the SIRT7 interactome was enriched in nucleolar proteins, such as nucleolin, nucleophosmin, MYBBP1A, DHX9, DDX21 and ribosomal proteins.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:15932..16249:sentences:b545f7a83f0f4c2e3134bf0feffbad9e	POLR2B|CDK9|CDK9|SIRT7|SIRT7	RPB2|cyclin-dependent kinase 9|CDK9|SIRT7|SIRT7	Proteins with functions in Pol II transcription, such as RPB2 and cyclin-dependent kinase 9 (CDK9) and mRNA processing factors were also identified, suggesting that SIRT7 is involved in both transcriptional and post-transcriptional processes (Supplementary  Table S3 ).. RNA-dependent changes of the SIRT7 interactome.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:16251..16561:sentences:9c3e82cdfb5db73d54caeb8e5628477e	SIRT7|POLR1E|SIRT7|SIRT7|RNASE1	SIRT7|PAF53|SIRT7|SIRT7|RNase A	Previous studies have revealed that the interaction of SIRT7 with PAF53 and U3-55k depends on RNA (12, 13) . To examine whether RNA is also involved in other SIRT7protein interactions, we compared SIRT7-associated proteins isolated from untreated and RNase A-treated samples (Supplementary Figures S1A and S1C).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:16563..16801:sentences:18472deb6e890a915fe5ef818778ebde	RNASE1|SIRT7|SIRT7	RNase A|SIRT7|SIRT7	After RNase A treatment 29% of SIRT7-associated proteins were completely or partially lost, indicating that RNA mediates or stabilizes the association of SIRT7 with a subset of proteins ( Figure 1B, Supplementary Figure S1D and Table S2 ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:17652..17861:sentences:731611f4ad48bfcb8fb4d4a217978e85	RNASE1|SIRT7	RNase A|SIRT7	While 29% of the interactions were sensitive to RNase A treatment, transcription inhibition by AMD resulted in loss or reduction of 78% of SIRT7-associated proteins ( Figure 1C , D and Supplementary Table S2 ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:18178..18304:sentences:bec911b48f922728e59fa7f2560870a5	RNASE1|SIRT7	RNase A|SIRT7	Similar to RNase A treatment, binding of SIRT7 to proteins comprising RNA recognition motifs was impaired in AMD-treated cells.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:18306..18462:sentences:1982d605b5940630e71d06490616bc2c	UBTF|TP53|SIRT7	UBF|p53|SIRT7	Validation of AMD-sensitive and -insensitive interactions by coimmunoprecipitation confirmed that some proteins, such as UBF or p53, remained bound to SIRT7.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:18464..18793:sentences:e6a1e36fdf84dddc7c9f284ddf8d8299	NCL|HNRNPK|SIRT7|SIRT7	nucleolin|hnRNPK|SIRT7|SIRT7	However, binding of a substantial fraction of SIRT7-associated proteins, including Pol I, nucleolin and hnRNPK, was markedly decreased after AMD treatment ( Figure 1D ), indicating that the majority of the SIRT7 interactome depends on ongoing transcription.. The N-terminal region mediates RNA-dependent SIRT7protein interactions.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:20690..20955:sentences:a3117086a638eebb80ababf7e94faf49	SIRT7|RNASE1|SIRT7	SIRT7|RNase A|SIRT7	To examine whether deletion of the N-terminal part of SIRT7 would also affect the interaction with proteins whose binding was compromised after AMD or RNase A treatment, we compared the association of selected proteins with wildtype and N-terminally truncated SIRT7.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:21007..21100:sentences:6fc4a8657bee73e75512398d524df63d	NCL|NPM1|SIRT7|POLI	nucleolin|nucleophosmin|SIRT7|Pol I	nucleolin, hn-RNPs, Pol I and nucleophosmin, was abolished in mutant SIRT7/ N78 ( Figure 2E ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:21102..21457:sentences:114ae27edddf7148fdf80e4c8a69051b	TP53|SIRT7|SIRT7|SIRT7|SIRT7|CDK9|UBTF	p53|SIRT7|SIRT7|SIRT7|SIRT7|CDK9|UBF	UBF or p53, however, which bind to SIRT7 in an RNA-independent manner, interacted with both wildtype and mutant SIRT7, indicating that the N-terminal part mediates RNA-dependent protein interactions, whereas the central and C-terminal part of SIRT7 mediate RNA-independent interactions.. SIRT7 releases P-TEFb from the 7SK snRNP complex and activates CDK9.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:21648..22451:sentences:35ab4a128cd89216e57fbffd24c7234c	JAG2||POLR2A|SIRT7|SIRT7|CCNT1|CDK9|HEXIM1||JAG2|SIRT7|CDK9|CCNT1|RNASE1|SIRT7|CDK9	Ser2|CTD|RPB1|SIRT7|SIRT7|cyclin T1|CDK9|HEXIM1|CTD|Ser2|SIRT7|CDK9|cyclin T1|RNase A|SIRT7|CDK9	Both unphosphorylated Pol II and Pol II phosphorylated at Ser2 and Ser5 within the C-terminal domain (CTD) of the large subunit RPB1 was present in SIRT7 immunoprecipitates, demonstrating that SIRT7 interacts with transcribing Pol II ( Figure 3A and Supplementary Figures  S3A and S3B) . We also identified cyclin T1 and CDK9, constituting the positive transcription elongation factor b (P-TEFb), and HEXIM1, an inhibitor of P-TEFb activity ( Figure 3A , B and Supplementary Figure S3A) . The canonical function of P-TEFb is to phosphorylate the CTD at Ser2, which marks the elongation complex (29, 30) . The association of SIRT7 with CDK9 and cyclin T1 was sensitive to RNase A treatment, indicating that binding of Figure 3A and B).. SIRT7 releases P-TEFb from the 7SK snRNP complex and activates CDK9.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:22606..23061:sentences:541319c28370afbe3f569c9e8cfdd913	HEXIM1|CCNT1|CDK9|HEXIM1|SIRT7|SIRT7|SIRT7|CDK9	HEXIM1|cyclin T1|CDK9|HEXIM1|SIRT7|SIRT7|SIRT7|CDK9	Binding of the 7SK snRNA/HEXIM1 complex to cyclin T1/CDK9 is known to sequester P-TEFb in a large inactive ribonucleoprotein complex which is released after dissociation of 7SK snRNA/HEXIM1 (29, 30) . The finding that SIRT7 is associated with components of the inactive P-TEFb complex as well as with elongating Pol II prompted us to investigate whether SIRT7 regulates P-TEFb activity.. SIRT7 releases P-TEFb from the 7SK snRNP complex and activates CDK9.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:23063..23314:sentences:42ad95592623b4989439ffc21498600c	CDK9|KAT2A|SIRT7|CDK9	CDK9|GCN5|SIRT7|CDK9	Previous studies have shown that CDK9 activity is inhibited by GCN5-mediated acetylation (31) (32) (33) . This observation sugested that deacetylation by SIRT7 activates CDK9, thereby promoting the transition into the elongation phase of transcription.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:23444..23584:sentences:b72649d968e1f938d221725b4713649d	CDK9|KAT2A	CDK9|GCN5	While CDK9 acetylation was hardly detectable in untransfected cells, a strong signal was observed after overexpression of GCN5 ( Figure 3C ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:23586..23886:sentences:6a6c04ee5617d50320f03351c0520073	KAT2A|STAC3|KAT2A|SIRT7|CDK9	GCN5|NAM|GCN5|SIRT7|CDK9	GCN5-mediated acetylation was further enhanced if cells were treated with nicotinamide (NAM), a competitive inhibitor of NAD + -dependent deacetylases, indicating that a member of the sirtuin family counteracts acetylation by GCN5.. SIRT7 releases P-TEFb from the 7SK snRNP complex and activates CDK9.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:23888..23977:sentences:5ef1e3e1335027a287ce4f9f1247cb91	CDK9|SIRT7|CDK9|SIRT7	CDK9|SIRT7|CDK9|SIRT7	If CDK9 is deacetylated by SIRT7, CDK9 should be hyperacetylated after knockdown of SIRT7.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:23979..24076:sentences:4ed153270fe30e3736d43861f11d809c	CDK9|SIRT7	CDK9|SIRT7	Indeed, a marked increase in CDK9 acetylation was observed after depletion of SIRT7 ( Figure 3D ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:24078..24232:sentences:93b45672eb022ed51a468931fb66b5b3	CDK9|KAT2A|SIRT7	CDK9|GCN5|SIRT7	To monitor deacetylation in vitro, HA-CDK9 was co-expressed with Flag-GCN5, incubated with recombinant SIRT7, and acetylation was monitored on immunoblots.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:24234..24478:sentences:1071f7141c17b1763cb15ea11cf70d15	SIRT7|SIRT7|CDK9|SIRT7	SIRT7|SIRT7|CDK9|SIRT7	Acetylation was significantly reduced upon incubation with wildtype SIRT7 in the presence of NAD + , confirming that SIRT7 is the enzyme that deacetylates CDK9 ( Figure 3E showing that the N-terminal region of SIRT7 mediates RNA binding in vivo.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:25265..25496:sentences:8b27fe27f162f1ea5d037041765ce083	SIRT7|CDK9|SIRT7|SIRT7|CDK9	SIRT7|CDK9|SIRT7|SIRT7|CDK9	not interact with SIRT7, did not deacetylate CDK9 in vitro, underscoring the importance of the N-terminus for SIRT7 function (Supplementary Figures S3C and S3D) .. SIRT7 releases P-TEFb from the 7SK snRNP complex and activates CDK9.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:25498..25793:sentences:bc8196bcc36f8bb0daa819837598441f	CDK9|SIRT7|KAT2A|CDK9|SIRT7|CDK9|	CDK9|SIRT7|GCN5|CDK9|SIRT7|CDK9|CTD	CDK9-dependent phosphorylation of the Pol II CTD is required for efficient promoter clearance and transcriptional processivity (34, 35) . Given that SIRT7 counteracts GCN5-directed acetylation of CDK9, we reasoned that deacetylation by SIRT7 should activate CDK9 and increase CTD phosphorylation.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:25795..26030:sentences:a87d7bf045431801ce0c9de3bdcee2e5	CDK9|POLR2A||CDK9	CDK9|RPB1|CTD|CDK9	To test this, we performed in vitro assays monitoring CDK9-dependent phosphorylation of RPB1, the large subunit of Pol II. Consistent with previous studies (32, 33) , CTD phosphorylation was compromised if CDK9 was hyperacetylated, i.e.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:26032..26316:sentences:addf25a3f40f31727d8ac3ccfab4b080	CDK9|KAT2A|STAC3|CDK9|SIRT7|CDK9	CDK9|GCN5|NAM|CDK9|SIRT7|CDK9	if CDK9 was isolated from cells co-expressing GCN5 and treated with the sirtuin inhibitor NAM ( Figure 3F and Supplementary Figures S3E  and S3F ), underscoring that acetylation inhibits the kinase activity of CDK9.. SIRT7 releases P-TEFb from the 7SK snRNP complex and activates CDK9.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:26633..26908:sentences:a05eb5c742360b472623b9a5a6696b66	CDK9|POLR2A|CDK9|CDK9|CDK9	CDK9|RPB1|CDK9|CDK9|CDK9	In accord with K48 acetylation regulating CDK9 activity, phosphorylation of RPB1 by the acetylation-defective mutant CDK9/K48R was higher than wildtype CDK9, while the acetylationmimicking mutant CDK9/K48Q was enzymatically inactive ( Figure 3G and Supplementary Figure S3G ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:26910..27122:sentences:766c4a06e79d0d6fd9e04ca557e84aac	POLR2A|CDK9|CDK9|SIRT7	RPB1|CDK9|CDK9|SIRT7	Furthermore, phosphorylation of RPB1 was markedly impaired if CDK9 was purified from SIRT7-depleted cells, supporting that hypoacetylation is required for CDK9 activity ( Figure  3H and Supplementary Figure S3H ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:27124..27349:sentences:6bc60ac2efd2482ada24499bb7f7330b	CDK9|SIRT7|SIRT7|CDK9|	CDK9|SIRT7|SIRT7|CDK9|CTD	The inverse correlation of acetylation and kinase activity of CDK9 reinforces the relevance of SIRT7-dependent deacetylation of K48 for CTD phosphorylation.. SIRT7 releases P-TEFb from the 7SK snRNP complex and activates CDK9.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:27351..27619:sentences:4b599b59637b93a32865d3775cf249ba	SIRT7|CDK9|CCNT1|SIRT7|HEXIM1	SIRT7|CDK9|cyclin T1|SIRT7|HEXIM1	To examine whether SIRT7 also activates P-TEFb by facilitating the release of CDK9/cyclin T1 from the inhibitory HEXIM1/7SK ribonucleoprotein complex, we incubated bead-bound P-TEFb/7SK snRNP complexes with Flag-SIRT7 and monitored the release of P-TEFb on immunoblots.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:27828..28061:sentences:68fd00d0a5c3f395046807b778df1f2b	SIRT7||JAG2|CDK9|SIRT7	SIRT7|CTD|Ser2|CDK9|SIRT7	Together these results indicate that SIRT7 mediates CTD-Ser2 phosphorylation and transcription elongation both by activation of CDK9 and releasing P-TEFb from the 7SK snRNP complex.. SIRT7 activates transcription of snoRNAs and mRNAs.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:28063..28249:sentences:271daab997fdbb58ed80ce6b9cddef5c	SIRT7|CDK9|SIRT7	SIRT7|CDK9|SIRT7	The finding that SIRT7 activates the kinase activity of CDK9 suggested that SIRT7 function is not restricted to the nucleolus but may also serve a regulatory role in Pol II transcription.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:28660..28939:sentences:911ff191323112627888830ebfcefe89	SIRT7|SNORD15A|SIRT7|SIRT7	SIRT7|snoRNA|SIRT7|SIRT7	Overexpression of the catalytically inactive mutant SIRT7/H187Y did not affect snoRNA levels, underscoring that the catalytic activity of SIRT7 is required for upregulation of snoRNAs ( Figure 4A and Supplementary Figure S4B) .. SIRT7 activates transcription of snoRNAs and mRNAs.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:29157..29542:sentences:b8ea8f45450598d32697774bab8ef9e4	SIRT7|BRF2|PEX12|JMJD4|PSMC4|SIRT7|RNU1-1|SIRT7	SIRT7|Brf2|Pex12|JMJD4|PSMC4|SIRT7|U1 snRNA|SIRT7	For this, genes were chosen that have been shown to be occupied by SIRT7 in the promoter-proximal region (11) . We found that numerous pre-mRNAs, including Brf2, Pex12, JMJD4 or PSMC4, are upregulated in cells overexpressing wildtype but not mutant SIRT7 ( Figure 4A and Supplementary Figures S4B and S4E) . Interestingly, the level of U1 snRNA was not affected by SIRT7 overexpression.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:29544..29809:sentences:adab31c33c09de9f96649382fcfaedf4	SIRT7|SNORD15A|SIRT7|SIRT7	SIRT7|snoRNA|SIRT7|SIRT7	This result is consistent with previous studies showing that SIRT7 occupies genes that encode snoRNA but not snRNA (13) , emphasizing that SIRT7 stimulates transcription of a subset of genes transcribed by Pol II.. SIRT7 activates transcription of snoRNAs and mRNAs.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:29811..30451:sentences:217bddfe54fb8042a9284d6a136db9c9	SIRT7|SIRT7|SIRT7|SIRT7|SIRT7|SIRT7|SIRT7|SIRT7|SNORD15A	SIRT7|SIRT7|SIRT7|SIRT7|SIRT7|SIRT7|SIRT7|SIRT7|snoRNA	This conclusion is further supported by loss-of-function experiments demonstrating that the level of snoRNAs and selected pre-mRNAs, but not U1 RNA, was decreased in SIRT7-depleted cells ( Figure 4B and Supplementary Figure S4B, right) . Significantly, decreased transcription of U3 and U13 snoRNA in SIRT7-knockout cells (SIRT7 / ) was rescued by overexpression of Flag-SIRT7, but not by Flag-SIRT7/H187Y or SIRT7/ N78, demonstrating that both the catalytic activity and RNA binding of SIRT7 are required for activation of Pol II transcription ( Figure 4C and Supplementary Figure S4C ).. SIRT7 activates transcription of snoRNAs and mRNAs.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:30453..30701:sentences:66fde52b81e60b2ce4af2f78c14a310e	SIRT7|SIRT7|SIRT7|POLI	SIRT7|SIRT7|SIRT7|Pol I	Previous results have established that SIRT7 activates transcription of rRNA genes by enhancing Pol I occupancy at rDNA (1, 12) . We therefore reasoned that overexpression of SIRT7 may increase binding of Pol II to genes that are regulated by SIRT7.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:30857..31141:sentences:24ed006a1b58fc30d280f8b39ca8d0c5	SIRT7|SIRT7|ACTB|SIRT7|POLI|RNU1-1	SIRT7|SIRT7|actin|SIRT7|Pol I|U1 snRNA	Conversely, knockdown of SIRT7 decreased Pol II occupancy at SIRT7-responsive genes to a similar level as Pol I at the rDNA locus, while binding of Pol II to actin and U1 snRNA genes, which are not occupied by SIRT7, was not altered ( Figure 4E and Supplementary Figures S4A and S4D ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:31143..31456:sentences:513fa86fb95c6393fa796ca17e3f2213	SIRT7|CDK9||SEMA4F	SIRT7|CDK9|CTD|S4F	ChIP assays with antibodies against Pol II-pSer5 and Pol II-pSer2 revealed that knockdown of SIRT7 affected the occupancy of both initiating and elongating Pol II, supporting that hyperacetylation of CDK9 prevents CTD phosphorylation and impairs transcription elongation ( Figure 4H and Supplementary Figure S4F ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:31458..31833:sentences:4d71a88c22bef2093ece89ed9ba0e4b3	SIRT7|CDK9|CDK9|SIRT7|SIRT7|CDK9|SEMA4F	SIRT7|CDK9|CDK9|SIRT7|SIRT7|CDK9|S4F	This view is substantiated by ChIP assays showing increased occupancy of both SIRT7 and CDK9 at the promoterproximal region of target genes ( Figure 4F) . Significantly, the association of CDK9 with these genes was abolished upon knockdown of SIRT7, confirming that downregulation of SIRT7 correlates with abrogation of CDK9 binding ( Figure 4G and Supplementary Figure S4F ).
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:31835..32020:sentences:8c2c64871a5c3b02b41798418b589f54	SIRT7|CDK9|SIRT7|CDK9|CDK9	SIRT7|CDK9|SIRT7|CDK9|CDK9	To further strengthen the functional link between SIRT7 and CDK9 activity, we determined Pol II occupancy at target genes in SIRT7-depleted cells that overexpress CDK9/K48R or CDK9/K48Q.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:32155..32466:sentences:b22535cfbe45145614865655a1fc4d14	SIRT7|SIRT7|CDK9|	SIRT7|SIRT7|CDK9|CTD	45, No. 5 2683 Figure S4G) . Taken together, these results uncover the mechanism underlying SIRT7-dependent activation of Pol II, demonstrating that SIRT7 enhances transcription elongation by deacetylation of lysine 48 of CDK9, which is required for CTD phosphorylation and transcription activation.. DISCUSSION.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:32788..33385:sentences:3d4586dd038a5d16cf317e0342aad9f6	SIRT7|SIRT7|POLR1E|SIRT7|SIRT7	SIRT7|SIRT7|PAF53|SIRT7|SIRT7	Global proteomic studies have identified numerous SIRT7-associated proteins, most of them serving functions in transcription, ribosome biogenesis and translation (14) (15) (16) . We have previously shown that SIRT7 is released from nucleoli in response to transcriptional, metabolic or osmotic stress, leading to hyperacetylation of PAF53 and the U3-55k protein, hyperacetylation compromising rDNA transcription and pre-rRNA processing (12, 13) . Given the vital role of SIRT7 in cellular homeostasis, it is not surprising that SIRT7 function is not restricted to pre-rRNA synthesis and processing.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:33645..34314:sentences:b209fd562b514f4d55c0d4b3e73aab58	SIRT7|SIRT7|SIRT7|GTF3C1|SIRT7|SIRT7|POLI	SIRT7|SIRT7|SIRT7|TFIIIC|SIRT7|SIRT7|Pol I	Previous studies have shown that SIRT7 deacetylates H3K18 in a gene-specific context, and selective hypoacetylation of H3K18Ac is necessary for essential features of cancer cells, including anchorage-independent growth and escape from contact inhibition (11) . SIRT7 was also found to interact with proteins that are associated with the Pol II and the Pol III transcription machinery (14, 16) . Consistent with SIRT7 interacting with TFIIIC, knockdown of SIRT7 led to decreased levels of tRNAs, indicating that the regulatory impact of SIRT7 is not restricted to Pol I transcription but affects transcription by all three classes of nuclear RNA polymerases.. DISCUSSION.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:34529..34663:sentences:055665d1bbf1493c0bff54c7a163eeac	UBTF|TP53|SIRT7	UBF|p53|SIRT7	Other proteins, however, such as UBF and p53, associate with SIRT7 in an RNA-independent fashion, presumably via the C-terminal domain.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:34665..34935:sentences:dcecf4a5756b325086f5a0083c39fa97	SIRT7|SIRT7|MYBBP1A|SIRT7	SIRT7|SIRT7|Mybbp1a|SIRT7	These results are supported by previous studies showing that N-and C-terminal regions flanking the catalytic domain enhance the activity of SIRT7 (36) and mediate interactions of SIRT7 with Mybbp1a, which inhibits the deacetylase activity of SIRT7 (37, 38) .. DISCUSSION.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:34937..35445:sentences:01e73747a2c5bc44fd9d14c909a6b7b7	SIRT7|POLR2B|SIRT7|POLR2A|SIRT7|CDK9|CCNT1|	SIRT7|RPB2|SIRT7|RPB1|SIRT7|CDK9|cyclin T1|CTD	Among the proteins detected in the SIRT7 proteome was RPB2, suggesting that SIRT7 interacts with Pol II. The C-terminal domain (CTD) of RPB1 is modified by reversible phosphorylation, acetylation and methylation, all of which are implicated in Pol II recruitment and transcription (30, 39, 40) . Notably, both the proteomic data and the results of co-immunoprecipitation experiments revealed that SIRT7 is also associated with the positive transcription elongation factor P-TEFb comprising CDK9 and cyclin T1.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:35552..35819:sentences:8d871e96bcf6dc92c1b9323b849eb709	SIRT7||JAG2|SIRT7|CDK9	SIRT7|CTD|Ser2|SIRT7|CDK9	Together with the observation that SIRT7 interacts with elongating Pol II and co-localizes with Pol II phosphorylated at CTD-Ser2 at SIRT7 target genes, these results suggested that reversible acetylation may regulate CDK9 kinase activity and transcription elongation.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:35821..36019:sentences:63e0501a23ec47326102257d24658c5f	CDK9|KAT2A|CDK9	CDK9|GCN5|CDK9	CDK9 is acetylated at two lysine residues, K44 and K48 (31) (32) (33) . GCN5-mediated in vivo acetylation preferentially targets K48 which is essential for ATP binding and CDK9 activity.. DISCUSSION.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:36021..36175:sentences:43fb9bb9b4d5dd3821cc364b1e25e558	SIRT7|CDK9|	SIRT7|CDK9|CTD	Here we show that deacetylation by SIRT7 augments the kinase activity of CDK9 which is required for CTD phosphorylation and efficient Pol II transcription.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:36177..36387:sentences:5cde238844a0258995311dcc44cc2f6a	CDK9|HEXIM1|HEXIM1	CDK9|HEXIM1|HEXIM1	Acetylation of CDK9 has no effect on the interaction of P-TEFb with HEXIM1 or 7SK snRNA (31, 32) , indicating that this modification regulates P-TEFb activity independently from the inhibitor function of HEXIM1.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:36389..36634:sentences:0a82ee86cbb164e2ed6fff73f8534bf1	SIRT7|CDK9|CCNT1|SIRT7|CDK9|CCNT1	SIRT7|CDK9|cyclin T1|SIRT7|CDK9|cyclin T1	However, we found that SIRT7-mediated deacetylation also promotes dissociation of CDK9/cyclin T1 from the inactive P-TEFb/7SK snRNP complex, suggesting that SIRT7 may target another component of the complex to release CDK9/cyclin T1.. DISCUSSION.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:36834..36903:sentences:f1af45242834482b6a35d15fc1165444	SIRT7|SNORD15A	SIRT7|snoRNA	(B) snoRNA and pre-mRNA levels are decreased in SIRT7-deficient cells.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:37113..37234:sentences:af0feed2efe901e3aa5902a4786c4e2a	SIRT7|SIRT7|SNORD15A	SIRT7|SIRT7|snoRNA	See also Supplementary Figure S4B . (C) Ectopic SIRT7 rescues downregulation of U3 and U13 snoRNA in SIRT7-knockout cells.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:37236..37371:sentences:e66d105ff38396e2c3b99f261ee8ab08	SIRT7|SIRT7|SIRT7|SIRT7|SNORD15A	SIRT7|SIRT7|SIRT7|SIRT7|snoRNA	HEK293T/SIRT7 / cells were transfected with Flag-tagged SIRT7/WT, SIRT7/H187Y or SIRT7/ N78 and snoRNA levels were monitored by RT-qPCR.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:37576..37710:sentences:d45943c3be955eb7c8fa944ed3d8ad7f	SIRT7|SIRT7|POLI	SIRT7|SIRT7|Pol I	ChIP-qPCR monitoring Pol I and Pol II occupancy at selected target genes after overexpression of Flag-SIRT7 (WT) or mutant SIRT7/H187Y.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:37712..37787:sentences:dde565d2d6d820b3a4d88acb8c10699e	POLI|POLR2A	Pol I|RPB1	Antibodies against RPA116 (Pol I) and RPB1 (Pol II, N20) were used for ChIP.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:37850..38073:sentences:71efbbd22544406bf5bd7352cdd8aa9f	POLI|POLR2A|SIRT7	Pol I|RPB1|SIRT7	See also Supplementary Figure S4A . (E) ChIP-qPCR monitoring occupancy of Pol I (anti-RPA116) and Pol II (anti-RPB1, N20) at selected target genes after shRNA-(left panel) or siRNA-(right panels) mediated depletion of SIRT7.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:38251..38323:sentences:2169fd5d69ab0706ef3c03495e57e161	SIRT7|CDK9	SIRT7|CDK9	(F) SIRT7 and CDK9 occupancy is enriched at the promoter of target genes.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:38325..38493:sentences:a2c3f8db63af204d3ddd602d2b96bc86	CDK9|SIRT7|BRF2|JMJD4|CDK9	CDK9|SIRT7|Brf2|JMJD4|CDK9	ChIPs monitoring occupancy of endogenous CDK9 or stably expressed Flag-HA-SIRT7 at different regions of Brf2 and JMJD4 using antibodies against CDK9 or the Flag epitope.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:38597..38694:sentences:9a52e812810339abade5b079870344de	SIRT7|CDK9	SIRT7|CDK9	See also Supplementary Figure S4E . (G) Knockdown of SIRT7 impairs CDK9 occupancy at target genes.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:38696..38863:sentences:012cdc94001a54c1059118ac06c00634	CDK9|SIRT7	CDK9|SIRT7	ChIP-qPCR monitoring occupancy of endogenous CDK9 at target genes upon siRNA-mediated knockdown of SIRT7, cells transfected with non-targeting siRNA serving as control.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:39046..39243:sentences:cfc7caff1050f9b039b6f7feb89b7cd1	||JAG2|SIRT7|	CTD|CTD|Ser2|SIRT7|CTD	ChIPs showing occupancy of Pol II phosphorylated at CTD-Ser5 and CTD-Ser2 in cells transfected with SIRT7-specific siRNA or with non-targeting siRNA using antibodies against pSer5-CTD and pSer2-CTD.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:39305..39410:sentences:04141db56dd6575251b899aa3eaa94ee	SIRT7|SEMA4F	SIRT7|S4F	See also Supplementary Figures S4A and S4F . Model illustrating the role of SIRT7 in Pol II transcription.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:39412..39652:sentences:090cd25acfae2c2dc5899eca4fed486b	SIRT7|CDK9|CCNT1|CDK9||JAG2	SIRT7|CDK9|cyclin T1|CDK9|CTD|Ser2	SIRT7-mediated deacetylation promotes the release of CDK9/cyclin T1 from the inactive P-TEFb/7SK snRNP complex and activates P-TEFb by deacetylation of CDK9, which leads to increased CTD-Ser2 phosphorylation and transcriptional processivity.
+SARS:02eb3dc5054c0dd2ce8faa06d6942484900d76c6:fulltext:b8d8349292c0b0ea5ac303a9eeffc991:39654..39873:sentences:b0f77228ea689e90eb75bacc158b3be1	CDK9|CCNT1	CDK9|cyclin T1	tasis of cancer cells (5, 6) . Likewise, aberrant expression of CDK9 and cyclin T1/T2 has been observed in various tumors (41) , demonstrating that regulation of P-TEFb activity is crucial for controlled gene expression.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:350..687:sentences:eb4fea1b9b625e12c809735aab0f775f	TLR9|TLR9|MYD88|NFKB2	TLR9|TLR9|MyD88|NF-kB). 2	Synthetic TLR9 ligands, short oligodeoxynucleotides (ODN) with unmethylated CpG motifs, 7 activate TLR9 that recruits the adapter protein myeloid differentiation factor 88 (MyD88) and induces a cascade leading to the nuclear translocation of the transcription factor nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB).
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:689..777:sentences:c3e0f3e841b6e8925ee7a8893d74a225	NFKB2|TLR9	NF-kB). 2|TLR9	2 The immune response following TLR9 engagement is highly desirable for cancer treatment.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:3111..3203:sentences:3a790cdde0151543fe0c11f87eb94e4c	TLR9|MYD88	TLR9|MyD88	TLR9 triggering alters gene expression and activates Akata cells in a MyD88-dependent manner.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:3556..4162:sentences:2e015ab4d054f8ca02e552bd66f30d63	IL10|IL10|CXCL10|CD40|NFKB1	interleukin 10|hIL-10|CXCL10|CD40|NF-kB	Among upregulated genes, we were mainly interested in those involved in cytokine (human interleukin 10; hIL-10) and chemokine expression (CXCL10), B-cell activation (CD40), transcription (NF-kB) and apoptosis (FAS) as these genes are those that preferentially determine cell proliferation and survival (Supplementary Table 1) . Thirteen genes, including two regulating cell cycle, one transcription factor, one involved in B-cell differentiation and apoptosis, four of diverse functions and four of unknown function, showed downregulation following ODN CpG-2006 treatment (Supplementary Table 2 ).. Results.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:4164..4321:sentences:d59365cb5dbe92fa6fbcefd00823a320	TLR9|IL10|NFKB1	TLR9|hIL-10|NF-kB	We earlier confirmed that TLR9 triggering of Akata cells with ODN CpG-2006 increases hIL-10 expression and leads to the translocation of NF-kB to the nucleus.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:4506..4931:sentences:50b569a344d0fc8c38238d68c1c70928	CD40|CD40|TLR9|TLR9	CD40|CD40|TLR9|TLR9	After 48 h, CD40 expression on ODN CpG-2006-treated cells was increased 2.7-fold compared with untreated cells (Figures 1a  and b) . Surprisingly, the control ODN GpC-2006, which is similar to ODN CpG-2006 but lacks the CpG motifs, also led to a 2.4-fold increase in CD40 expression (Figures 1a and b) . This might reflect a TLR9-independent mechanism or the ability of the control ODN to stimulate TLR9 in BL cells.. Results.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:5212..5358:sentences:28b74e6a039cd408b36afed8a61f2260	CD40|STAT3	CD40|STAT3	Collectively, we validated our microarray data showing that triggering with ODN CpG-2006 activates Akata cells to induce CD40 and STAT3 expression.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:5749..5936:sentences:16677563882fcb8a2d9bef6664397aaa	|CASP3	caspase-3 and -7|caspase-3	Thus, the activity of caspase-3 and -7 in ODN-treated Akata cells was detected using a luminogenic substrate, which gives rise to a luminescent signal proportional to caspase-3/7 activity.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:7391..7567:sentences:1eb588fc88ffb743c77618f840f1d126	IL10|TLR9	hIL-10|TLR9	22, [24] [25] [26] We previously reported 16 and corroborate here, a strong hIL-10 induction in Akata cells following TLR9 triggering with ODN CpG-2006 (Supplementary Table 1 ).
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:7746..8002:sentences:cd7632487b14d016139a96fdd5e501e5	TLR9|IL10|IL10	TLR9|hIL-10|hIL-10	(Figure 6b) . Thus, TLR9 triggering of distinct BL cells resulted in a broad range of hIL-10 mRNA and hIL-10 protein expression levels, and the magnitude of the level seemed independent of EBV status.. Survival of distinct BL cells following treatment with.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:8076..8574:sentences:c40c5b2bea3c05bcb505aeb7cfaa6192	TLR9|IL10|TLR9|TLR9|IL10|TLR9	TLR9|hIL-10|TLR9|TLR9|hIL-10|TLR9	Although distinct BL cells showed up to sixfold different relative TLR9 mRNA expression levels (Figure 6c) , ODN CpG-2006 treatment-induced hIL-10 mRNA peak expression levels did not correlate with the relative TLR9 mRNA expression levels ( Figure 6d) . Collectively, TLR9 triggering in distinct BL cells resulted in distinct hIL-10 mRNA expression, not linked to presence or absence of EBV, and not correlated to TLR9 mRNA expression levels.. Survival of distinct BL cells following treatment with.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:10088..10364:sentences:b5f45d2f7b40f79c8eb785b320a7baf6	TLR9|MYD88|TLR9	TLR9|MyD88|TLR9	Cell death was (i) dependent on TLR9-MyD88 signaling, (ii) occurred concomitantly with activation and could be suppressed by pan caspase inhibitors, (iii) was not dependent on the presence or absence of EBV in the tumor cells and (iv) was associated with SNPs in the TLR9 gene.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:11197..11263:sentences:98c6bea294cb416c4ee5a59e6da2b761	TLR9|IL10	TLR9|hIL-10	TLR9-triggered BL cells consistently upregulated hIL-10 expression.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:11504..11764:sentences:7084b76e159c4ae576cef2441860a0bd	IL10|NELFCD	hIL-10|Th1	hIL-10, as an anti-inflammatory cytokine, inhibits the Th1 immune response 31 and this effect would be detrimental in cancer therapy that is based on intact or enhanced immune responses, 9 as an unintended proliferation of the malignant cells could be provoked.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:12228..12343:sentences:707a279794c344713049ce4bd8fb9ba9	TLR9|MYD88	TLR9|MyD88	32 Therefore, we examined whether downstream signaling of TLR9 via MyD88 is involved in the induction of cell death.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:12641..12808:sentences:2058420d2258bf33af82f2cf7111aba6	TLR9|LYN|HCK	TLR9|Lyn|Hck	34 Another pathway that is triggered by CpG ODNs, but is TLR9-independent, was described in monocytes and involves the activation of the Src family kinases Lyn and Hck.
+SARS:05df6a79e61e69b9113ffa6a667c3fb9b2680e70:fulltext:9f73a968952381117f6f0a155b323fd0:14108..14217:sentences:d78c0188ada4b9b77a6d55fa55e1bcff	NFKB1|TLR9	NF-kB|TLR9	36 Hence, the presence of the C allele seems to result in enhanced NF-kB activation following TLR9 triggering.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:562..1634:sentences:36a9cfd605c45c5cc23cab88f27746d0	IVNS1ABP|	NS1|NS2	One of the pathologies of the disease is an innate inflammatory response to infection in the lung, which could explain possible links between HRSV and asthma (2, 3) . The pathogenesis of HRSV is not well understood, and to date, the development of a vaccine has been unsuccessful (4) . Understanding the interaction for HRSV in particular, and for other viruses in general, with the host cell proteome, will aid in the design of effective antivirals and the development of possible vaccine strategies (5) .. . Because of their similar genome organization and gene expression strategy, the paramyxoviruses have been grouped into the Mononegavirales order that includes rabies and Ebola viruses (6) . HRSV has a cytoplasmic replication strategy, and the genome consists of a single-stranded negative sense RNA with the gene order 3 to 5: non-structural protein 1 (NS1), non-structural protein 2 (NS2), nucleo-(N) protein, phospho-(P) protein, matrix (M) protein, small hydrophobic (SH) protein, glyco-(G) protein, fusion (F) protein, M2-1 and M2-2, and the large (L) protein.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:2449..2698:sentences:eae87c9e967d1b01a53e978551155650	IVNS1ABP||IFNA1	NS1|NS2|IFN	NS1 and NS2 are accessory proteins involved in modulating the host response to infection by acting as antagonists of the / interferon (IFN)mediated antiviral state (15) (16) (17) .. . During infection, the virus has multiple effects on the host cell.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:2700..3421:sentences:db641657414a0f22babd09fea099daa3	IFNA1|TRAF3|TRAF3|STAT2|TLR2	IFN|TRAF3|TNF receptor-associated factor 3|STAT2|Toll-like receptor 2	These include (but are not limited to) cell cycle arrest through the up-regulation of transforming growth factor 1 (18) , alterations in the composition of lipid raft membranes (19) , decreases in members of the IFN pathways such as TRAF3 (TNF receptor-associated factor 3) and STAT2 (signal transducers and activators of transcription protein 2) (20) , activation of the NF-B signal transduction pathway (21, 22) , and the activation of innate immunity through Toll-like receptor 2 (23) . Many of these processes are regulated by the induction of different gene subsets (24) . The relative level of host cell proteins can have a direct effect on HRSV disease progression where secondary bacterial infections are observed.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:17618..17738:sentences:e7a6090833335dc84471fe30f91ae768	VDAC1P1|PHB|TOMM20|TOMM22	VDAC1|prohibitin|TOMM20|TOMM22	VDAC1 (20B12) (ab14734), prohibitin (II-14-10) (ab1836), TOMM20 (ab56783), and TOMM22 (ab57523) were obtained from Abcam.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:17852..17968:sentences:dc4ab23272e6aa837d95e9e796cd8fad	PML|PGM3	PML|PG-M3	Lamin B (101-B7) (NA12) was obtained from Merck, and PML (PG-M3) (sc-966) was obtained from Santa Cruz Biotechnology.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:20830..21003:sentences:60a0ed2007eb9272638e165cf1550a18	LMNB1|CDK1|NCL	lamin B1|Cdc2|nucleolin	Tubulin (YOL1/34) (ab6161), lamin B1 (119D5-F1) (ab8982), cell division control protein 2 homolog (Cdc2) (A17) (ab18), and nucleolin (4E2) (ab13541) were obtained from Abcam.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:21005..21211:sentences:11ebaa22114b0da800acaff8bcdd7ee9	CCNA2|CCNB1|CCND2	cyclin A|cyclin B1|cyclin D2	Lamin B (101B7) (NA12) was obtained from Merck, and cyclin A (H-432) (sc-751), cyclin B1 (D-11) (sc-7393), cyclin D2 (M-20) (sc-593), and cyclin E (M-20) (sc-481) were obtained from Santa Cruz Biotechnology.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:21648..21747:sentences:c5b0112c0f57d043e1b1cbc1f145cd2c	PML|PGM3	PML|PG-M3	Immobilized proteins were detected with PML (PG-M3) (sc-966) obtained from Santa Cruz Biotechnology.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:31211..31281:sentences:4302d2ce3af14d78d713a86b244a23a0	CCNA2|IFNA1	cyclin A|IFN	cyclin A) and IFN , which were not identified in the LC-MS/MS analysis.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:32195..32372:sentences:dc9ae316a463170fdd7fdfff7e85cf10	NCL|NPM1	nucleolin|nucleophosmin	Other identified cellular proteins altered in HRSV-infected cells included components of subnuclear structures such as the nucleolus (nucleolin and nucleophosmin) and ND10s (e.g.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:33974..34178:sentences:0b995ffa5f16674572961cefacdb96ae	STAT1|ISG15	STAT1|ISG15	20) . In the quantitative proteomics analysis of A549 cells infected with HRSV, STAT1 and its downstream molecule IFN-stimulated gene 15 protein (ISG15) were more abundant than in mock-infected cells (Fig.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:34180..34797:sentences:899073de2f0f10b731b2f64983dab064	STAT1|STAT1|IFNA1|IFNA1	STAT1|STAT1|IFN|IFN	5, left) . This observation reflects previous work in which human diploid fibroblast 2fTGH cells were infected with HRSV, and STAT1 protein was shown to be more abundant in HRSVinfected cells when compared with mock-infected cells (43) . The role of STAT1 in the immunobiology of HRSV has been investigated in transgenic animal models (44) . The IFN-stimulated gene 15 mRNA and protein were shown to be upregulated in a mouse lung epithelial cell line (MLE-15) infected with HRSV (45) . In the current data set, these molecules were linked to NF-B-activated transcription, transforming growth factor 1, and IFN / (Fig.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:36228..36525:sentences:51a4590bbef89391d9853779aee20909	TOMM20|TOMM22|TOMM40|TOMM70A	Tom20|Tom22|Tom40|Tom70	The abundance of the translocase of the outer mitochondrial membrane (TOM) complex subunits Tom20, Tom22, Tom40, and Tom70 were decreased 129-, 26-, 15-, and 12-fold, respectively, in the nuclear fraction enriched from HRSV-infected cells but were not detected in Table 8. the cytoplasmic fraction.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:36741..36909:sentences:1766ab4b79cc7e7a2596d776a8b1be4c	VDAC1P1|VDAC2	VDAC1|VDAC2	VDAC1 and VDAC2 were also detected in the cytoplasmic fraction with 10-and 9-fold increases, respectively, in HRSV-infected cells when compared with mock-infected cells.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:36911..37129:sentences:6eee809d9e7fba7417e55d4edfbe1497	PHB|PHB|PHB2	Prohibitin|PHB1|PHB2	Prohibitin (PHB) subunits PHB1 and PHB2, which are involved in cell proliferation and the functional integrity of mitochondria (48, 49) , were increased 3-fold in the cytoplasmic fraction from HRSV-infected cells.. FIG.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:37634..37944:sentences:0a69ff795427265378d91388d62451c7	TOMM20|TOMM22	Tom20|Tom22	7A) . The fluorescence data for the subcellular localization of rep-resentative TOM complex members (Tom20 and Tom22) indicated that the subcellular localization of these proteins also differed between HRSV-infected cells and mock-infected cells with localization observed in a distinct region of the cytoplasm.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:37946..38038:sentences:b5c562340fd0b228006b7c13d1642116	TOMM20|TOMM22	Tom20|Tom22	There also appeared to be less fluorescence from Tom20 and Tom22 in HRSV-infected cells (Fig.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:41165..41501:sentences:7e7e0bc797f3b86b3e70f1623d690ad1	NUP155|NUP107	nup155|nup107	10A . Assignment of the localization of the localization of these proteins within the nuclear pore complex was based on data from a number of different studies (50 -56) . Additionally, nup155 and nup107 identified in the study but not shown in 10A were shown to be involved in nuclear envelope and pore complex formation (57, 58) .. FIG.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:41779..41820:sentences:2da63f287cfc641df744d03a232c1cb2	NUP85|NUP160	nup85|nup160	The only exceptions were nup85 and nup160.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:42813..43095:sentences:a036a2cf086f37075e11b83b3a257856	CDK1|CDK1|CDK1|HDAC2|HDAC2|PA2G4|PA2G4|SIN3A|SIN3A	Cdc2|cyclin-dependent kinase 1|cdk1|histone deacetylase 2|HDAC2|proliferation-associated 2G4|PA2G4|SIN3|SIN3A	These included Cdc2 (also known as cyclin-dependent kinase 1 (cdk1)); histone deacetylase 2 (HDAC2); proliferation-associated 2G4, 38 kDa (PA2G4); and SIN3 homolog A transcription regulator (yeast) (SIN3A) (6-, 4-, 3-, and 3-fold less abundant, respectively, in HRSV-infected cells).
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:43202..43769:sentences:19fa580d98d931ce184b67431eab8ce6	CDK1|CDK1|	Cdc2|Cdc2|cyclins D2, A, E, and B1	Cdc2 has been shown to bind to cyclins such as A, E, and B types and can regulate cell cycle progression (59, 60) . In addition, in HRSV-infected A549 cells, cell cycle arrest has been observed; however, the abundance of cell cycle regulatory complexes was not elucidated (18) . Western blot analysis of nuclear and cytoplasmic fractions from mock-and HRSVinfected cells indicated that Cdc2 was less abundant in the nuclear fraction in HRSV-infected cells (confirming the quantitative proteomic analysis) and that cyclins D2, A, E, and B1 were also less abundant (Fig.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:44009..45121:sentences:17475d829854cb382453b5851c919b42	PML|NCL|NPM1|PML|PML|NCL|NCL|NPM1	PML|nucleolin|nucleophosmin|PML|PML|nucleolin|nucleolin|nucleophosmin	1. Quantitative proteomics using SILAC of HRSV-infected cells versus mock-infected cells.. Disruption to Subnuclear Structures, ND10s (PML Bodies), and Associated Proteins-Many subnuclear structures such as the nucleolus and ND10s (also known as PML bodies) contain proteins that are involved in the antiviral signaling response that become altered in virus-infected cells (61) (62) (63) . The nucleolus is formed from a complex of protein-protein and protein-nucleic acid interactions centered around nucleolar hub proteins such as nucleolin and nucleophosmin (64) . ND10s are formed around PML protein and are dynamic structures that are in continuous protein exchange with the nucleus, depending on the metabolic state of the cell (65) . PML is a protein with several different isoforms that can localize to ND10s and/or the nucleus or cytoplasm (66) . Several components of the subnuclear structures were altered in HRSV-infected cells, including an ablation of nucleolin (decreased 4.5-fold) and nucleophosmin (decreased 6.7-fold) (see supplemental Table 1 ; for nucleolin, shown using Western blot, see Fig.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:45135..45441:sentences:315ce45db725947c5a43614b9f053e4c	TARDBP|RAD50	TAR DNA-binding protein|DNA repair protein RAD50	1. Quantitative proteomics using SILAC of HRSV-infected cells versus mock-infected cells.. The following constituents of ND10s were altered in abundance in HRSV-infected cells: the TAR DNA-binding protein (3-fold), eukaryotic translation initiation factor 3 (9fold), and DNA repair protein RAD50 (2.6-fold).
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:46724..46921:sentences:5450e8214e6f3e5567a5551b2326cc3a	TOMM20|TOMM22	Tom20|Tom22	In the outer mitochondrial membrane, Tom20 and Tom22 interact with other Toms (some of which were identified in this analysis) to form a pore through which premitochondrial proteins are transported.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:47287..47877:sentences:2754c7c4c8021743a57201f6fae30fbe	PHB|PHB2|PML|PML	PHB1|PHB2|PML|PML	Those proteins involved in cell proliferation and integrity such as PHB subunits PHB1 and PHB2 are also found in mitochondria.. . Alterations in mitochondrial protein abundance and mitochondrial integrity in HRSV-infected cells.. ysis of the nucleus from HRSV-infected A549 cells proposing that PML protein is redistributed from the nucleus to the cytoplasm 24 h postinfection (26) . In the current study, further analysis of HRSV-infected cells at 36 h postinfection indicated that PML remained predominately in the nucleus with no change in the number of ND10s in mock-infected cells (Fig.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:53144..53277:sentences:2e961bb4fa25f7c2aee094e43fe47f67	PML|NCL	PML|nucleolin	the increased abundance of PML versus the decreased abundance of nucleolin and similar levels of marker proteins such as lamin B (e.g.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:56862..56983:sentences:31dfb7a62782144a46652716f80e21c0	STAT1|ISG15	STAT1|ISG15	STAT1 and ISG15 were identified as being more abundant in HRSV-infected cells when compared with mock-infected cells (Fig.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:56985..57175:sentences:b729b6365a57446eb3f26da875be462f	STAT1|IFNA1	STAT1|IFN	5) . Both of these observations were consistent with previous observations using HRSV-infected cells and in vivo models (20, 45, 79) . In the pathway analysis, STAT1 was linked to IFN / (Fig.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:57177..57649:sentences:09f852afffbd15c3f459a6583dd75e4b	STAT1|STAT1|STAT1|STAT1|IFNA1|IVNS1ABP||IFNA1|IFNA1	STAT1|STAT1|STAT1|STAT1|IFN|NS1|NS2|IFN|IFN	5) . STAT1 activity is also regulated by phosphorylation, and HRSV uses distinct mechanisms to either impair STAT1 phosphorylation or increase phosphorylation of STAT1 (a STAT1 variant) to repress IFN expression (80) . HRSV proteins NS1 and NS2 strongly inhibit IFN / by preventing the phosphorylation of the IFN regulatory factor-3 (15, 16) . However, the molecular pathology of HRSV infection and the mechanisms by which it circumvents IFN are still not fully understood.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:60762..61232:sentences:d2186a8177f01dab2479cb42ed592703	MAVS|IFNA1|CYCS	mitochondrial antiviral signaling protein|IFN|cytochrome c	For example, HCV is able to block the mitochondrial antiviral signaling protein (found on the outer membrane of the mitochondria) downstream signaling pathway, which leads to the expression of IFN , thereby enabling HCV to evade host immunity (85) . Furthermore, human cytomegalovirus has been shown to perturb many cellular processes that promote the release of proapoptotic molecules such as cytochrome c (86) .. Alterations in Mitochondrial Proteins and Mitochondrial.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:61234..61498:sentences:84a5b2758e6a92b8132b8544fbcf3039	DDX58|DDX58|MAVS	retinoic acid-inducible gene-1|RIG-I|mitochondrial antiviral signaling protein	In HRSV infection, activation of retinoic acid-inducible gene-1 (RIG-I) induces an antiviral response (87) that involves its association with the mitochondrial antiviral signaling protein, allowing the recruitment of signaling adapters to the mitochondrial surface.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:62545..63078:sentences:dd7ff64832a51f147000d165c0928ff5	RAN|NUP98|NUP98|NUP98|IFNA1	RAN|nup96|nup98|nup98|IFN	This could be a common feature of RNA virus infection (89) as other negative strand RNA viruses that replicate in the cytoplasm, such as vesicular stomatitis virus, have been shown to inhibit RAN-dependent trafficking (90) . Specifically, the virus-encoded matrix protein can inhibit nuclear import and export (91) . This virus has been shown to target nup96 and nup98 for degradation (92) , potentially to inhibit antiviral activity (93) . nup98 is an IFN-induced nuclear pore complex protein with a major role in the export of mRNA.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:65372..65698:sentences:4f3d4a5c92fbc2c9d90b55a7aa80f562	NCL|NPM1	nucleolin|nucleophosmin	Both RNA and DNA viruses target the nucleolus and its structure, and the proteome can change in response to viral infection (61, 106) . In this study, the quantitative proteomic analysis indicated that two of the most common and most studied nucleolar proteins, nucleolin and nucleophosmin, were ablated in HRSV-infected cells.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:65821..66138:sentences:77c2e4626c3253d4689a9b3f856ca8be	LMNB1|LMNB1|LMNB1|NPM1	lamin B1|lamin B1|lamin B1|nucleophosmin	Recently, it has been shown that lamin B1 interacts with nucleophosmin to maintain nucleolar structure for ribosome biogenesis (107) . However, the loss of lamin B1 resulted in the breakdown of the nucleolus (107) . Our analysis indicated that lamin B1 was potentially cleaved and depleted in HRSV-infected cells (Fig.
+SARS:054831a6a11886b5ad44cac71d17e367721a2b5b:fulltext:ada2cb192890c1885c7f1da1b638097d:66485..66632:sentences:c30ecc4607eaa5b87a6839b14dbf07e8	RAD50|PML	RAD50|PML	ND10 constituents TAR and RAD50 were significantly decreased in abundance, but the major constituent, the PML protein, was not detected by LC-MS/MS.
+SARS:08467794d024d78c7981f7c39743a9faaa1adecb:abstract:5499490dcf91803f2b38e7329419f094:1078..1442:sentences:d9a22f327b9dba2d13a9ce1391c1077e	IL4|SRGN|SRGN|SRGN	IL-4|pPG|pPG|pPG	Moreover, in response to restimulation with the PEDV COE antigen in vitro, a significant difference in splenocyte proliferation response and Th2-associated cytokine IL-4 level was observed in the group of mice orally immunized with pPG-COE-Col-DCpep/L393 (p < 0.05) compared to the groups of mice that received pPG-COE-Col/L393 and pPG-COE-DCpep/L393, respectively.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:557..1590:sentences:eb89150561cff1ba8bf00fbfa06cec11	IFNA1|IRF6	interferon gamma (IFN-)|LPS	Specifically, the virus infects certain subsets of differentiated macrophages in the lung, lymphoid tissues and placenta and replicates in testicular germ cells and monocytic lineage cells, particularly porcine alveolar macrophages [5, 6, 24, 30] . Thus, the lungs and lymphoid organs are obvious locations of prolonged viral replication and persistence [16] .. . Macrophages play an important role in the first line of defense against invading pathogens, where they act as immune effectors and antigen presenting cells [9] . Macrophages also play a significant functional role in osteochondral repair [1, 8, 14] . Within fractures, macrophages are recruited during the early inflammatory phase and persist throughout the repair process [1] . During this time, macrophages polarize towards distinct phenotypes in response to environmental cues to support the multiple events occurring during wound repair [21] . In vitro exposure to interferon gamma (IFN-) and lipopolysaccharide (LPS) polarizes macrophages doi: 10 .1292/jvms.17-0258
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:1592..2000:sentences:4090129264ab81b0c0d81d41c1c96558	IL6|TNF|IL4|IL10|IL13	IL-6|TNF|IL-4|IL-10|IL-13	towards a classically activated M1 phenotype marked by the release of catabolic, pro-inflammatory cytokines, such as interleukin (IL)-1, IL-6 and tumor necrosis factor- (TNF-) [18] . The M1 phenotype triggers proinflammatory responses required to kill intracellular pathogens [10] . In contrast, macrophages are polarized to an alternatively activated M2 phenotype following IL-4, IL-10, or IL-13 stimulation.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:2002..3067:sentences:544addd1880f38776cd59308ba314dae	IL1RN|IL1RN|IL10|PAM	IL-1 receptor antagonist|IL-1RA|IL-10|PAM	M2 macrophages release limited levels of pro-inflammatory factors; rather they secrete high levels of antiinflammatory molecules including IL-1 receptor antagonist (IL-1RA) and IL-10 [18] . During inflammation, M2 macrophages serve to protect against tissue damage [13] . Most monocytotropic viral infections, such as those caused by human immunodeficiency virus (HIV), respiratory syncytial virus (RSV), severe acute respiratory syndrome virus (SARS-CoV) and influenza A virus (IAV), may affect macrophage polarization and thereby potentiate immunosuppression and/or immunopathology, which are generally associated with viral persistence and co-infections by pathogens of other phyla [2, 19, 34] . The consequence of viral infection on macrophage polarization has been directly demonstrated in HIV and RSV infections, and is associated with infections caused by human herpes viruses, IAV, SARS-CoV and other viruses [27] .. . The purpose of the present study was to investigate the consequence of PRRSV replication on porcine alveolar macrophage (PAM) polarization.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:3069..3227:sentences:11c70fffe78bc5b594a33ac0b779fb89	IFNA1|IL4|IRF6	IFN-|IL-4|LPS	For this, we established a macrophage polarization model using primary PAMs stimulated with LPS and IFN- or IL-4 to induce M1 or M2 polarization, respectively.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:3229..3425:sentences:78b1c10c9080ac4613c2ba2be549ef5d	IL6|TNF|IL10	IL-6|TNF|IL-10	M1 polarization was identified by the expression of IL-6, IL-12, TNF- and other pro-inflammatory cytokines, whereas M2 polarization was characterized by IL-10 and other anti-inflammatory molecules.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:5808..6073:sentences:5e58b864114969150b6c5de7ea6f4691	IRF6|IFNA1	LPS|IFN-	To generate M1 PAMs, cells were treated with LPS (R&D Systems, Minneapolis, MN, U.S.A.) and IFN- (R&D Systems) at various concentration combinations (10 ng/ml + 10 ng/ml, 100 ng/ml + 50 ng/ml or 1,000 ng/ml + 100 ng/ml, respectively) for 6, 12, 24, 30, 36 and 48 hr.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:11073..11211:sentences:4571dc4a1aeb89d1012af04738a97e9e	IL4|IRF6|IFNA1	IL-4|LPS|IFN-	Scanning electron microscopy was used for high-magnification confirmation of macrophage morphology after stimulation with IFN-/LPS or IL-4.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:11939..12106:sentences:84f14ab9008f14d8159cd22352d87a53	SP5|PAM	SP5|PAM	PAM nuclei were stained with 4,6-diamidino-2phenylindole (DAPI) (Sigma) prior to imaging with a Leica TCS SP5 confocal scanning-laser microscope.. Statistical analysis.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:12375..12626:sentences:5f455f9cd68ac46d4da3693673148e3c	PAM|S100A9|CD68	PAM|MAC387|CD68	Before investigating the effect of PAM polarization on PRRSV replication, the purity of our macrophage cultures was assessed by indirect immunofluorescence assay (IFA) and flow cytometry with anti-MAC387 antibody and anti-CD68 antibodies, respectively.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:13072..13212:sentences:5e434bfb1eecd2d0f3933ca4dcdcc2cc	IFNA1|IRF6	IFN|LPS	Interestingly, IFN-/LPS-treated M1 PAMs exhibited an elongated shape with a smaller nucleus in comparison to control and M2 macrophages (Fig.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:13214..13347:sentences:96763f812d707862c1937430ff17a333	IRF6|IFNA1|IL4	LPS|IFN-|IL-4	1A) . Scanning electron microscopy showed IFN-/LPS-and IL-4-treated PAMs displayed numerous filopodia in comparison with M0 PAMs (Fig.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:13411..13715:sentences:23a506e1662e786a0bdee5c21b4068b7	IFNA1|IFNA1|IRF6|IRF6	IFN|IFN|LPS|LPS	To determine the optimal concentration and incubation time for LPS and IFN- co-treatment to induce M1 polarization, we used three combinations of LPS/IFN- at various concentrations (10 + 10, 100 + 50 and 1,000 + 100 ng/ml) and analyzed M1 marker expression at 6, 12, 24, 30, 36 and 48 hr post-stimulation.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:13717..13917:sentences:0483ccd3098958e29de6f3e199c1ab7d	IL1B|IL1B|IL6|IL6|IL12B|TNF|TNF	IL-1|Il1b|IL-6|Il6|Il12b|Tnf|TNF	This experiment revealed that the mRNA expression of prototypical M1 markers including TNF- (Tnf), IL-1 (Il1b), IL-6 (Il6) and IL-12 (Il12b) started to increase significantly at 6 hr after stimulation.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:13919..14151:sentences:752d4cacd47030318509ca92d4369cec	TNF|IL1B|IL6	TNF|IL-1|IL-6	Individually, the TNF- level peaked at 6 hr followed by a rapid decline, whereas IL-1 and IL-6 peaked at 24 hr and then gradually decreased, and IL-12 peaked at 12 hr and remained upregulated throughout the analyzed time period (Fig.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:14194..14321:sentences:3ac93eff5018e39ab10d4f40024b5975	IFNA1|IRF6	IFN|LPS	2A , we decided to use a co-treatment consisting of 100 ng/ml LPS and 50 ng/ml IFN- for 24 hr to induce M1 polarization in PAMs.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:14843..15040:sentences:79a42bce1699eb991c94b359b9a9f174	IL1B|IL6|IL23A|CCL2|CXCL10|IL4|IRF6|TNF	IL-1|IL-6|IL-23|CCL2|CXCL10|IL4|LPS|TNF	Notably, we observed that IL-1, TNF-, IL-6, IL-12, IL-23, CCL2 and CXCL10 expression was significantly higher in LPS/IFN--treated M1 macrophages than in control and IL4-stimulated counterparts (Fig.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:15042..15159:sentences:bfbe5a1c9faa7425428cbdee4ba1f7b7	ARG1|IL10|PPARA|STAT6|IL4	Arg-1|IL-10|PPAR-|STAT6|IL-4	3A) , whereas Arg-1, TGF-, IL-10, Ym-1, PPAR- and STAT6 expression was markedly higher in IL-4-simulated M2 PAMs (Fig.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:16079..16218:sentences:9afe5a8f8729f68d115fdc4b565914eb	IL10|ARG1	IL-10|Arg-1	Furthermore, we found a significant increase in the M2 genes IL-10 and Arg-1 in M2-polarized macrophages as compared to M0 and M1 PAMs (Fig.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:16220..16377:sentences:d05246b2047292c8a83921ef9c894557	PAM|IRF6|IFNA1|IL4	PAM|LPS|IFN-|IL-4	3D) . Additionally, expression of M1 TLR4 and M2 Arg-1 was notably higher LPS/IFN--and IL-4-stimulated PAM, respectively, when compared to control cells (Fig.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:16379..16567:sentences:b2cbeef095a1649ac92ab5873bc5cfbe	IFNA1|IL4	IFN-|IL-4	3E) . Collectively, these results indicate that treatment with LPS/IFN- or IL-4 potently induces M1 or M2 polarization in PAMs, respectively.. M1 polarization inhibits HP-PRRSV replication.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:16569..16908:sentences:7b866777c6d6dead33c9a89a3178200a	PAM|IFNA1|IL4|PAM	PAM|IFN-|IL-4|PAM	To investigate the effects of PAM polarization on HP-PRRSV replication, PAM cultures were treated with LPS/IFN- or IL-4 for 24 hr to induce macrophage polarization prior to infection with the HuN4-F5 strain of HP-PRRSV, which was derived from the wild, highly virulent strain HuN4 by 5 passages in MAC145 cells or left untreated (controls).
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:19194..19327:sentences:a731fa6433f27393498eb890f8304994	IFNA1|IRF6	IFN|LPS	In summary, M1 polarization with LPS/IFN- also inhibits the replication of other PRRSV strains, such as the HuN4-F2 and CH-1a strains.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:19787..19960:sentences:db2156ebf4e6ee9fd861c8d3891fa9c3	IFNA1|IL4|PAM	IFN-|IL-4|PAM	Our data show the PAM activation (LPS/IFN- or IL-4 stimulation) elicits a changed phenotype, altered expression pattern of certain markers and different antiviral regulation.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:20250..20409:sentences:615f08fd9ea70c2208dc95b67c28e009	IFNA1|IL4|IRF6	IFN-|IL-4|LPS	Here, PAMs showed an elongated shape with a smaller nucleus after activation with LPS/IFN-, whereas activation by IL-4 appeared to result in more circular PAMs.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:20411..20925:sentences:08540711c067dabf522f2af481e89aaa	|IRF6|IFNA1	LPS/IFN|LPS|IFN	This is in line with reports showing that the morphology of human macrophages changes with different maturation and activation methods in vitro [31] . A previous study showed that LPS/IFN- stimulation causes macrophages to stretch through cytoskeletal arrangements and modulates macrophage elasticity, which is a major determinant of innate macrophage functions such as phagocytosis [25] . These results suggest that LPS/IFN- increase phagocytosis through effects on macrophage elasticity (morphology).. DISCUSSION.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:20927..21069:sentences:6bc70b85cc0f516b0ee2ec458ed0e8d1	IL1B|IL6|IL23A|CCL2|CXCL10|IRF6|TNF	IL-1|IL-6|IL-23|CCL2|CXCL10|LPS/IFN- stimulation|TNF	Our results showed significantly higher IL-1, TNF-, IL-6, IL-12, IL-23, CCL2 and CXCL10 production by PAMs activated with LPS/IFN- stimulation.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:21071..21201:sentences:2b7c93d729bd31b805a409b8b03bd04c	ARG1|IL10|PPARA|STAT6	Arg-1|IL-10|PPAR-|STAT6	In contrast to M1-type macrophages, M2-type PAMs were characterized by the production of Arg-1, TGF-, IL-10, Ym-1, PPAR- and STAT6.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:21492..21751:sentences:e2e960fa273dc55088e77cebea5c9ebb	RETNLB|IFNA1|IL4	Fizz1|IFN-|IL-4	However, differences between species should be considered, e.g., there are no homologs of Ym1 and Fizz1 in humans [26] . A transcriptional analysis of PAMs polarized using LPS/IFN- or IL-4 stimulation needs to be performed to answer this question.. DISCUSSION.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:21856..22409:sentences:443b268d4a537be19b483ea725bbcbc7	CD4|CCR5|CCL3|CCL4|CCL5|SIGLEC1|CD163|PAM	CD4|CCR5|CCL3|CCL4|CCL5|sialoadhesin|CD163|PAM	Several studies have confirmed that human immunodeficiency virus (HIV)-1 infection is restricted through down-regulation of CD4 at the cell surface and up-regulation of the secretion of CCR5-binding chemokines (CCL3, CCL4 and CCL5) in M1-type macrophage [3] . PAMs are the primary cellular target for receptor-mediated PRRSV infection via sialoadhesin (SN), heparan sulfate (HS) and CD163 [7] . Thus, we theorized that the observed effect on PRRSV replication in M1 macrophages results from the decreased expression of viral receptors on the PAM surface.
+SARS:08079db5747d09016612f319e154ff81c4d9aef5:fulltext:41fc52decb598ff983a5af4392b092ce:22994..23051:sentences:4456cdcef55b850fdf7a5ac80512c470	APOBEC3G|SAMHD1	APOBEC-3G|SAMHD)-1	APOBEC-3G and sterile alpha motif and HD domain (SAMHD)-1.
+SARS:08741b63c08d63c1a86dd3ef3ce3d1bfd39e560b:title:a14c9b4a6c3e1a48cde14df3cf99c3bd:0..141:sentences:84fd1cff3815c3cc19c0c7f23fe8bcd8	|AKT1	ERK1/2|Akt	Dissection and integration of the autophagy signaling network initiated by bluetongue virus infection: crucial candidates ERK1/2, Akt and AMPK
+SARS:088207699688d96fe973df88c1add87ac8339645:abstract:5c6bad50423cec4b7242e1cd499f6a59:870..1206:sentences:d3d10d19c4b740a37f4a98e7856de9d5	TLR2|NELFCD	TLR2|Th1	Higher expression of TLR2 and of HLA-DR molecules, induction of dendritic cell maturation and release of pro-inflammatory molecules, stimulation of T lymphocyte proliferation and differentiation toward a Th1 phenotype, as well as an increase of the phagocytosis have been demonstrated to be associated with Pidotimod in in vitro studies.
+SARS:0887d72928848c7c8dfea2b737af6ad098fd5bbb:abstract:54fe509d3a9bfa610f10e1458878f5b0:222..442:sentences:579b4de53ed1acc5aff51a2e2911662b	TLR4|MYD88|S100A9|S100A9	TLR4|MyD88|S100A9|S100A9	The S100A9 is a member of the DAMPs protein family and, is released by activated phagocytic cells such as neutrophils, monocytes, macrophages or endothelial cells, and S100A9 induces its effect through TLR4/MyD88 pathway.
+SARS:0889153e8bd8e83afad8e49fe4ba3ceb62c7eba5:abstract:2fea1f3e4fa0395b358560bb5930935d:894..1060:sentences:0edabbc27d7d3aba472d422033455f5f	DDX58|IFIH1	RIG-I|MDA5	This challenging task is taken on by the homologous cytosolic DExD/H-box family helicases RIG-I and MDA5, which control the innate immune response to most RNA viruses.
+SARS:089729d867c630e0e90958e3225cfae36486f021:abstract:7684d56d8161ec6421e12d36c4c81c79:601..853:sentences:19c2e402c8867e87a1f58d16ad997ccd	ABCC3|ABCC1|ABCC1	multidrug resistance-associated protein|MRP|MRP	BSO and MK-571, which inhibit the efflux of drugs mediated by multidrug resistance-associated protein (MRP), increased the action of both inhibitors, indicating that the latter enter the cells and that their export is mediated by MRP in both cell lines.
+SARS:08f62fb3d767dc6d27afcc1ae6054e05ec27b329:abstract:77ba93b2355ff236391e659eca66dadc:0..369:sentences:32fbfeec6838132d4bca202c7aa77e2e	ADK|HFM1|HFM1	ADK|helicase|helicase	Abstract As anti-HCV aryl diketoacids (ADK) are good metal chelators, we anticipated that ADKs might serve as potential inhibitors of SARS CoV (SCV) NTPase/helicase (Hel) by mimicking the binding modes of the bismuth complexes which effectively competes for the Zn2+ ion binding sites in SCV Hel thereby disrupting and inhibiting both the NTPase and helicase activities.
+SARS:08f62fb3d767dc6d27afcc1ae6054e05ec27b329:abstract:77ba93b2355ff236391e659eca66dadc:371..570:sentences:6eb619ec80a41494dce3ed00cf36fc32	ADK|HFM1	ADK|helicase	Phosphate release assay and FRET-based assay of the ADK analogues showed that the ADKs selectively inhibit the duplex DNA-unwinding activity without significant impact on the helicase ATPase activity.
+SARS:08f6c419a42b6c922108349af6c1b2aaf2cc62b2:fulltext:f7e86d5b3d01fb1c15bcf1712694cb11:14465..14869:sentences:b49e5992f4ff147b40dc2e3b892a001d	ORMDL3|GSTM1|GSTP1|GSTM1|GSTP1	ORMDL3|GSTM1|GSTP1|GSTM1|GSTP1	71 The ORMDL3 gene confers susceptibility to early-onset asthma, particularly through interaction with early life exposure to ETS 67 72 ; GSTM1 and GSTP1 are involved in the metabolism of polycyclic aromatic hydrocarbon derivatives and reactive oxygen species 73 74 ; GSTM1 null and GSTP1 genotypes have been associated with an increased risk of asthma 75 and rapid decline of lung function among smokers.
+SARS:08f6c419a42b6c922108349af6c1b2aaf2cc62b2:fulltext:f7e86d5b3d01fb1c15bcf1712694cb11:15075..15365:sentences:f45c5f765471d00372d0975518cce527	TBX21|FCER2|STIP1|SERPINE1	TBX21|FCER2|STIP1|SERPINE1	68 78 Among genes affecting the corticosteroid and inflammatory pathways, we selected genes (CHRH1, TBX21, FCER2, GLCC1, STIP1 and SERPINE1) that were shown to correlate with response to corticosteroids in patients with asthma; the finding for some of them was replicated in several cohorts.
+SARS:08f6c419a42b6c922108349af6c1b2aaf2cc62b2:fulltext:f7e86d5b3d01fb1c15bcf1712694cb11:15821..16078:sentences:595c61d01bd3d7a57ad9bff32d9b6dd3	RNASE3|IL8|IL8|MPO	eosinophil cationic protein|interleukin-8|IL-8|myeloperoxidase	85 Sputum cell counts and differentials (ie, eosinophils and neutrophils) determine the inflammatory phenotype; analysis of supernatants for eosinophil cationic protein (ECP), interleukin-8 (IL-8) and myeloperoxidase provides measures of cellular activation.
+SARS:091b857ba8a07eca145ae411f7202ca3a4d970df:fulltext:6c816e04f47f1428ebf5fcb55ac8116d:2300..2469:sentences:5f2e71fe4bd126a1cbbf82a4ca2b251a	MUC5AC|MUC5B	MUC5AC|MUC5B	17, 18 MUC5AC and MUC5B are the most common mucins in the human sputum, and they assist the innate immune system through their anti-inflammatory and antiviral properties.
+SARS:091b857ba8a07eca145ae411f7202ca3a4d970df:fulltext:6c816e04f47f1428ebf5fcb55ac8116d:3274..3434:sentences:94cd761b034b8230fe45640ec71d09c3	NOD1|NOD2	Nod1|Nod2	22, 25 Nod1 and Nod2, which are family members of NLRs, are induced by molecules synthesized during the production and/or degradation of bacterial peptidoglycan.
+SARS:091b857ba8a07eca145ae411f7202ca3a4d970df:fulltext:6c816e04f47f1428ebf5fcb55ac8116d:3796..4023:sentences:57487870cdaa49ba99a31e0bdef2152a	ICAM1|ICAM1|CEACAM1|PTAFR	intercellular adhesion molecule 1|ICAM-1|CEACAM-1|PAF-r	32 Finally, the airway epithelium consists of many molecules including intercellular adhesion molecule 1 (ICAM-1), carcinoembryonic antigen-related cellular adhesion 1 (CEACAM-1), and platelet-activating factor receptor (PAF-r).
+SARS:091b857ba8a07eca145ae411f7202ca3a4d970df:fulltext:6c816e04f47f1428ebf5fcb55ac8116d:6752..6984:sentences:31a0bf24634df1d14f3d0d1e6a18f1c0	TLR4|TLR5	TLR4|TLR5	For instance, TLR4 and TLR5 pathways are altered after influenza virus infection, resulting in decreased neutrophil attraction, thereby leading to increased attachment of S. pneumonia and P. aeruginosa to the airway epithelial cells.
+SARS:091b857ba8a07eca145ae411f7202ca3a4d970df:fulltext:6c816e04f47f1428ebf5fcb55ac8116d:7771..7933:sentences:0f6078ad06510336ff37aeff4338c7e7	CEACAM1|ICAM1	CEACAM-1|ICAM-1	54 RSV differs from influenza virus in that the former upregulates cellular receptors including CEACAM-1 and ICAM-1, which eventually leads to bacterial infection.
+SARS:091b857ba8a07eca145ae411f7202ca3a4d970df:fulltext:6c816e04f47f1428ebf5fcb55ac8116d:7935..8091:sentences:17957a62bbc6fad255e59190e867ae3b	NOD1|NOD2	Nod1|Nod2	45 Finally, interaction between type I IFNs and Nod1/Nod2 signaling leads to bacterial recognition, but indicts harmful effects in the virally infected host.
+SARS:091b857ba8a07eca145ae411f7202ca3a4d970df:fulltext:6c816e04f47f1428ebf5fcb55ac8116d:9088..9231:sentences:f7ad45dd01e9ba491526db29439a7cfe	MX1|STAT1	MxA|signal transducer and activator of transcription 1	MxA expression is firmly modified by type I and type III IFNs, which also requires signal transducer and activator of transcription 1 signaling.
+SARS:09417d5a567e93e35a80a241b9459f2b84ef0b0d:abstract:08871c72c4b0b86a45091c846fed6ae6:1648..1920:sentences:11c316f1ef843fc92593405315a6b97c	BAX|BCL2|CASP3	Bax|Bcl-2|caspase-3	The results suggested that the anticancer molecular mechanism of the combination therapy of glycyrrhizin and doxorubicin in ALG NGPs was performed via regulating apoptosis pathway of Bax/Bcl-2 ratio and caspase-3 activity, which was also verified in H22 tumor-bearing mice.
+SARS:09484eac9b6a66dfc5ab6da0814a0d5d5c3bc9b4:abstract:e639573ed2700fc0df69cdb7119051d7:0..99:sentences:087700074a432a809ba13b661d7bf981	TRIM25|DDX58	TRIM25|RIG-I	TRIM25 is an E3 ubiquitin ligase that activates RIG-I to promote the anti-viral interferon response.
+SARS:09484eac9b6a66dfc5ab6da0814a0d5d5c3bc9b4:abstract:e639573ed2700fc0df69cdb7119051d7:101..281:sentences:b4aff266fbf64045660ed29a39716d03	IVNS1ABP|TRIM25|TRIM25	NS1|TRIM25|TRIM25	The NS1 protein from all strains of influenza A virus bind TRIM25, although not all virus strains block the interferon response, suggesting alternative mechanisms for TRIM25 action.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:3321..3485:sentences:d992f9d62dfd3578ae4902187160ff21	TLR1|TLR10	TLR1|TLR10	The TLR family comprises 10 TLRs (TLR1 to TLR10 have been reported thus far) [9, 10] .. Can fibroblasts express TLRs against microorganisms or microbial components?.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:3487..3643:sentences:be30adc3bb1be270ac9134f8c22ebf8e	TLR1|TLR2|TLR4|TLR5|TLR6|TLR3|TLR7|TLR8|TLR9	TLR1|TLR2|TLR4|TLR5|TLR6|TLR3|TLR7|TLR8|TLR9	The recognition of PAMPs by TLRs can occur at the cell surface (TLR1, TLR2, TLR4, TLR5, and TLR6) and in intracellular vesicles (TLR3, TLR7, TLR8, and TLR9).
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:3645..3872:sentences:70247881d21560d470dd3a392f259840	|TLR2|TLR4|TLR2|TLR1|TLR6	TRL1|TLR2|TLR4|TLR2|TLR1|TLR6	TLRs play an important role in recognizing microbial components from bacteria, fungi, parasites, and viruses [11] . TRL1, TLR2, and TLR4 recognize bacterial cellular walls, and TLR2 forms heterodimer complexes with TLR1 or TLR6.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:3983..4375:sentences:4fdeb3b3174e3a9769c6bbae64163889	TLR5|TLR7|TLR8|TLR9|TLR10	TLR5|TLR7|TLR8|TLR9|TLR10	The fl agellin of gram-negative bacteria can be recognized by TLR5 and TLR7, while TLR8 recognizes single-stranded viral RNA and TLR9 identifi es viral and bacterial deoxyribonucleic acid (DNA) unmethylated CpG motifs [9, 10, 12] , and expression of TLR10 has been induced by exposure to Helicobacter pylori [13] .. Can fibroblasts express TLRs against microorganisms or microbial components?.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:4377..4552:sentences:056b5519157ec354c8fd854fc4d33142	TLR1|TLR9|TLR10	TLR1|TLR9|TLR10	Yao and colleagues demonstrated the expression of 10 different TLRs in skin fi broblasts and also showed that fibroblasts are functionally active (TLR1 to TLR9, but not TLR10).
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:4985..5419:sentences:6a7213c510ec45aa204e582fe9d0c91b	SPG7|TLR1|TLR2|TLR6|TLR5|TLR7|TLR8|TLR5|TLR9	PGN|TLR1|TLR2|TLR6|TLR5|TLR7|TLR8|TLR5|TLR9	Peptidoglycan (PGN; fsa = from Staphylococcus aureus) induces the specifi c expression of TLR1, TLR2, and TLR6 for these PAMPs, but also the expression of TLR5, TLR7, or TLR8, which are not specifi c for these PAMPs, while stimulation with lipoteichoic acid (LTA; fsa) induces TLR5 expression and muramyl dipeptide (MDP; fsa) induces TLR9 expression [15] .. Can fibroblasts express TLRs against microorganisms or microbial components?.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:5421..5990:sentences:a2cf6b2647afdfc6aa4e5edaee625aef	SPG7|TLR4	PGN|TLR4	On the other hand, gram-negative bacteria possess a slim PGN layer, while in the outer membrane there is a lipopolysaccharide (LPS) formed of lipid A and O-linked polysaccharide [1, 16] . There are components of gram-negative bacteria that can induce TLR corneal and gingival fi broblast expression, such as an LPS from Pseudomonas aeruginosa, the tetra-acylated lipid A LPS from Porphyromonas gingivalis, and the LPS from Escherichia coli which also induces TLR4 expression [16] [17] [18] .. Can fibroblasts express TLRs against microorganisms or microbial components?.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:6306..6648:sentences:d5a59fc980e4f50c9fed7375ef2f987f	TLR4|TLR2|TLR4	TLR4|TLR2|TLR4	It has been demonstrated that fi broblasts express TLR4 in the presence of the hyphae or conidia of Fusarium solu [21] . This expression has been observed in other diseases where corneal cells expressed TLR2 and TLR4 in the presence of Aspergillus fumigatus [22] .. Can fibroblasts express TLRs against microorganisms or microbial components?.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:8317..8557:sentences:477aecdc27143aa3c7b037bdd3eba866	DEFB1|DEFB104B|CAMP	hBD1|hBD4|LL-37	This family includes -defensins and -defensins (hBD1 to hBD4), adrenomedullin, histatins, and cathelicidins (LL-37) [25] .. What about antimicrobial peptide synthesis by fibroblasts in the presence of microorganisms or microbial components?.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:8779..9047:sentences:e382a76e33cf76c996e2bb1a254a4829	CAMP|CAMP|DEFB103B	LL-37|LL-37|hBD-3	However, the LL-37 concentrations and the susceptibility of E. coli to LL-37 increase the proba-bility of developing urinary tract infections (UTI) [26, 27] . -Defensin 3 (hBD-3) is able to suppress the biofi lm formation of S. aureus [28] . Common ocular pathogens (P.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:9556..9953:sentences:533d5996d812a11cec1e22d8573cbcea	DEFB4A|DEFA3|SPG7	hBD-2|DEFA-3|PGN	abscessus); on the other hand, gingival fi broblasts secreted hBD-2 in the presence of intracellular bacteria such as Chlamydia spp., while corneal fi broblasts expressed DEFA-3, which is an -defensin, when they were stimulated with PGN from S. aureus (Table 1 ) [30] [31] [32] .. What about antimicrobial peptide synthesis by fibroblasts in the presence of microorganisms or microbial components?.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:11266..11777:sentences:3297f8f945cf93bf53ca9bf852debe36	IL6|MMP2|TNF|TNF|GIF	IL-6|membrane protein (MMP)-II|tumor necrosis factor alpha|TNF|INF	INF increases the cytotoxic and phagocytic activity of macrophages, restricting the growth of infected cells [34, 35] . IL-6 is an infl ammatory cytokine and is synthesized and activated in an acute immune response when infection occurs [36] . IL-12p70 is synthesized by dendritic cells when they are stimulated with major membrane protein (MMP)-II, in addition to producing tumor necrosis factor alpha (TNF) [37] .. What about the synthesis of cytokines expressed by fibroblasts against present microorganisms?.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:11779..12293:sentences:3a5d934a55d1a0942defc495ea603159	IL6|IL8|IL6|IL2|IL10|IL6|IL8|GIF|GIF	IL-6|IL-8|IL-6|IL-2|IL-10|IL-6|IL-8|INF|INF	Skin fi broblasts can synthesize proinfl ammatory cytokines such as INF, IL-6, and IL-8 in response to conditioned biofi lm and planktonic cultures of S. aureus cells [38] . Corneal fi broblasts stimulated with LPS from P. aeru ginosa synthesize IL-6, IL-2, IL-10, IL-12p70, and INF- [39] . Human gingival fi broblasts express IL-6 and IL-8 in the presence of LPS tetra-acylated peptide A from P. gingivalis [23] . The same effect occurs when the oral fi broblast cavity is exposed to C. albicans and Chlamydia spp.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:13566..14464:sentences:238d076876eb5ed42ed7ae68b719d4de	CCL2|CCL3|CCL4|IL8|IL8|CXCL9|CXCL13|CXCL16|IL8|CXCL10|CXCL10|CXCL9|CCL2|CCL3|CCL5|GIF	CCL2|CCL3|CCL4|CXCL8|IL-8|CXCL9|CXCL13|CXCL16|CXCL8|CXCL10|CXCL10|CXCL9|CCL2|CCL3|CCL5|INF	In malarial infections, there are the synthesis of proinfl ammatory cytokines and the recruitment of monocytes and macrophages; there are also expressions of chemokines such as CCL2, CCL3, CCL4, CXCL8 (IL-8), CXCL9, CXCL13, and CXCL16 in the placentae of women with malaria [41] . The chemokine CXCL8 is primarily produced by fi broblasts and other cells in response to periodontal bacteria and bacterial components [42] . The expression of CXCL10 increases in airway epithelial cells when the cells are stimulated with dsRNA and INF [43] . CXCL10, CXCL9, CCL2, CCL3, and CCL5 are involved in the cellular migration of natural killer cells (NK), macrophages, T cells, neutrophils, and plasmacytoid dendritic cells in a model of severe acute respiratory syndrome-associated coronavirus (SARS-CoV) [44] .. What about the synthesis of cytokines expressed by fibroblasts against present microorganisms?.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:14483..14667:sentences:9f7187b0ecdc9558ff62f0d1ab09c531	CCL1|CCL2|CCL5|CXCL1|IL8|IL8|CXCL10	CCL1|CCL2|CCL5|CXCL1|CXCL8|IL-8|CXCL10	demonstrated the expression of chemokines, such as CCL1, CCL2, CCL5, CXCL1, CXCL8 (IL-8), and CXCL10, on limbo-corneal myofi broblasts with the stimulus of poly I:C [23] . Herath et al.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:14834..14998:sentences:ae35fbc94789990c6fd83e5f34816355	HGF|CSF2|CXCL10|CSF3|IL6|IL8|CCL2	HGF|GM-CSF|CXCL10|G-CSF|IL-6|IL-8|CCL2	Microbial component or microorganisms Cytokine/growth factor/antimicrobial peptide HGF [16] LPS tetra acylated peptide A GM-CSF, CXCL10, G-CSF, IL-6, IL-8, and CCL2.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:15071..15349:sentences:3c65018185903d08843e61ea2d9623ae	MMP9|IL2|IL8|IL10|CSF2|GIF|TNF|IL6|CCL2|TNPO1|CCL4|IL10|IL1A|CCL1|CCL5|CXCL1|IL8|IL8|CXCL10|IL6|DEFB1|CAMP	MMP-9|IL-2|IL-8|IL-10|GM-CSF|INF|TNF|IL-6|MCP-1|MIP-1|CCL4|IL-10|IL-1|CCL1|CCL5|CXCL1|CXCL8|IL-8|CXCL10|IL-6|hBD1|LL37	CF [18] P. aeruginosa LPS MMP-9, IL-2, IL-8, IL-10, IL-12p70, GM-CSF, INF, TNF, IL-6, MCP-1, and MIP-1 (CCL4) SFHTI [21] Hyphae and conidia Fusarium solu IL-10, IL-1 LCM [23] Poly I:C CCL1, CCLC, CCL5, CXCL1, CXCL8 (IL-8), CXCL10, G-SCF, IL-6 LCF [30] Mycobacteria hBD1 and LL37.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:15370..16160:sentences:614b17dc92e204776806a381ac1b5fac	IL6|IL8|VEGFA|MMP3|IL6|IL6|IL8|DEFB4A|CCL2|CX3CL1|HGF|GIF	IL-6|IL-8|VEGF|MMP-3|IL-6|IL-6|IL-8|hBD2|CCL2|CX3CL1|HGF|INF	EF [38] Biofilm and planktonic supernant INF, IL-6, IL-8, VEGF, TGF-1, EGF HB, and MMP-3 OCF [39] C. albicans CX3CL, IL-6, IL-8 HGF [40] Chlamydia sp IL-6, IL-8, hBD2 HGF = human gingival fibroblasts; HDF = human dermal fibroblasts; CF = corneal fibroblasts; SFHTI = stromal fibroblasts human telomerase immortalized; LCM = limbo-corneal myofibroblasts; LCF = limbo-corneal fibroblasts; EP = epidermal fibroblasts; OCF = oral cavity fibroblasts the expression of CCL2 and CX3CL1 by gingival fi broblasts [16] . Previous data had suggested the capacity of fi broblasts to induce chemokines when there was a microbial infection and to cause the recruitment of infl ammatory cells (Table 1) . The sentinel fi broblasts said that their communication method with the gremmie members was the best.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:17436..17726:sentences:090ee21a8e8ee7b6f2abd189464c8d32	CSF2|CSF3|CSF3	GM-CSF|granulocyte colony-stimulating factor|G-CSF	The growth factors granulocyte/macrophage colony-stimulating factor (GM-CSF) and granulocyte colony-stimulating factor (G-CSF) play roles in immune responses, survival, cancer pathogenesis, proliferation of macrophages, erythrocytes, eosinophils, megakaryocytes, and multipotent progenitors.
+SARS:092880cc76f470dd9cca8233d83c884c0c5edf94:fulltext:e5bb3452ab881702bd1f9c36e70297ed:18405..18741:sentences:3d4f7a1fd8a93b2ddb6dd217d86f0493	CSF3|CSF2|CSF3	G-CSF|GM-CSF|G-CSF	[49] observed the synthesis of GMC-CSF in corneal fi broblasts when stimulated by P. aeruginosa LPS, while Dominguez-Lopez reported poly I:C-induced G-CSF expression on limbo-corneal myofi broblasts [23] . These reports permit us to conclude that the fi broblast produces GM-CSF upon bacterial stimulation and G-CSF in a viral infection.
+SARS:0977f51bf118077aae3d344adbe019c40622beb4:abstract:e6960ae7616ee7d0ba208043d217f2e4:579..820:sentences:983892ca82bd9c7a1eaa11e5bab83bcc	HSPB1|EIF4E	Hsp27|eIF4E	Specifically, the interaction of the chaperone protein Hsp27 with the initiation factor eIF4E leads to the protection of protein synthesis initiation process and enhances cell survival during cell stress induced by castration or chemotherapy.
+SARS:0977f51bf118077aae3d344adbe019c40622beb4:abstract:e6960ae7616ee7d0ba208043d217f2e4:822..1053:sentences:1524b9beea660c3e8de1fe00b0b06634	HSPB1|EIF4E	Hsp27|eIF4E	Thus, in this work we aimed at i) identifying the interaction site of the Hsp27/eIF4E complex and ii) interfere with the relevant protein/protein association mechanism involved in castration-resistant progression of prostate cancer.
+SARS:0977f51bf118077aae3d344adbe019c40622beb4:abstract:e6960ae7616ee7d0ba208043d217f2e4:1055..1222:sentences:0e725424f6a701a7955056cc4fdf6c98	EIF4E|HSPB1|HSPB1	eIF4E|Hsp27|Hsp27	By a combination of experimental and modeling techniques, we proved that eIF4E interacts with the C-terminal part of Hsp27, preferentially when Hsp27 is phosphorylated.
+SARS:0977f51bf118077aae3d344adbe019c40622beb4:abstract:e6960ae7616ee7d0ba208043d217f2e4:1321..1704:sentences:752ff4ee7c1eeef29bd853bb0e42ff02	HSPB1|EIF4E	Hsp27|eIF4E	In order to find a potential inhibitor of Hsp27/eIF4E interaction, BRET assays in combination with molecular simulations identified the phenazine derivative 14 as the compound able to efficiently interfere with this protein/protein interaction, thereby inhibiting cell viability and increasing cell death in chemo- and castration-resistant prostate cancer models in vitro and in vivo.
+SARS:097e78073b154805e74de8245008ee3f91c24af2:fulltext:44b2a3ee879314944b54301b7afb09e5:12512..12823:sentences:577237fdf1c172a4fd788becca5e9fdb	IVNS1ABP||PBRM1|NEU1	NS1|NS2|PB1|neuraminidase	These are non-structural protein 1 (NS1), non-structural protein 2 (NS2), matrix protein M1 and ion channel protein M2, polymerase acidic (PA) protein, polymerase basic protein (PB1), polymerase basic protein 1-F2, polymerase basic protein 2 (PB2), nucleoprotein (NP), hemagglutinin (HA), and neuraminidase (NA).
+SARS:0977f51bf118077aae3d344adbe019c40622beb4:title:55306f182759901b99438a093b09af66:0..132:sentences:6df88ce353a3f8614357c9bc15a4a207	HSPB1|EIF4E	Hsp27|eIF4E	Targeting Hsp27/eIF4E interaction with phenazine compound: a promising alternative for castration-resistant prostate cancer treatment
+SARS:077fdedebe982644bd8eb2ad732ec9c1b2cff475:abstract:61d10262a0adc9a93ffedc0e3d22bb9d:272..384:sentences:21305c369e05e8bf7904eeb76f0b17e4	NAA20|NAA25	NAA20|NAA25	We found that NatB, which comprises NAA20 and NAA25, is involved in the shutoff activity of influenza virus PA-X.
+SARS:077d5a9302762a66842c6bdf13912433954ca723:fulltext:044151f4866a319dbbb20a81495e8e3e:4067..5124:sentences:f9ee6df3767eab96fc8b782a22249d6c	RAB2A||TP53	Rab2|p58|p53	These include the small GTPase Rab2 (Chavrier et al., 1990) , the transmembrane protein p58 in rat cells or its human homologue p53 (Schweizer et al., 1988; Saraste and Svensson, 1991) , which actively cycle between the ER and VTCs, and the COPI subunit 13-COP (Oprins et al., 1993; Pepperkok et al., 1993; Pind et al., 1994a; Aridor et al., 1995) . VTCs play a pivotal role in the segregation of anterograde and retrograde transported proteins (Aridor et al., 1995; Tang et al., 1995) . Segregation is believed to involve the COPI coat complex whose assembly is driven through activation of the ARF1 GTPase (Aridor et al., 1995; Letourneur et al., 1995) .. . While VTC composition and function have been described qualitatively through use of immunofluorescence (Lotti et al., 1992; Aridor et al., 1995; Lippincott-Schwartz et al., 1995) and immunoperoxidase (Connolly et al., 1994; Stinchcombe et al., 1995) approaches, the topology of ER budding sites and, in particular, their relationship to VTCs have not been studied quantitatively at high resolution.
+SARS:077d5a9302762a66842c6bdf13912433954ca723:fulltext:044151f4866a319dbbb20a81495e8e3e:42985..43217:sentences:0e3a997aeaade0972ca886203a4f4bb8	CARD16|SEC13	COP|Sec13	Upon immunolabeling, we found accumulated vesicles to be substantially enriched in VSV-G (Pind et al., 1994a) and components of both COPI (13-COP) (Pind et al., 1994a; Griffiths et al., 1995b) and COPII coats (Sec13 and Sec 23) (Fig.
+SARS:09c9fcabc66a106e01ef42247cbd86b6d85bd67f:abstract:fc6652142cfcbcfcf8d7e91104721f25:376..546:sentences:b3b397b3d96182889b5dbe63053dae69	SH2D3A|PRSS57|SH2D3C	nsP1|nsP4|nsP3	CHIKV expresses four non-structural proteins (nsP1-nsP4), with nsP3 containing a macrodomain that hydrolyzes and thereby reverses protein MARylation in vitro and in cells.
+SARS:09c9fcabc66a106e01ef42247cbd86b6d85bd67f:abstract:fc6652142cfcbcfcf8d7e91104721f25:880..997:sentences:6945a2001ca85aa4bdef09c361b4eaaa	PARP10|PARP12	ARTD10|ARTD12	We identified ARTD10 and ARTD12 as restriction factors for CHIKV replication in a catalytic activity-dependent manner.
+SARS:09c9fcabc66a106e01ef42247cbd86b6d85bd67f:abstract:fc6652142cfcbcfcf8d7e91104721f25:1191..1264:sentences:efc863c92e03c144b7015ea606fb996d	PARP10|PARP12	ARTD10|ARTD12	Expression of ARTD10 and ARTD12 resulted in a reduction of processed nsPs.
+SARS:09c9fcabc66a106e01ef42247cbd86b6d85bd67f:abstract:fc6652142cfcbcfcf8d7e91104721f25:1650..1699:sentences:4c518d3c79c09093e5f7ff77e7d1beb5	RTN2|PARP10	nsP2|ARTD10	Indeed, we found that nsP2 is MARylated by ARTD10.
+SARS:0a003aa69f43cee4357f1e943df79a8b87c0a88e:fulltext:4eda92f901c7bfc4fc1cf73934bc8a07:2848..3871:sentences:526cd3044deb5f60f58bc8be7dfc6407	ITGAL|ITGAL|ITGB2	LFA-1|CD11a|CD18	LKT is a potent cytolytic toxin, with an apparent molecular weight (MW) of 105 kDa, actively secreted by all serotypes of the bacterium during the logarithmic phase of in vitro growth (Shewen and Wilkie, 1985; Chang et al., 1987) . It belongs to the family of the RTX (repeat in toxin) pore-forming cytolysins, which have been linked with the virulence of other bacterial species (Lo et al., 1987; Lainson et al., 1996) . It specifically targets ruminant leukocytes and plays a major role in pathogenesis of BRD by impairing the primary lung defense mechanism and by inducing inflammation as a consequence of leukocyte lysis (Conlon et al., 1991) . This phenomenon has been correlated with its ability to bind and interact with the ruminant beta2-integrin Lymphocyte Function-associated Antigen 1 (LFA-1) (CD11a/CD18) (Zecchinon et al., 2005; Singh et al., 2011) . Neutralizing antibodies generation against the cytolytic toxin is relevant for achieving a high level of protection (Mosier et al., 1989) . Immunity against M.
+SARS:09e8ffe2b970364e969a4b167ed6ecd1ff8f9554:title:fbe5ff00bac4b2be2cb258dbd10956d8:0..106:sentences:0b2bcce98a30dba0c8825fccd7c07d22	OAS1|MX1|SARS	OAS-1|MxA|SARS	Polymorphisms of interferon-inducible genes OAS-1 and MxA associated with SARS in the Vietnamese population
+SARS:0a1f43c04e0e22fb6efbd94611920bc9680d7ae3:fulltext:1c21c63b1ae52b50c05441272c140ce6:4827..5039:sentences:6f7b86b94a1854637523219360407344	TNF|IFNA1	TNF|IFN	Typing of the TNF-  308 G NA (rs1800629) SNP and IFN- + 874 ANT (rs2430561) were performed using the polymerase chain reaction with amplification refractory mutation system (PCR-ARMS) as described by Perrey et al.
+SARS:0a1f43c04e0e22fb6efbd94611920bc9680d7ae3:fulltext:1c21c63b1ae52b50c05441272c140ce6:6435..6550:sentences:61b21f1445a03a663c57ab77819a2f0f	TNF|IFNA1	TNF|IFN	The PCR product for TNF-  308 was detected at 184 bp ( Fig. 1) while that of IFN- + 874 was detected at 263 bp (Fig.
+SARS:0a1f43c04e0e22fb6efbd94611920bc9680d7ae3:fulltext:1c21c63b1ae52b50c05441272c140ce6:8790..8961:sentences:b415da3a9ad155459b6d4ebf6ff0914e	TNF|IFNA1	TNF|IFN	It showed clearly IFN- + 874 T and TNF-  308 A alleles are risk alleles for SLE in Egyptian subjects although apparently not affecting the clinical severity of the disease.
+SARS:0a1f43c04e0e22fb6efbd94611920bc9680d7ae3:fulltext:1c21c63b1ae52b50c05441272c140ce6:10985..11608:sentences:3d3c42f6aa2c71a010a65b06554882d9	IFNA1|TNF	IFN|TNF	Several studies have indicated that alterable expression of the IFN- level has significant effects to the susceptibility of various autoimmune diseases, particularly in SLE (Csiszr et al., 2000; Tanaka et al., 1999) . Nonetheless, other studies found contradictory results of no association of TNF-  308 G NA polymorphism with SLE among Argentinean (Muoz et al., 2014) , Mexican (Ziga et al., 2001) , Japanese (Takeuchi et al., 2005) , Colombian (Tobn et al., 2005) , African Americans (Parks et al., 2004 ), Italian (D'Alfonso et al., 1996 , Chinese (Fong et al., 1996) , Thai and Portuguese (Santos et al., 2012) patients.
+SARS:09e6d442b7da6f36e3c7a82a056d8d61e27b1050:fulltext:beae60fb365dfcad4a7724cffbbd216c:4090..4313:sentences:f8accd76b5595883e47f80cfb191517e	FZD4||CXCR5	GPCR|HPC4|CXCR5	In order to develop GPCR whole receptor assays, a tandem 6xHis/HPC4 tag was added to the C-terminus of full-length human CXCR5 coding sequence and expressed in insect Sf9 cells using the baculovirus expression vector system.
+SARS:09e6d442b7da6f36e3c7a82a056d8d61e27b1050:fulltext:beae60fb365dfcad4a7724cffbbd216c:6922..7037:sentences:3e5ae396e1dd3a31f2a45a7df0a8ce6a	CXCR5|CD52	hCXCR5|CD52	Similar to Ni-affinity capturing of the purified hCXCR5, the capture of CD52 VLPs by Alemtuzumab is target specific.
+SARS:09e6d442b7da6f36e3c7a82a056d8d61e27b1050:fulltext:beae60fb365dfcad4a7724cffbbd216c:13325..13459:sentences:b098f21eb812d091ec04676cab9870fb	CXCL13|CXCR5|CXCR5	CXCL13|hCXCR5|hCXCR5	CXCL13 and 3 anti-hCXCR5 mAbs were each tested in triplicate in 2-fold dilution series for binding to hCXCR5 in HBS-EP1 running buffer.
+SARS:0a95d5dccbe573b1f79c50ac2c7839a5c08a990e:title:ad73d0bb463d27c7719e399d83064965:0..212:sentences:4fa4931dd9db170580f227aac78b4383	CD8A|CD4	CD8|CD4	Overlapping CD8+ and CD4+ T-cell epitopes identification for the progression of epitope-based peptide vaccine from nucleocapsid and glycoprotein of emerging Rift Valley fever virus using immunoinformatics approach
+SARS:0aa0d50125fe98feab1d98aba6760b14f4fe3927:abstract:996c5c0578c2e5ad4ed641d1568afbe5:1414..1565:sentences:85d1022a21fe1ec5c69a7c72f891d589	TLR3|	TLR3|miR-155	TLR 3, 7, and 9 transcripts were upregulated in ORNs and ML, yet only ORN layers revealed a positive correlation between TLR3 and miR-155 transcription.
+SARS:0ac431a9a48289831c825c2b30f48bdf7f548995:abstract:38a4d73e37bdf771101e556b72b003fe:733..1058:sentences:cd37fe8cc0c943cef0a4e896a77c204d	SH2D3A|RTN2	nsp1|nsp2	A limited number of SARS-CoV attenuating modifications have been described, including mutations, and partial or complete gene deletions affecting the replicase, like the nonstructural proteins (nsp1 or nsp2), or the structural genes, and drastic changes in the sequences that regulate the expression of viral subgenomic mRNAs.
+SARS:0ac431a9a48289831c825c2b30f48bdf7f548995:abstract:38a4d73e37bdf771101e556b72b003fe:1564..1869:sentences:736501fda572089a243578e6b25a3d30	SH2D3A|RTN2	nsp1|nsp2	The safety of the live SARS-CoV vaccines is being increased by the insertion of complementary modifications in genes nsp1, nsp2, and 3a, by gene scrambling to prevent the rescue of a virulent phenotype by recombination or remodeling of vaccine genomes based on codon deoptimization using synthetic biology.
+SARS:0a64b2c55fc2091358da4f83ac6fdc7701ddb46e:fulltext:b01c261db1dd60a60616028808cca701:6323..6473:sentences:16672da767fee4a5c08469d19f7bf5ef	RPL11||RPL11	rpl11|TRP1|ribosomal protein L11	Isogenic rpl11 mutant strains were based on JD1381, but contained low copy TRP1-CEN6based plasmids expressing mutant versions of ribosomal protein L11.
+SARS:0aa4edc168fd9bf7ba7efee20dbeb007c26b1beb:fulltext:3af9121e92def22f594e0cc25a2838fc:593..1070:sentences:32fec6a230cd624a5769a385be7c6b9f	|ASZ1	ORF1|ORF3	The viral genome is 7.3 to 7.5 kb in size and consists of three open reading frames (ORF1, ORF2, and ORF3), which encode for large polyprotein, major capsid protein (VP1) and small basic protein (VP2), respectively [7] . Based on the phylogeny of deduced amino acids (aa) of VP1 protein, noroviruses are classified into seven genogroups (GI-GVII); GI, GII, and GIV infect humans while GIII infects bovine and sheep [8] . Each genogroup is further divided into several genotypes.
+SARS:0ac8a7f82aad93ce05c17848784cdb2dc06aa44f:abstract:4a18dd255eaf023bac90a991b8f8bbbc:320..434:sentences:9acb0f20df6b548880f3d2d4460978d5	DDX1|DDX3X	DDX1|DDX3	Indeed, DDX1 and DDX3 DEAD-box RNA helicases are known to be required for efficient HIV-1 Rev-dependent RNA export.
+SARS:0ac8a7f82aad93ce05c17848784cdb2dc06aa44f:abstract:4a18dd255eaf023bac90a991b8f8bbbc:560..759:sentences:efc1ebd704ea389ce80144daa595ea4a	DDX1|DDX3X|DDX5|DDX17|DDX21|DDX56|DDX6	DDX1|DDX3|DDX5|DDX17|DDX21|DDX56|DDX6	In this study, we noticed that distinct DDX RNA helicases, including DDX1, DDX3, DDX5, DDX17, DDX21, DDX56, except DDX6, bound to the Rev protein and they colocalized with Rev in nucleolus or nucleus.
+SARS:0ac8a7f82aad93ce05c17848784cdb2dc06aa44f:abstract:4a18dd255eaf023bac90a991b8f8bbbc:873..957:sentences:61493c1f10ac3b65eb3e6d543ae9ec00	DDX3X|DDX5	DDX3|DDX5	Furthermore, DDX3 interacted with DDX5 and synergistically enhanced the Rev function.
+SARS:0a617f5467e92a9a638ee23204247128635e32aa:abstract:a57bf7f593284a556adb60446c6493ca:299..537:sentences:020dc57c0e22ef987b9d43e42dd320f7	|CAB39|MARK1|MTOR	miR-451|CAB39|MARK|mTOR	Recent studies have shown that miR-451 regulates downstream molecules including AMPK/CAB39/MARK and mTOR to determine the balance between rapid proliferation and invasion in response to metabolic stress in the harsh tumor microenvironment.
+SARS:0a617f5467e92a9a638ee23204247128635e32aa:abstract:a57bf7f593284a556adb60446c6493ca:696..957:sentences:dc99fd8af90a0646f7587c89ccdc8e0a	|MTOR	miR-451|mTOR	In order to address this complex process of cell proliferation and invasion and its response to conventional treatment, we propose a mathematical model that analyzes the intracellular dynamics of the miR-451-AMPK- mTOR-cell cycle signaling pathway within a cell.
+SARS:0ad29b032fe87db2641893f4cc880c22f2107712:fulltext:723a5e5ac2d122ba6c0b2d68eaed644b:7123..7208:sentences:787f2c1eb365962d966e89981b593bb2	PPP1R3A|RB1	Rg1|Rb1	The sum of ginsenosides Rg1 and Rb1, used as quality control marker, was above 7 mg/g.
+SARS:0ad29b032fe87db2641893f4cc880c22f2107712:fulltext:723a5e5ac2d122ba6c0b2d68eaed644b:15682..15918:sentences:a8789d4cd1cb172c46f6755fa92a6d10	ALPP|ALPP|SLC17A5	ALP|alkaline phosphatase|AST	WBC, white blood cell; RBC, red blood cell; PLT, platelet; ALP, alkaline phosphatase; AST, aspartate transaminase; ALT, alanine transaminase;  -GT, gamma glutamyl transferase; BUN, blood urea nitrogen; HPF, high power field.. DISCUSSION.
+SARS:0b48e310b1f5d0205ad5ffa292d950d2808185c0:abstract:bd8fc1bb2cab657d215cb0dc19cef293:887..1075:sentences:460e78ae60c79ac59b3f5335657f65de	MAPK8|MAP2K4	JNK|MKK4	Furthermore, silencing of the two selected lncRNAs (E52329 and N54010) resulted in reducing the phosphorylation of JNK and MKK4, which are known to be involved during inflammatory response.
+SARS:0b5a16a20f162e5f72cb4dd5efe066f5210324c5:abstract:031ffbc16c4510bce13fcb5c866c23bb:0..158:sentences:962f7e2db5348a5a257b4795be5cd64d	DDX58|IFIH1|DHX58|DDX58	RIG-I|MDA5|LGP2|RIG-I	The RIG-I-like receptors (RLRs) RIG-I, MDA5, and LGP2 play a major role in pathogen sensing of RNA virus infection to initiate and modulate antiviral immunity.
+SARS:0b65341c3090421acaac37ec4c93212277be55bb:abstract:9c0630716eca3f42bcb6d015103ab055:1245..1581:sentences:9d82c52270fa26a9cdfa9e0969ab216c	VIM|HSPB1|LCP1	vimentin|HSPB1|lymphocyte cytosolic protein 1	The protein signature at day 31 pi with E75CV1 seems to reflect events observed at 1 dpi, including the upregulation of proteosomal subunits and molecules described as autoantigens (vimentin, HSPB1, enolase and lymphocyte cytosolic protein 1), which allow the speculation that auto-antibodies could contribute to chronic ASFV infections.
+SARS:0b6962f3ef4cb5e76d6ccd144af840b6aec67474:abstract:7b6ac8fbebef4e2f6fc39870f84aceb4:583..796:sentences:51cc888a1064a761fb07a8e385f1fee2	MAP1B|MAP1LC3A	microtubule associated protein 1B|LC3	Conversion of microtubule associated protein 1B light chain 3 (LC3) from cytosolic (LC3 I) to the membrane associated form (LC3 II), a canonical marker of autophagosome formation, is enhanced in BEV infected cells.
+SARS:0b6962f3ef4cb5e76d6ccd144af840b6aec67474:abstract:7b6ac8fbebef4e2f6fc39870f84aceb4:919..1038:sentences:34ff460384ca520a384723f0a27ecc94	BECN1|MAP1LC3B	Beclin 1|LC3B	Similarly, BEV infection is not altered in autophagy deficient cells lacking either Beclin 1 or LC3B protein expression.
+SARS:0a2ded6cbd632857d491140a57f2773c3610b10b:fulltext:42b45368ae3f1c5aa4244cb0c6d5b973:11390..11523:sentences:0117121a9261338a609ea4bca421023c	PPT1|KCTD7	CLN1|CLN14	To date, 14 different genes have been implemented in the development of the human form of neuronal ceroid lipofuscinosis (CLN1-CLN14).
+SARS:0a2ded6cbd632857d491140a57f2773c3610b10b:fulltext:42b45368ae3f1c5aa4244cb0c6d5b973:12265..12464:sentences:8c0f56261f9a3545709474f3b85cf042	PPT1|CLN3|CLN5|CLN8|CTSD	CLN1|CLN3|CLN5|CLN8|CLN10	23, [25] [26] [27] [28] Sequencing of the exons of CLN1, CLN3, CLN5, CLN8 and CLN10 in a confirmed case of feline neuronal ceroid lipofuscinosis failed to identify the molecular cause in that patient.
+SARS:0b8d789e2116efa9e813dd4763020174f3f26968:title:0139f47b7ebcd395cf64717a04194196:0..39:sentences:775add07b704c2e0d358fc46b5c5d50b	FGL2|SARS	Fgl2|SARS	Fgl2: link between hepatitis B and SARS?
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:8138..8617:sentences:10d0e9fda311fbff15a31dd56ec680c7	POU5F1|NANOG	Oct-4|Nanog	64, 65 Murine BM-purified VSELs possess several in vitro features expected from PSCs, such as a characteristic morphology in transmission electron microscopy (a high nuclear/cytoplasmic ratio with a thin rim of cytoplasm, the presence of euchromatin and few mitochondria), and express Oct-4 and Nanog at the mRNA and protein levels, 14 which has received further confirmation by promoter methylation studies showing their association with histone codes that promote transcription.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:9573..9894:sentences:19dc196b862f4ca751163951651a93bf	DPPA3|PRDM14|PRDM1|NANOS3|DND1	Stella|Prdm14|Blimp1|Nanos3|Dnd1	In studies performed on highly purified double-sorted VSELs isolated under steady-state conditions from murine BM, we observed that these cells highly express, at the mRNA and/or protein levels, genes involved in both specification of the epiblast (for example, Stella, Prdm14, Fragilis, Blimp1, Nanos3 and Dnd1) and PGCs.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:9896..9998:sentences:7ff6d74f46d308e7dc11587227167e06	PGC|DPPA2|DPPA4	PGC|Dppa2|Dppa4	68, 69 The PGC-specific genes, such as Dppa2, Dppa4 and Mvh, are characteristic of late-migratory PGCs.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:10614..11231:sentences:130b289ae6e8d94065a02608d1657b4a	IGF2|KCNQ1|CDKN1C|CDKN1C|CDKN1C|CDKN1C|CDKN1C	Igf2|KCNQ1|p57|Kip2|p57|KIP2|p57 KIP2	Pursuing this hypothesis, we observed that VSELs, like PGCs migrating during embryonic development, modify the imprinting of some early-development parentally imprinted gene loci, including Igf2-H19, which results in their resistance to IIS, and by modifying imprinting and KCNQ1/p57 Kip2 upregulate the cyclin-dependent kinase inhibitor p57 KIP2 . 49 We also observed that, in addition to changes in expression of imprinted genes, VSELs express several miRNAs that attenuate IIS signaling in these cells (for example, mir681, mir470 and mir669b) as well as upregulate the expression of p57 KIP2 (for example, mir25.1,
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:12116..12780:sentences:47b00e39b6035477755c36509d003650	ATXN1|PTPRC|ATXN1|PTPRC|	Sca-1|CD45|Sca-1|CD45|B15-35	In support of this concept, we observed that a 10-day administration of all these sex hormones directly stimulated expansion of VSELs and HSCs in BM, as measured by an increase in the total number of these cells in BM (B2-3x) and enhanced 5-bromodeoxyuridine (BrdU) incorporation (the percentage of quiescent BrdU  Sca-1  Lin  CD45  VSELs increased from B2% to B15-35%, and the percentage of BrdU  Sca-1  Lin  CD45  HSCs increased from 24% to 43-58%) (K Mierzejewska, manuscript in preparation).. THE DEVELOPMENTAL ORIGIN OF VSELS EXPLAINS THE EPIGENETIC CHANGES REGULATING THE EXPRESSION OF PATERNALLY IMPRINTED GENES THAT GOVERN THEIR QUIESCENCE IN ADULT TISSUES.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:14760..15004:sentences:04db6b6fa6dcdc5cb542597813e864e3	IGF2|CDKN1C	Igf2|KCNQ1p57 Kip2	Blue box and yellow arrows pointing at VSELs indicate mechanism based on epigenetic modification of parentally imprinted genes (for example, at Igf2-H19 and KCNQ1p57 Kip2 loci) that keeps these early-development cells quiescent in adult tissues.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:17434..17630:sentences:7bfb12896b915945ec0f5fefa40da1f7	ATXN1|PTPRC	Sca-1|CD45	For example, murine BM-sorted Sca-1  Lin  CD45  VSELs have been shown to give rise to type 2 pneumocytes, which produce lung surfactant protein after transplantation into surfactant-deficient mice.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:17632..17836:sentences:3b8b6514a10b5efec02c320a4d732ee0	FUT4|POU5F1|PTPRC	SSEA1|Oct4|CD45	17 Furthermore, small SSEA1  Lin  CD45  cells that express Oct4  sorted from rat BM gave rise in vivo to cardiomyocytes and endothelial cells in an experimental model of rodent acute myocardial infarction.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:17838..18177:sentences:9aca3be56a051d6f42d97823b408361f	ATXN1|PTPRC|CXCR4|PTPRC	Sca-1|CD45|SSEA4  CD133  CXCR4|CD45	47 Furthermore, Sca-1  Lin  CD45  VSELs cells from murine BM 16 or human mobilized peripheral blood 18 cells expressing the SSEA4  CD133  CXCR4  Lin  and CD45  phenotype and isolated by fluorescence-activated cell sorting formed murine and human bones, respectively, when embedded in gelatin sponges and implanted into immunodeficient mice.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:18852..19212:sentences:9d1f2e97f6d4f3db775f55bdfad05a9b	SOX2|POU5F1	Sox2|Oct4	19, 20 Furthermore, human mobilized peripheral blood VSELs have been successfully purified by other researchers, 18, 21 and very small Oct4  Sox2  cells corresponding to UCB-derived VSELs described by us 15, 46 were purified from UCB by other investigators, who described them as a population of UCB-derived VSELs 23, 84 or UCBderived embryonic-like stem cells.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:23619..23864:sentences:8e21560fb9b0dc183a6032b2bea58567	PTPRC|ATXN1|PTPRC|ATXN1	CD45|Sca-1|CD45|Sca-1	Similarly, including CD45 int /Lin  /Sca-1  cells in the sorted population of CD45  /Lin  /Sca-1  cells (containing, in fact, VSELs) could result in VSEL dilution and eventually negative experimental outcomes in any type of functional experiment.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:25915..26604:sentences:2dcb7f218b385cacdbb14d5966002f55	PTPRC|ATXN1|PTPRC|ATXN1	CD45|Sca-1|CD45|Sca-1	Because of this crucial mistake and their resultant focus on the wrong population, the authors' statement 'This indicated that our VSEL candidates were the relatively larger cells in the population analyzed, unlike the VSELs The Sytox16-related signal may vary between cell populations, raising questions about its discriminatory role for diploid cell identification, and this problem is also clearly visible in the example of the CD45 hi /Lin  /Sca-1  cell fraction (located on the border of the 10-mm bead size, originally Figure 1C 29 and shown as Figure 2a in this article, green box), which is close to a half log unit brighter than the majority of FSC hi /CD45 hi /Lin  /Sca-1  cells.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:27422..27744:sentences:a1e81b349fe80f9481948ddcb36c5011	PTPRC|CXCR4	CD45|CXCR4	In the second of the 'con' papers, Danova-Alt et al., 27 based on their uncertain-quality fluorescent in situ hybridization staining with probes directed to only selected chromosomes, concluded that human UCB-derived CD45  /Lin  /CXCR4  cells (which they considered wrongly to be VSELs) display a high degree of aneuploidy.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:27746..28160:sentences:8702e793a190f10d0edf41940139f3d4	PTPRC|PROM1	CD45|CD133	In contrast, we verified the karyotype of human UCBderived CD45  /Lin  /CD133  cells (which we in fact consider to be a VSEL-enriched population) by employing a global genome cytogenetic array (CytoScan 750K, Affymetrix, Santa Clara, CA, USA) and definitively confirmed their normal, diploid status, with neither chromosomal aberrations nor small deletion/insertions in any gene (E Zuba-Surma, manuscript in press).
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:28213..28321:sentences:26714480205530256c7e9c94d6ae7810	PTPRC|CXCR4	CD45|CXCR4	27 focused on the subset of CD45  /Lin  /CXCR4  UCB cells that we indicated as being least enriched in VSELs.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:28797..28962:sentences:b22ae4cd8647b0dc93c6e38088dfe1a4	PTPRC|ATXN1	CD45|Sca-1	83 Small non-hematopoietic Sca-1  Lin  CD45  cells Isolated by FACS from murine BM give rise to type II pneumocytes, producing surfactant in lung alveolar epithelium.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:29019..29181:sentences:89c58b18e45deb4a93fa0cc7b03d60ad	POU5F1|PTPRC	Oct-4|CD45	17, 106 Rat VSELs Isolated by FACS from rat bone marrow as SSEA  Lin  CD45  cells that express Oct-4 and are endowed with cardiomyogenic and endothelial potential.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:29183..29392:sentences:5cd1a3583920ca4082014ae1689eba6f	ATXN1|PTPRC|PTPRC|PROM1|CXCR4	Sca1|CD45|CD45|CD133|CXCR4	47 Human PB-derived VSELs Isolated by FACS as Sca1  Lin  CD45  from murine BM or as SSEA-4  CD133  CXCR4  Lin  and CD45  from human PB-described as being at the top of the hierarchy for the mesenchymal lineage.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:29683..30037:sentences:27a781618c40bb393b31a75270150b6f	PTPRC|CD33|CD7|POU5F1|SOX2|POU5F1	CD45|CD33|CD7|Oct4|Sox2|Oct-4	19, 24, 48, 107 Testicular VSELs Small Oct-4  SSEA  cells identified in murine and human testes-precursors of male gametes 20 Embryonic-like stem cells from UCB Small CD45  , CD33  , CD7  , CD235a  pluripotent stem cells (2-3 mm in diameter) coexpressing embryonic stem cell markers, including Oct4 and Sox2, and able to differentiate into neuronal cells.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:30039..30141:sentences:ff19fb6559722b5859124b4aa4f03781	POU5F1|NANOG|SOX2|REXO1	Oct-4|Nanog|Sox-2|Rex-1	85, 86 UCB VSELs Small Oct-4  , SSEA-4  , Nanog  , Sox-2  , Rex-1  , and Tert  cells isolated from UCB.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:30433..30612:sentences:dd982376317281d7d63be600f378b691	POU5F1|PTPRC|PROM1	Oct-4|CD45|CD133	VSELs: an update MZ Ratajczak et al years, we clearly suggested that primitive Oct-4  , SSEA-4  cells should be sought within the much rarer fraction of CD45  /Lin  / CD133  cells.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:30802..31552:sentences:fdc797106baf4a055703dadb8f4b06ef	PTPRC|CD34|PROM1|PTPRC|CD34|PTPRC|PROM1	CD45|CD34|CD133|CD45|CD34|CD45|CD133	15, 46, 97 Interestingly, although these authors concluded that CD45  /Lin  cells from UCB essentially lack CD34 and CD133 antigens, these cells are visible even in their histograms (originally Figure 2B 27 and shown as Figure 2b in this article, upper panel), but the authors inexplicably overlooked the rare objects, including the VSEL fraction, 27 which we clearly indicated in our analysis done on dot plots (Figure 2b, lower panel) . It is clearly apparent that both CD45  /Lin  /CD34  and CD45  /Lin  /CD133  cells are present in at least some UCB samples analyzed by Danova-Alt et al., 27 which are indicated in their original histograms by blue boxes marking rare objects corresponding to both populations (Figure 2b , UCB samples 1, 2 and 3).
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:31554..31835:sentences:639380fda0aaa9966ebc68243a03e430	PROM1|PROM1||	CD133|CD133|CD133/2|CD133/1	Another important technical problem is that the authors instead of using for CD133 staining as VSELs: an update we recommended in our original protocols antibodies against CD133/1 epitope 100 employed not optimized for VSEL isolation an anti-CD133/2 eiptope antibody (clone: 293C3).
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:31895..32186:sentences:f58e2f8708028a90c7034b98c8071ac0	PTPRC|ATXN1	CD45|Sca-1	28 went a step further and tried to set up an entirely new protocol for isolation of murine VSELs, discounting our already published strategies, and eventually sorted a fraction distinctly different from very small CD45  /Lin  /Sca-1  cells, thus presumably losing the VSELs during isolation.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:32188..33153:sentences:596572ffed5b96c8a8146d089b66357e	ANXA5|KIT|ANXA5	Annexin V|c-kit|Annexin V	Using their de novo protocol, these authors 28 made several cardinal mistakes, including: (1) setting up an enlarged input gate on the forward scatter (FSC) vs side scatter (SSC) plot that, on one hand, included granulocytes and apoptotic cells, resulting in enrichment of sorted fractions with artifacts reflected in further analyses (for example, Annexin V binding) and, on the other hand, excluded some of the critical very small objects from further sorting (originally Figure 1A 28 and shown as Figure 2c in this article); (2) losing very small objects further by cutting them out during gating for 'singlets' (originally Figure 1A 28 and shown as Figure 2c in this article); (3) focusing on selection markers that were not proven to be expressed on VSELs (for example, c-kit); and (4) a selective focus on some populations and discarding other fractions (containing potentially VSELs) based on a superficial interpretation of results such as Annexin V binding.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:33155..33441:sentences:3245b955ad287e6d8f1dfc0ca74ea7eb	PTPRC|ATXN1|KIT|KDR|ANXA5	CD45|Sca-1|c-kit|KDR|Annexin V	28 For instance, the entire fraction of CD45  /Lin  /Sca-1  /c-kit  /KDR  was excluded by the authors from further sorting because it was deemed 'apoptotic' (Figure 2 28 ), although it most likely contained not only real Annexin V  /FSC low /SSC dim/hi apoptotic objects, but also VSELs.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:35932..36335:sentences:ad8da370bc664f0cfa6f5f65897e0c16	PTPRC|ATXN1	CD45|Sca-1	However, when it was already clear from their initial experiments (shown in the first and second dot plots in the 29 described and subsequently isolated large-size, Syto16-bright, CD45  /int /Lin  /Sca-1  murine cells as 'VSEL candidates' (lower left plot, blue box), whereas in our opinion, a visible population of smaller, Syto16-dim cells is the most likely VSEL population (lower left plot, red box).
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:36436..36640:sentences:494f5144d808b2e8e71b5ce7025e27f3	PTPRC|ATXN1	CD45|Sca-1	It is, for instance, visible in the CD45 hi /Lin  /Sca-1  population (lower right plot, green box), which is almost a half log unit brighter than the majority of FSC hi cells (lower right plot, black box).
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:36906..37402:sentences:cf4f7ee099d28180cba36e8c1db6590f	PTPRC|PTPRC|CD34|PROM1	CD45|CD45|CD34|CD133	(Dot plots were adopted from a paper by 27 in their recent studies focusing on human VSEL isolation, concluded that CD45  /Lin  / CD133  cells (which we consider in fact to be a population enriched in human VSELs) as well as CD45  /Lin  /CD34  cells do not exist in CB, whereas such cells are not only found in our samples (lower dot plots, VSELs marked with blue circles), but also in some CB samples ( 28 in their recent studies on VSELs tried to set up a new protocol for murine VSEL isolation.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:38238..38607:sentences:e8a4c386f7e338d1f236b952a995bd56	PTPRC|ATXN1	CD45|Sca-1	The left panel shows FlowSightderived brightfield images of CD45  /int /Lin  /Sca-1  /Sytox16  objects that were isolated as 'VSEL candidates' by Miyanishi et al.. 29 Despite the fact that these cells do not represent the VSEL population described by the Ratajczak group, the quality of images is too poor for accurate quantitative analyses, including size calculations.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:38917..39221:sentences:5bc8ee373ec7fced742d3419cd6f04d5	PTPRC|PTPRC|KIT|KIT	CD45|CD45|c-Kit|c-Kit	The histogram shows size analysis of CD45  Lin  Sca-1  c-Kit  cells, where objects 4-5 mm in size are unfortunately excluded from analysis (as indicated by the orange box), whereas the images are confusingly derived from the distinct CD45  Lin  Sca-1  c-Kit  cell fraction, which does not represent VSELs.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:39298..39594:sentences:eb3f828d434dd9e766118c5d4e69e7b9	PTPRC|ATXN1|PTPRC|ATXN1|ITGA2B	CD45|Sca-1|CD45|Sca-1|CD41	(Data were adopted from the paper by Szade . 28 The right panel shows representative images of murine VSELs (CD45  /Lin  /Sca-1  /7-AAD  cells), HSCs (CD45  /Lin  /Sca-1  /7-AAD  cells) and platelets (CD41  /7-AAD  objects) obtained with the ImageStream 100 system and used for VSEL size analysis.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:43163..44210:sentences:fb333bccba533ffe2b583b76225bb9ed	PTPRC|PTPRC|PROM1|CD34|PTPRC|PROM1|CD34	CD45|CD45|CD133|CD34|CD45|CD133|CD34	Although in our initial sorting protocols we used histograms visualizing, for example, CD45 expression for final separation of hematopoietic and non-hematopoietic cells, 14, 96 we gradually became aware that replacing such a histogram with dot plots (for example, CD45 vs SSC) was much more informative and gave a better gating set-up ( Figure 3) . Moreover, we found that rare cells such as human VSELs have been simply overlooked by other investigators using histograms showing expression of CD133 and CD34 in CD45  /Lin  human UCB samples, 27 although these very rare SCs would be clearly visible in the same samples and in the same analyses if, for instance, CD133 (or CD34) vs SSC dot plots are employed 97 (Figure 2b) . Importantly, we also exclude any contour plots from our sorting and analysis protocols, which were used by Miyanishi et al., 29 as in our opinion they flatten the view and do not provide complete information about low cell number clusters and the single-cell distribution when we focus on isolation of unique rare objects.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:44387..44939:sentences:b73ae84fbf83708c423674bb8b9967a5	PTPRC|ATXN1	CD45|Sca-1	Eventually, when gated properly, CD45  /Lin  /Sca-1  cells will 'come back' as a homogeneous population of small objects in a FSC vs SSC dot plot following back gating (Figure 3) . Importantly, our established protocol for murine VSEL isolation has already been successfully followed and fine-tuned by several laboratories and investigators, including groups in the United States, France, India, Japan and Poland, [16] [17] [18] [19] 21, 22, 88, 91, 103 a fact that was not appreciated by any of the investigators (Miyanishi et al., 29 Danova-Alt et al.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:48079..48560:sentences:598fea2690b88c0709fb2e79238ece75	PTPRC|ATXN1	CD45|Sca-1	96 (Figure 2d ) (major concern), (3) the CD45  /int /Lin  /Sca-1  /Sytox16 bri larger-cell population was analyzed excluding the Sytox16 dim fraction that resembled 'VSEL candidates' (major concern), (4) no information was provided about the analytical approach, including the type of masking or the features used for size calculation, (5) a small number of objects was analyzed and (6) the preparation of cells before analysis was different than in our previously reported studies.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:48957..49309:sentences:525518815d40163034234ebe9a68c4ca	PTPRC|ATXN1	CD45|Sca-1	29 Most importantly, in our opinion, an incorrect population was included in the analysis, and it would be much more valuable to investigate CD45  /int /Lin  /Sca-1  /Sytox16 dim cells based on their full images, including all stained marker populations, to evaluate both size and potential cell content for assessing the VSEL presence in this fraction.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:49870..49994:sentences:2f998237f83d35b3c926648acd0177d2	PTPRC|ATXN1|KIT	CD45|Sca-1|c-kit	Furthermore, the population they focused on as VSELs (CD45  /Lin  /Sca-1  /c-kit  ) was not comparable to our reported cells.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:49996..50265:sentences:fdf5bc4d9ee6df948935ae6cb2bd182d	PTPRC|ATXN1|KIT	CD45|Sca-1|c-kit	On the other hand, the authors carelessly excluded potentially crucial objects (4-5 mm in size based on their unknown masking and diameter measurements) from size analysis in the CD45  /Lin  /Sca-1  /c-kit  fraction, which could contain VSELs ( Figure S2 in Szade et al.
+SARS:09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8:fulltext:3d79e19c2d66f505adc683537c5f0340:51093..51398:sentences:6c64d11d0ebef5ceda21f430f50efb9a	PTPRC|ATXN1	CD45|Sca-1	Moreover, it was the first paper that clearly showed that the fraction of FSC low /SSC low /CD45  /Lin  /Sca-1  cells sorted by classical flow cytometry (fluorescence-activated cell sorting) may not only contain a great amount of debris and artifacts, but also include small cellular objects such as VSELs.
+SARS:0bdae8c38f570965cc9a630a44b7089c2a5da0ed:abstract:026599a79c1ba8a01b21f8a92e89db71:634..893:sentences:6db4183d1a6ec4186d9a80312a69a282	DLEU2|GDE1|MIR21|MIR34A	miR-15a|miR-16|miR-21|miR-34a	To delineate a mechanism of miRNAs in regulating PCV2-induced G0/G1 cell cycle arrest, we determined expression levels of some relevant miRNAs and found that only miR-15a but not miR-16, miR-21, and miR-34a was significantly changed in the PCV2-infected cells.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:0..752:sentences:a0524e03e2bc6c04dca58a51c32565bd	IL17A|IL17A|CD79A	IL-17A|IL-17A|IgA	. port neutrophil infiltration in inflammatory-disease models (10) (11) (12) (13) . Neutrophils play a central role in cell-mediated clearance of parasites and may be important in clearance of E. histolytica (14) . IgA was also implicated in protection against E. histolytica infection in a childhood cohort and thus may be involved in immunity against the parasite (15) . Given that IL-17A and downstream mediators are important in immunity to E. histolytica, components of the intestinal microbiota that elicit exogenous IL-17A in the absence of intestinal pathology might prove to be protective during amebiasis.. . Segmented filamentous bacteria (SFB), or "Candidatus Savagella," are genetically and morphologically unique members of the Clostridia.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:754..2455:sentences:e36d1d38a36a7bb07256fa64dc70ea03	IL17A|	IL-17A|SAA	They represent an uncultivable component of the mammalian intestinal microbiota, reported to colonize both humans and mice (16) (17) (18) . It has been demonstrated that SFB colonization induces a potent Th17 helper response in the intestine that is dependent on intestinal dendritic cells (19, 20) . SFB colonization is associated with higher intestinal levels of both IL-17A and the damage-associated molecular pattern molecule and antimicrobial peptide serum amyloid A (SAA) (20) . SFB infection influences many models of intestinal and extraintestinal inflammatory disease, suggesting that it may have a systemic influence on the immune response (21) (22) (23) . Indeed, a growing body of literature suggests that intestinal colonization with commensal microorganisms can have extraintestinal effects on dendritic-cell precursors that influence susceptibility to pathogens (24) (25) (26) . It is also quite possible that mediators induced by the intestinal microbiota in the serum might influence the bone marrow in such a way as to prime DCs to provide protection against, or exacerbate, enteropathogen infections (27, 28) .. . Bone marrow dendritic cells (BMDCs) are known to be able to recapitulate effector functions of some in vivo antigen-presentingcell populations, and lipopolysaccharide (LPS)-matured BMDCs have been effectively utilized in adoptive transfer experiments to examine the influence of dendritic cells in infection models (28) (29) (30) . Thus, to begin to examine the influence of changes in the microbiota on resistance to amebic infection, we utilized a murine model and BMDCs to explore what influence colonization with SFB had on intestinal infection with E. histolytica.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:3721..3902:sentences:8fbd2ff8c39478c77905769f5a57346d	IL17A|IL23A|	IL-17A|IL-23|SAA	Segmented filamentous bacteria specifically protect against E. histolytica and induce increased IL-17A, IL-23, neutrophils, and dendritic cells in the intestine and SAA in the blood.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:4474..4593:sentences:d4bc38e8f60a2bc8602402a2aebf88eb	IL17A|IL23A	IL-17A|IL-23	2B) . Additionally, there was increased IL-17A and IL-23 expression before ( onized mice after E. histolytica infection.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:4691..4823:sentences:9b798de72a54632f033042cfee38b13d	IL23A|	IL-23|SAA	BMDCs derived from SFB-colonized mice have an increased capacity to produce IL-23 that is partially recapitulated with SAA treatment.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:4825..5119:sentences:4a748a781ba7f693cfcfe570a14f0d2c	IL23A|IL17A||IL23A|KDM6B|IL23A	IL-23|IL-17A|SAA|IL-23|JMJD3|IL-23	IL-23 is a key cytokine in the generation and maintenance of IL-17A-producing cells (33) . SAA can directly induce IL-23 from both DCs and macrophages (20, 34) and is known to upregulate an epigenetic mediator, JMJD3 (33) , that specifically increases IL-23 production in a macrophage cell line.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:5121..5337:sentences:30209b340d5f9757876c1ae59521147a	IL23A|IL17A||IL23A	IL-23|IL-17A|SAA|IL-23	Thus, as SFB increased frequency of intestinal DCs, IL-23, IL-17A expression, and circulating serum SAA, we examined the capacity of bone marrow DCs from SFB-infected mice to produce IL-23 in response to trophozoites.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:6097..6222:sentences:a1a6a5c660bce57ac8fb617bbee73035	|IL23A	SAA|IL-23	We hypothesized that SAA induced in the serum by intestinal SFB colonization could influence BMDCs to produce increased IL-23.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:6224..6391:sentences:7cd8837054b3a14ae3a7c8f7d1aadb5f	|IL23A	SAA|IL-23	Therefore, we wanted to test if the presence of SAA during the differentiation of SFB-free BMDCs might alter them in such a way that they also would produce more IL-23.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:6470..6606:sentences:70e95bbb8b341916488a1d25e8fa8065	|IL23A	SAA|IL-23	Addition of SAA to BMDC culture from SFB-free mice partially recapitulated the increased IL-23 seen in BMDCs derived from SFB  mice (Fig.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:8646..9064:sentences:5209166578cba308f8e3330a315a1953	IL17A|IL23A|ERBB2	IL-17A|IL-23|neu	We have demonstrated that alteration of the microbiota via introduction of the commensal bacteria SFB impacts susceptibility to amebic infection in a murine model, likely via its impact on the mucosal immune system (36) . There was an increase in IL-17A and IL-23 expression in the intestines of SFB-colonized mice prior to and following amebic infection and a relative increase in neu- trophils after amebic infection.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:10125..10287:sentences:2a84c277b23481b4bc0a3cfaef49dc61	IL23A|	IL-23|SAA	However, this response was not specific to E. histolytica, as increased IL-23 production from SFB  BMDCs was also seen with LPS and SAA treatment (data not shown).
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:12214..12396:sentences:b6df16cf90680c1547c201716bb53680	KDM6B|IL23A||	Jmjd3|IL-23|SAA|SAA	SAA-dependent induction of Jmjd3-mediated epigenetic regulation of inflammatory cytokine gene expression has also been described (33) , including IL-23, in SAA-stimulated macrophages.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:12398..12770:sentences:2f16b8fb21f8a1d8bc3789f0967619ef	|IL23A||IL23A	SAA|IL-23|SAA|IL-23	It is thus not hard to imagine that circulating SAA might act on bone marrow cells to alter IL-23 induction via epigenetic mechanisms (33) . Indeed, we cultured BMDCs from SFB  mice in the presence of SAA for the first 4 days of culture and then removed the mediator, and the resulting differentiated BMDCs produced significantly more IL-23 than BMDCs from SFB  mice alone.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:13086..13422:sentences:a6b7bd3b359fca78a813ccd5e8c26fa6	|IL17A|CD79A	SAA|IL-17A|IgA	We propose a model in which intestinal colonization with SFB leads to induction of systemically circulating me-diators, perhaps including SAA, that alter bone marrow dendriticcell precursors so that they provide protection against E. histolytica via induction of downstream effectors, which may include IL-17A, neutrophils, and IgA (Fig.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:16265..16520:sentences:22b0969c68d84cf23ec9b391ad6bd2ff	|IL23A||	S14|IL-23p19|S14|S14	Cytokines were measured via qPCR with Sybr green, and data were normalized to expression of S14: IL-23p19F, 5=-GACCCACAAGGACTCAA GGA-3=; IL-23p19 R, 5=-CATGGGGCTATCAGGGAGTA-3=; S14 F, 5=-T GGTGTCTGCCACATCTTTGCATC-3=; S14 R, 5=-AGTCACTCGGCAG ATGGTTTCCTT-3=.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:16522..16707:sentences:ec73031f23fe83bca6a2e83cc184b8f8	IL17A|IL23A	IL-17A|IL-23	Melting temperatures were 60C for EUB, SFB, IL-17A, and IL-23 and for E. histolytica (44) . Primers and probes were purchased from Integrated DNA Technologies, Coralville, IA, USA.. SFB.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:16993..17386:sentences:1a8feaade424cfce6ee68cb5a605eb05	CSF2|CSF2|IL23A	granulocyte-macrophage colony-stimulating factor|GM-CSF|IL-23	Cells were cultured in RPMI with 10% FBS supplemented on days 0 and 3 with granulocyte-macrophage colony-stimulating factor (GM-CSF) (10 ng/ml; Peprotech) and harvested on day 6. For in vitro experiments, 2.5  10 5 cells were plated per well of a flat-bottom 96-well dish and treated with trophozoites for 24 h. Cytokines in the supernatants were determined by ELISA (IL-23; R&D Systems).. SFB.
+SARS:0afa3ea846396533c7ca515968abcfea3f895082:fulltext:f7fe4db8bdf3a161fb6d5c671fec5088:18368..18550:sentences:e2e26ccde5899ae792091f9721084c3e	FCGR3B|FCGR2B|PTPRC	CD16|CD32|CD45	A total of 1  10 6 cells were incubated with CD16/CD32 MAb (BD Biosciences) to block Fc binding, followed by staining with CD11V-BV421, MHCII-FITC, TCR-beta-APC, B220-APC, CD45.2-APC,
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:14..1252:sentences:71fe1706a6c6f944fe0dc3c32806a636	SLPI|SLPI|CD4|CCR5|CXCR4|ITIH4|CD4	SLPI|SLPI|CD4|CCR5|CXCR4|gp120|CD4	Secretory leukocyte protease inhibitor (SLPI), originally identified as a serine protease inhibitor at portals of pathogen entry and in mucosal fluids (1) , has more recently been associated with multiple functions relevant to innate host defense (2) (3) (4) (5) (6) (7) (8) (9) . One of the first novel non-antiprotease functions identified for SLPI was its ability to inhibit HIV-1 infection of macrophages, which appeared to be effected through interaction with unidentified host cell molecules and not the virus (2, 3) . In addition to CD4, macrophages express CCR5 and CXCR4 that function as HIV-1 envelope gp120 coreceptors (10) , and once colonized by HIV-1, can function as stable reservoirs of the virus, thereby facilitating transmission of HIV-1 to CD4  lymphocytes (11, 12) . Persistent evidence favors the existence of additional cofactors for binding and/or entry of HIV-1, including components of the host cell membrane acquired during viral budding (13) . Among these host-derived constituents in the viral envelope is the phospholipid, phosphatidylserine (PS; reference 14) , which predicts a potential interactive molecule on the receptive host cell that may facilitate virus binding, entry, and/or fusion.. Introduction.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:1358..2482:sentences:81317e9d17c0af83a9f7ef3cca1bb096	SLPI|SLPI|ANXA2|ANXA2|ANXA2|ANXA2|ANXA2|ANXA2|SLPI|S100A10	SLPI|SLPI|annexin II|Annexin II|annexin II|p36|p36|annexin II|SLPI|p11	To decipher the mechanisms by which SLPI regulates target cell functions independent of protease inhibition, we searched for a membrane-binding protein/receptor for SLPI on mononuclear phagocytes that are susceptible to its antiinflammatory and antiviral activities (2) (3) (4) (6) (7) (8) . In this study, we document that SLPI binding to the macrophage cell membrane involves annexin II. Annexin II is a member of the larger annexin gene family and contains a variable NH 2 -terminal tail, a COOH-terminal region with heparin and plasminogen-binding sites, and the core domain, which includes binding sites for Ca 2  , phospholipids, and F-actin (15) (16) (17) (18) . Characterized by a highly conserved set of  -helical repeats that mediate membrane binding, annexin II exists as a monomer (p36) or a heterotetramer constructed of two p36 and two p11(S100A10) subunits, and traffics to the cell surface by an unknown mechanism (18) . Although implicated in exocytosis and endocytosis pathways, as well as in ion channel activity and stimulation of DNA replication (17) , annexin II has not previously been linked to HIV-1.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:2484..2809:sentences:10f245b15d4680824c257e32f51f976a	ANXA2|ANXA2|SLPI	annexin II|annexin II|SLPI	Nonetheless, annexin II has recently been identified as a receptor for CMV (19) and respiratory syncytial virus (20) , prompting our exploration of a potential role for annexin II in HIV-1 infection and as a conduit for inhibition by SLPI and/or other targeted interventions in the battle against AIDS.. Materials and Methods.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:12806..13015:sentences:04e6b5854c0b11bf76cf0f67217e7467	ANXA2|SLPI	annexin II|SLPI	For cell-binding experiments, macrophages were treated with anti-annexin II, control antibody, or SLPI for 30 min, washed, and virus was added for 30 min at 37  C. The cells were washed extensively, lysed (0.5%
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:13457..13807:sentences:081391b1ec17e7a52dc732a600889fb5	ITIH4|ANXA2	gp120|annexin II	96-well plates (Nunc immunoplates with maxiSorp surface; Nunc) were coated with 60 g/ml BSA (Sigma-Aldrich), annexin II tetramer, IgG, or gp120 (NIH AIDS Research and Reference Reagent Program) overnight at 4  C, washed with PBS, and blocked or not with 1% BSA for 1-2 h. After two PBS washes, 100 l HIV-1 BaL (10 4 /ml) was added for 1 h at 4  C (3).
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:16758..17341:sentences:e15334df15ca14d4932d2815101a4d28	ANXA2|ANXA2|ANXA2|ANXA2|SLPI|SLPI	Annexin II|annexin II|annexin II|annexin II|SLPI|SLPI	Annexin II was confirmed with monoclonal anti-annexin II and rhSLPI coimmunoprecipitation followed by Western blotting (Fig.  2, B and C) . The p42 SLPI-binding protein band was identified by mass spectrometry as actin, which we determined does not interact with rhSLPI directly, but rather associates with annexin II as part of a trimolecular complex (not depicted).. SLPI Membrane Binding.. The detected binding between annexin II and rhSLPI was typically higher on differentiated macrophages than on freshly isolated blood monocytes or an undifferentiated monocytic cell line (Fig.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:17615..17811:sentences:48cd5ff16429d8e020c6e7355c676589	ANXA2|CD4|CD14|CD4	annexin II|CD4|CD14|CD4	2 C,  A431) . Importantly, assessment of annexin II on CD4  blood mononuclear cells revealed differential membrane expression between freshly isolated resting CD4  T cells and CD14  monocytes (Fig.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:17813..17984:sentences:ca214101750ca5255c0fbdeee9d31f33	ANXA2|CD4|ANXA2	annexin II|CD4|annexin II	3, B and C) . The absence of fluorescence staining of annexin II on CD4  T cells was confirmed by their lack of detectable annexin II membrane protein by Western blot (Fig.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:17986..18205:sentences:b5cec3402ba7c872bf61e75c79f2d0dd	ANXA2|ANXA2|SLPI|SLPI	annexin II|Annexin II|SLPI|SLPI	3 D) . Collectively, these data identify mononuclear phagocytes as the predominant population expressing the SLPI membrane-binding protein, annexin II.. SLPI Membrane Binding.. Annexin II Is a Cofactor for HIV Infection.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:18207..18479:sentences:c4af5a06e3d9f748bdc5c889d3f0d53b	SLPI|ANXA2|ANXA2|ANXA2	SLPI|annexin II|annexin II|annexin II	Based on the link between SLPI, a known antagonist of HIV-1 infection (2, 3) , and annexin II, we attempted to abort infection by directly blocking annexin II. A single treatment of adherent macrophages with an antibody targeting the NH 2 -terminal tail of annexin II (Fig.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:19373..19571:sentences:31017c358c43618a7b39b74b24003405	ANXA2|CD4|CCR5|ANXA2	annexin II|CD4|CCR5|annexin II	Furthermore, to establish that the suppression of viral infection was specific to annexin II levels, we monitored the macrophages treated with annexin II RNAi for CD4 and CCR5 expression in parallel.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:19610..20200:sentences:e5a45c08ccf774a9d85c6400eabbfac8	ANXA2|ANXA2|ANXA2|SLPI	annexin II|annexin II|annexin II|SLPI	4 D) and by flow cytometry (not depicted), no substantive change in these essential viral recognition and binding receptors was evident, consistent with a contributing role for annexin II in the macrophage infection process.. SLPI Membrane Binding.. To determine whether annexin II played a role in infection of macrophages by viral isolates other than the laboratory-adapted BaL strain, macrophages were treated with an antibody to annexin II at the time of infection with two additional laboratory-adapted M tropic isolates (ADA and JRCSF) and a primary clinical isolate (Clade B 92US712).
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:20484..20600:sentences:5376bfc333b2504c5f3060fe99836e24	ANXA2|CD4	annexin II|CD4	Moreover, in CD4  T cell infection with IIIB, antibodies to annexin II were not effective in blocking the virus (Fig.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:20913..21074:sentences:b8687f54e1198476730e27dfdcd519ea	ANXA2|ANXA2|SLPI	annexin II|Annexin II|SLPI	Thus, annexin II appears to selectively contribute to the pathway by which HIV-1 infects human macrophages.. SLPI Membrane Binding.. Annexin II Interacts with PS.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:21899..22027:sentences:8c1af5b986c244911d9ffdca70230afa	CD4|CD14|ANXA2|CD4	CD4|CD14|annexin II|CD4	(B and C) By flow cytometry, purified CD4  CD14  monocytes expressed surface annexin II, with minimal expression on CD4  T cells.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:22304..22489:sentences:0495ce95be282759a316574af93942eb	ANXA5|ANXA2|SLPI	annexin V|Annexin II|SLPI	5 B) , compatible with inhibition of infection by soluble annexin V and/or PS vesicles (14) .. SLPI Membrane Binding.. Annexin II Is Associated with Entry/Fusion of HIV-1 in Macrophages.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:22595..22725:sentences:b50f622dc909911be303cacbd0fba9a5	SLPI|ANXA2	SLPI|annexin II	Consistent with SLPI (2, 3), blockade of annexin II on macrophages did not significantly interrupt HIV-1 binding to the cells (Fig.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:22727..22803:sentences:3ab97614d6cb8c68e38b6964970f92c1	CD4|CCR5	CD4|CCR5	5 C) , likely dissociating it from a direct interaction with CD4 and/or CCR5.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:22805..23214:sentences:604d1b3aa8eacc2446e2e73151b7c2a9	ANXA2||CD4|ANXA2||CD4	annexin II|Env|CD4|annexin II|Env|CD4	In confirmatory studies, anti-annexin II was incorporated into a fusion assay in which effector cells expressing recombinant Env, but lacking viral PS, were cocultured with target cells expressing recombinant CD4 and coreceptors (23) . In the absence of PS, anti-annexin II was ineffective in interrupting this fusion process (not depicted), ruling out a specific interaction with Env, CD4, and/or coreceptors.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:24597..24739:sentences:be0fed69402eaa417316340ebd7cccb1	SLPI|	SLPI|p24	(B) Macrophages, treated or not with anti-annexin, IgG, or SLPI for 60 min, were infected with HIV-1 and 14-d supernatants were tested for p24.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:25156..25276:sentences:5961afd9f282ec6a81d825f697b08c14	ANXA2|CD4|CCR5	annexin II|CD4|CCR5	(D) Macrophages treated with siRNA as indicated in C were analyzed for annexin II, CD4, and CCR5 protein by Western blot.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:25278..25661:sentences:a91a1502c25fb5a6cf206a89cd966309	ANXA2||ANXA2	annexin II|p24|annexin II	(E) Macrophages were treated with anti-annexin II, infected with HIV-1 JRCSF (JRC; TCID50  250/ml), ADA (TCID50  10,000/ml), or primary isolate Clade B 92US712 (TCID50  1,000/ml), washed, and cultured, with supernatants collected for p24 ELISA every 2-3 d for 12 d. (F) PHA-blasted T cells were treated with anti-annexin II or isotype IgG before infection with T cell tropic HIV IIIB.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:25694..25928:sentences:e5f742420ef2c82dfd5018b4a75bfeca	SLPI|ANXA2	SLPI|annexin II	life cycle after HIV-1 binding but before reverse transcription, as shown for SLPI (3), macrophages were infected with or without annexin II inhibitors and the formation of nascent viral DNA was assessed using a nested PCR-based assay.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:26448..26693:sentences:9ab78586be186a142e3aa1744ba3f76b	ANXA2|SLPI	annexin II|SLPI	In this study, we identify annexin II as a novel macrophage membrane-binding protein for the innate host defense protein, SLPI, by multiple parameters including im-munoprecipitation, mass spectrometry, peptide sequencing, and binding specificity.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:26695..26855:sentences:59e9762459acf216277286beffb2271d	ANXA2|SLPI	annexin II|SLPI	Striking was the ability of inhibitors of annexin II to mimic the kinetics and apparent mechanism of HIV-1 suppression by SLPI, denoting a shared site of action.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:26857..26991:sentences:68f08439e26b71192735e4c65694666f	SLPI|ANXA2	SLPI|annexin II	Although not ruling out additional binding targets for SLPI, annexin II appears to be significant in mediating its anti-HIV-1 activity.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:26993..27448:sentences:38f8fd64b073b4018e40059c6995d834	CD4|CCR5|ITIH4	CD4|CCR5|gp120	Subsequent to binding of HIV-1 to the canonical receptors, CD4 and CCR5, HIV-1 fuses with the host cell membrane that might be facilitated by viral envelope PS (14) . PS is not encoded by HIV-1, but rather is acquired from its host cell membrane as it exits the cells (26) . During viral assembly at the cell surface or within cytoplasmic vesicles, cell membrane components become incorporated into the new viral coat along with virally encoded gp120/gp41.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:28259..28398:sentences:268917cd706eda9e4dc6ed41cfe2d7cd	SLPI|ANXA2	SLPI|annexin II	(C) After treatment with anti-annexin II (Ann II), IgG, or SLPI for 30 min, macrophages were washed and HIV BaL was added for 30 min at 37C.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:29136..29466:sentences:0757e2f8a764271e6a427b36faf251e4	ANXA2|ANXA2|SLPI|ANXA2	annexin II|annexin II|SLPI|annexin II	consistent with our observations that neither soluble annexin II, RNAi, anti-annexin II, nor the annexin II ligand, SLPI, blocks HIV-1 binding, but rather inhibit postbinding and pre-reverse transcription, a point in the viral life cycle consistent with a proposed role for annexin II as a cellular fusogenic cofactor.. Discussion.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:29739..30169:sentences:a11e83636059af51fc68c89e07d579fb	ANXA2|ITIH4|CD4|ANXA2	annexin II|gp120|CD4|annexin II	Our data favor a model in which PS in the viral coat interacts with annexin II on the surface of macrophages subsequent to recognitionspecific gp120 interactions with CD4 and the chemokine coreceptors that instigate coiled coil exposure of gp41 fusion domains to interact with the lipid bilayer of the target cell (10, 30) , and then engage an annexin II-dependent fusion/entry pathway leading to productive infection.. Discussion.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:31133..31354:sentences:43f1ebd5e357c7807a7c29a0487dfdb8	ANXA2|ELANE	Annexin II|neutrophil elastase	Annexin II may represent one of multiple potential cofactors, such as syndecan and human neutrophil elastase (31, 32) , which independently or collaboratively might be usurped by HIV-1 to facilitate the infectious process.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:31646..31848:sentences:75dee56e4cd2449c370ecaa1064e0383	ANXA2|PTK2B	Annexin II|Pyk-2	Annexin II can be phosphorylated at key residues by several kinases, including the src oncogene (17) and Pyk-2 (15), a tyrosine kinase activated by HIV-1 (33, 34) , but such a pathway awaits delineation.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:31850..32136:sentences:83e836e7c3395fc95f27f4ac862ab014	SLPI|ANXA2|SLPI	SLPI|annexin II|SLPI	Although less persuasive due to the temporal association of SLPI/anti-annexin II inhibition with preintegration events, SLPI may also influence NF-B activation and/or proteasome inhibition (6, 8) , both of which are requisite in an optimal infection process (35) (36) (37) .. Discussion.
+SARS:0994b9aa851f17dc1c6af309973fe189118ab6c5:fulltext:acc509a12cdb807e95afdad4112f0d43:35030..35336:sentences:6ea67bafa6de9cd3307e1cb1af01146d	ANXA2|SLPI|ANXA2|ANXA2	annexin II|SLPI|annexin II|annexin II	In this regard, annexin II, a host cell molecule that the virus has appropriated for easing its entrance into the host cell, represents a likely candidate, and SLPI, an endogenous ligand for annexin II, or other annexin II-specific blockades, may represent a therapeutic impediment to the infection process.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:14..537:sentences:e6b0c2ca97f27425868a1894630ce419	FOXP3|NRP1|NRP1|IL2RB|IL2RA|CD4	Foxp3|neuropilin 1|Nrp-1|IL-2 receptor|CD25|CD4	Regulatory T cells (Treg) which express the Foxp3 transcription factor, neuropilin 1 (Nrp-1) and the IL-2 receptor (CD25) comprise ~10% of CD4 + T cells in the nave animal and play an essential role in regulating the immune response to infection, progression of clinical disease and tissue damage (Langier et al., 2010; Lourenco and La Cava, 2011; Rouse et al., 2006; Rowe et al., 2012) . During viral infection the host is challenged to mount an effective anti-viral immune response while minimizing immune mediated damage.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:539..816:sentences:fd52c09ee599188eb23f6b8a5ebbb1fd	FOXP3|IL10|FOXP3|FOXP3	Foxp3|IL-10|Foxp3|Foxp3	Exuberant T cell effector function and tissue damage are regulated by sustained natural Treg (nTreg), induction of antigen specific Foxp3 + Treg (iTreg), secretion of the anti-inflammatory cytokine IL-10 by both Foxp3 + and Foxp3  T cells, as well as inhibitory ligand receptor.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:2678..3675:sentences:73595c1280cd481bb15d8cc2e57d26e4	IL2RA|IL2RA|CD4	CD25|CD25|CD4	Depletion and/or functional inactivation of CD25 + Treg did not affect CNS inflammation or TMEV replication in mice resistant to chronic infection (Richards et al., 2011) . The identical depletion strategy resulted in both enhanced inflammation and control of TMEV replication in the CNS of mice susceptible to chronic infection (Richards et al., 2011) . By contrast, Treg depletion prior to acute infection with a neuronotropic MHV, which also produces chronic demyelination, did not alter CNS inflammation or virus specific T cell responses (Cervantes-Barragan et al., 2012) . Following CNS infection with an MHV variant containing a mutation in the immunodominant CD4 + T cell epitope which ameliorates disease, anti-CD25 mediated Treg depletion increased both morbidity and mortality (Anghelina et al., 2009) . A beneficial role of Treg was also supported by adoptive transfer of nTreg at a time when CNS infection by a sub-lethal, glial tropic JHM strain of MHV (JHMV) was already established.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:3949..4255:sentences:acae26a607ca7ae81b6ae6a912495d02	IL2RA|IL2RA|IL10	CD25|CD25|IL-10	To better define the role of CD25 + Treg early during JHMV induced encephalomyelitis and potential consequences on the chronic infection associated with sustained demyelination, the present study examined depletion/functional inactivation of CD25 + cells in wild type (WT) and syngeneic IL-10 reporter mice.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:4452..4601:sentences:e2c6c28f021569fd2efea26b42610786	IL2RA|CD8A|CD4	CD25|CD8|CD4	The absence of CD25 + CD4 + T cells did not influence the composition or extent of the CNS inflammatory cells, including virus-specific CD8 + T cells.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:5148..5427:sentences:caa6b29455f946dc2afb0b2a261b34ff	IL2RA|NRP1|NRP1|IL2RA|IL2RA|FOXP3|CD4	CD25|Nrp-1|Nrp-1|CD25|CD25|Foxp3|CD4	Kinetics of CD25 + Nrp-1 hi nTreg and Nrp-1 low iTreg accumulation in the CNS Prior to initiating anti-CD25 monoclonal antibody (mAb) treatment the kinetics and relative composition of CD25 + and Foxp3 + CD4 + T cells recruited into the CNS were assessed following JHMV infection.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:5429..5533:sentences:ea6beff27925ffbc4aa243b3a4f7cbbb	IL2RA|FOXP3|CD4	CD25|Foxp3|CD4	CNS accumulation of CD25 + and Foxp3 + CD4 + T cells followed similar patterns throughout infection (Fig.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:5535..5677:sentences:2289f06aee1b8cf1fc94bd62d680dc08	IL2RA|CD4|FOXP3|CD4	CD25|CD4|Foxp3|CD4	1A) . Total numbers of both CD25 + CD4 + and Foxp3 + T cells peaked at day 7 post infection (p.i.) comprising ~20% of total CD4 + T cells (Fig.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:5778..5843:sentences:e95a5e04937a8f0f12a2e66903dd2638	IL2RA|FOXP3	CD25|Foxp3	Importantly, > 75% of CD25 + cells expressed Foxp3 + at day 7 p.i.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:5845..5936:sentences:e7e673454ba7c6773157d973469b973e	IL2RA|CD4	CD25|CD4	indicating a minority of ~25% non Treg CD4 + effector cells expressed CD25 ( Fig. 1A and D).
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:5938..6132:sentences:e7d76a716e93f06747eba3388bf77c5e	FOXP3|IL2RA	Foxp3|CD25	These data show that the vast majority of the Foxp3 + population expressed CD25 ( Fig. 1A and D) and this proportion remained stable at 75-80% throughout the infection ( Fig. 1A and D).. Results.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:6134..6437:sentences:d60aa234cc4c7091659ca95eeb8c0538	IL2RA|NRP1|NRP1|FOXP3	CD25|Nrp-1|Nrp-1|Foxp3	To distinguish a phenotypic transition of Treg populations, possibly accompanied by differential expression of CD25, nTregs were identified based on high Nrp-1 expression Yadav et al., 2012) . At day 7 p.i., Nrp-1 hi nTreg represented the majority (~75%) of Foxp3 + Treg within the CNS ( Fig. 2A and B ).
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:6684..6751:sentences:0cf22e07ec8c306e8c7d555fd1a74864	IL2RA|NRP1	CD25|Nrp-1	1D ), CD25 expression remained stable at ~75% on both Nrp-1 hi (Fig.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:6753..6927:sentences:2d31eed6c20b8f1bb5f7a01365ced291	NRP1|IL2RA|FOXP3|IL2RA	Nrp-1|CD25|Foxp3|CD25	2C ) and Nrp-1 low Treg during the course of infection ( Fig. 2C and D) . These data predicted that the majority of CD25 + Foxp3 + Treg are susceptible to anti-CD25 treatment.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:6929..7174:sentences:383c5767c9b335b1c2a6131fbc3dadb0	IL2RA|NRP1|IL2RA|IL2RA	CD25|Nrp-1|CD25|CD25	Moreover, CD25 treatment at early times during infection was anticipated to primarily target prevailing Nrp-1 hi Treg and only a minor population of CD25 + effector T cells.. Early CD25 + T cell depletion does not alter morbidity or inflammation.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:7955..8178:sentences:7037476cc5d4fcbf4beae0716b8c623e	IL2RA|IL2RA|CD4|IL2RA	CD25|CD25|CD4|CD25	Anti-CD25 mAb eliminated essentially all CD25 + T cells from the cervical lymph nodes (CLN) at least until day 14 p. i.; a small percentage of CD4 + CD25 + T cells, representing ~15% of control levels, emerged by day 21 p.i.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:8198..8366:sentences:4a1d833f669d7e53d5fc0e075abdae21	IL2RA|CD4	CD25|CD4	Flow cytometric analysis of CD4 + T cells recruited into the CNS indicated the anti-CD25 treatment was also effective at the site of infection at least until day 14 p.i.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:8385..8595:sentences:e1d9ca7404061da24001b581c01899bd	IL2RA|CD4|IL2RA|IL2RA|CD4	CD25|CD4|CD25|CD25|CD4	At day 21 p.i., the frequency of CD25 + CD4 + cells within the CNS of the anti-CD25 treated group, returned to control levels, suggesting accumulation of CD25 + CD4 + T cells from the reemerging peripheral pool.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:8597..8829:sentences:3b5ecd62448d18c95bde10192b78db42	PTPRC|ITGAM|IL2RA	CD45|CD11b|CD25	Neither total numbers of CD45 hi inflammatory cells nor CD11b + macrophages recruited into the CNS were altered in the anti-CD25 treated group compared to controls ( Fig. 4A and B), consistent with the similarity in clinical disease.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:8831..8914:sentences:c187445d5181eab583e553d75524d9ee	IL2RA|CD4	CD25|CD4	Although CD25 + T cells comprise up to 30% of CD4 + T cells in the CNS at day 7 p.i.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:10739..11157:sentences:e34d2a455ee9b1497b82be54d5b45ba7	IFNA1|IFNA1|IL2RA|CD8A|IFNA1	IFN-|IFN-|CD25|CD8|IFN-	T cell mediated cytolytic activity and IFN- are the primary immune effectors controlling JHMV replication within the CNS (Bergmann et al., 2006) and Treg depletion enhances CD8 + T cell number and activity (Dietze et al., 2011; Haeryfar et al., 2005) . Comparison of anti-CD25 treated and control mice indicated no affect on CNS IFN- mRNA levels or frequencies of virus-specific T cells secreting IFN- (data not shown).
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:11629..11868:sentences:a0bf07d43f18bcfde9608f85ab1c2457	IL10|CD8A|CD4|IL2RA|CD8A|CD4	IL-10|CD8|CD4|CD25|CD8|CD4	During influenza virus infection of the lung, highly cytolytic IL-10 producing CD8 + T cells are dependent upon CD4 + T cells (Sun et al., 2011) , suggesting a possible influence of CD4 + CD25 + T cells on CD8 + T cell function during JHMV.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:11870..12017:sentences:3e4d648ed1aa99b62a16033c11bd4a95	IL10|CD8A|CD8A	IL-10|CD8|CD8	Furthermore, an IL-10 + CD8 + T cell population constituting ~25% of virus-specific CD8 + T cells resides within the JHMV infected CNS at day 7 p.i.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:12019..12274:sentences:d458895c8133144e8e3b6e081ad05761	IL10|IL10|IL2RA|CD8A|CD8A	IL-10|IL-10|CD25|CD8|CD8	(Puntambekar et al., 2011) , comprising CD8 + T cells with high cytolytic potential (Trandem et al., 2011a) . Anti-CD25 treated and control IL-10 reporter mice were therefore infected to examine the possibility of diminished IL-10 + effector CD8 + T cells.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:12276..12457:sentences:a34244ccbd4ab6360f31e904366ea840	IL2RA|IL2RA|IL10|CD4	CD25|CD25|IL-10|CD4	Similar to WT mice, anti-CD25 mAb treatment was effective at eliminating CD25 + CD4 + T cells from the CNS of infected IL-10 reporter mice until at least day 14 p.i (data not shown).
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:12459..12625:sentences:1d2f1a254085387c283e179ecaa2bd90	IL2RA|IL10|CD4	CD25|IL-10|CD4	Anti-CD25 treatment reduced the frequency of IL-10 + CD4 + T cells by ~30% at day 7 p.i.; however, the population returned to WT levels by day 10 p.i (data not shown).
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:12627..12818:sentences:efd86566da5489d04c08bbfba6eed687	CD8A|IL10|CD4	CD8|IL-10|CD4	In contrast to the CD4 + T cell population, virus specific CD8 + IL-10 + were slightly reduced at both days 7 and 10 p.i.; however, these decreases also did not reach statistical significance.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:13064..13161:sentences:4be71b0a9fa35601f7516cf1c966a378	IL2RA|CD8A	CD25|CD8	5A) , cytolytic activity by CNS derived CD8 + T cells was not altered by anti-CD25 treatment (Fig.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:13275..13543:sentences:977fcaab0b9ed8a772468c9b5c489e42	IL2RA|CD8A|CD4	CD25|CD8|CD4	(data not shown), consistent with previous results (Bergmann et al., 1999) . Thus the transiently increased viral load in the absence of CD25 + CD4 + T cells could not be correlated with either reduced IFN, virus-specific CD8 + T cell recruitment or cytolytic activity.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:13545..13866:sentences:6e248ad45e656ae4a5557491f4286f14	IL2RA|IL2RA|CD4	CD25|CD25|CD4	Transiently decreased antiviral activity may thus be due to insufficient help provided by CD25 + CD4 + T cells or induction of inhibitory molecules (Phares et al., 2009) , neither of which would be directly reflected by in vitro analysis.. Early CD25 + T cell depletion does not alter persistence but limits demyelination.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:13868..14095:sentences:68d44bcc22febeb07309f17b7b3cca4e	IL2RA|CD4|IL2RA	CD25|CD4|CD25	A number of chronic viral infections are associated with CD25 + CD4 + Treg (Belkaid, 2007; Rowe et al., 2012) . However, no clinical or virological evidence for viral recrudescence was found in the anti-CD25 treated group (Figs.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:14713..15084:sentences:e33e0d17f50ffb8a41a3257672275d89	IL2RA|IL2RA|CD4	CD25|CD25|CD4	6A) , the predominant site of JHMV persistence (Bergmann et al., 2006; Marten et al., 2000) . These results indicate that diminished viral control during the acute phase of coronavirus mediated encephalomyelitis in the absence of CD25 + CD4 + T cells did not facilitate viral persistence.. Early CD25 + T cell depletion does not alter persistence but limits demyelination.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:15086..15447:sentences:03de0743cac41a701bad75acba9e7525	IL2RA|IL2RA|CD4	CD25|CD25|CD4	The transient decrease in control of CNS viral replication, decreased demyelination mediated by nTreg adoptive transfer in a similar model of JHMV infection (Trandem et al., 2010) and the delayed onset of demyelination in anti-CD25 treated TMEV infected mice (Richards et al., 2011) suggested that CD25 + CD4 + T cells might influence JHMV induced tissue damage.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:16731..17018:sentences:4f4fe16646ba6da9e6fddf259d015635	IL2RA|IL2RA|CD4	CD25|CD25|CD4	6C) . However, the extent of demyelination was increased in the spinal cords of the CD25 deficient mice at days 14 and 21 p.i ( Fig. 6B and C) . These data support the notion that the early events of viral induced tissue damage within the CNS are not regulated by CD25 + CD4 + Treg cells.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:19729..20165:sentences:6f81ac487b18cd292b0c066de451137a	IL2RA|IL2RA|CD8A	IL-2R|CD25|CD8	Inhibition of IL-2-IL/IL-2R interactions may explain the limited inflammation in some viral infections (Fulton et al., 2010; Ruckwardt et al., 2009) , but it has no effect on inflammation in others (Betts et al., 2011) . In addition, anti-CD25 treatment increases CD8 + T cells responses under some, but not all circumstances (Betts et al., 2011; Dietze et al., 2011; Fulton et al., 2010; Haeryfar et al., 2005; Ruckwardt et al., 2009 ).
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:20167..20581:sentences:e14fd8b62658f58ebdeb3ff26bf79550	IL2RA|IL10|IL2RA|CD4|CD4	CD25|IL-10|CD25|CD4|CD4	Both CD25 + CD4 + T cells and CD4 + IL-10 + T cells are rapidly recruited into the JHMV infected CNS (Anghelina et al., 2009; Puntambekar et al., 2011) . However, both virus control and inflammation are Treg independent following infection with a related MHV (Cervantes- Barragan et al., 2012) . Therefore, it was not surprising that anti-CD25 treatment did not alter recruitment of inflammatory cells into the CNS.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:20993..21210:sentences:8a1c74bef5d8bfd858353426c17b64b1	CD274|IL10	PD-L1|IL-10	Programmed death-1 ligand (PD-L1), as well as the anti-inflammatory cytokine IL-10 influence JHMV pathogenesis (Phares et al., 2010; Trandem et al., 2011b) potentially exhibiting more potent regional effects than Treg.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:21212..21801:sentences:fc1c61a733bad06c5baabdb28c83dcd3	IL10|IL10|IL2RA|IL10|IL2RA|IL2RA|CD4|CD4	IL-10|IL-10|CD25|IL-10|CD25|CD25|CD4|CD4	For example, JHMV infection of IL-10 deficient mice demonstrated accelerated viral clearance, yet dramatically enhanced tissue destruction (Trandem et al., 2011a) . During JHMV infection IL-10 secretion within the CNS is limited to the T cell compartment with CD25 + IL-10 + CD4 + T cells, characteristic of nTreg, rapidly recruited into the CNS (Puntambekar et al., 2011) . The absence of a suppressive effect suggested by anti-CD25 treatment may reside in the rapid replacement of this population by CD25  IL-10 + CD4 + T cells (Puntambekar et al., 2011) , or the loss of CD25 expression.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:21803..22354:sentences:93574956f884a047a15bda188d829704	FOXP3|IL10|IL27|IL2RA|IL2RA|FOXP3|FOXP3|CD4	Foxp3|IL-10|IL-27|CD25|CD25|Foxp3|Foxp3|CD4	Although the precise phenotype of the CD25  IL-10 + CD4 + T cell population is unclear, it is possible it comprises virus-specific Foxp3 + Treg (Zhao et al., 2012) or virus-specific IL-10 + Foxp3  cells regulated by IL-27 (Wojno and Hunter, 2012) . Interestingly, ~5% of Treg infiltrating the CNS during JHMV infection are virus-specific (Zhao et al., 2011) . As CD25 expression was not assessed on this population, our data cannot exclude that enrichment of this population in the CD25  Foxp3 + subset may contribute to JHMV pathogenesis.. Discussion.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:22356..22525:sentences:17dae9d999db1476829d95776c3a2fcc	IL2RA|CD4	CD25|CD4	Control of CNS virus replication was partially inhibited at the peak of replication, suggesting that CD25 + CD4 + T cells enhanced the initial phase of adaptive immunity.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:22527..22776:sentences:272e0974cdb43e222e65e32e4106ba30	IL2RA|IL2RA|CD4	CD25|CD25|CD4	Although anti-CD25 treatment did not alter numbers of inflammatory cells recruited into the CNS or the proportions of anti-viral effectors, we cannot rule out a transient CD25 dependent CD4 + helper T cell effect , independent of the Treg population.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:23009..23275:sentences:cd390a42a2fcd8e537621a9861fed91d	IL2RA|CD274|CD4	CD25|PD-L1|CD4	One possibility to account for the limited clearance of infectious virus in the absence of CD25 + CD4 + T cells is inhibition of CTL activity in vivo via the inhibitory ligand PD-L1 on CNS targets (Phares et al., 2009) which is not apparent in a direct ex vivo assay.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:23277..23475:sentences:102e5026beda6cc508e5b6af87eed00e	CD274|IL2RA|CD4	PD-L1|CD25|CD4	Although PD-L1 mRNA expression was slightly increased in the CNS of the CD25 + CD4 + T cell depleted mice relative to controls (data not shown), the difference did not reach statistical significance.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:23865..24398:sentences:c8d380989f9f3520cd2072e178390a72	IL2RA|CD4|IL2RA|CD4	CD25|CD4|CD25|CD4	These data contrast with data from a number of both human and viral infections suggesting that CD25 + CD4 + Treg facilitate chronic viral infection (Belkaid, 2007; Rouse et al., 2006; Rowe et al., 2012) . Although CD25 + CD4 + T cells are rapidly recruited to the site of infection, depletion and/or functional inactivation demonstrates the effect on the inflammatory response within the CNS is transient, appearing to decrease the initial set point for control of virus replication without influencing viral persistence.. Discussion.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:25130..25304:sentences:667860c508759ac161b38b520d7a77d2	IL2RA|CD4	CD25|CD4	Thus despite the minimal influence of CD25 + CD4 + Treg on JHMV viral load and persistence, these minimal alterations were sufficient to influence the extent of tissue damage.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:25880..26032:sentences:37d5b96d7a6ad43e116778bc7f993c86	IL10|FOXP3	IL-10-GFP|Foxp3	IL-10-GFP and Foxp3-GFP reporter mice on the C57BL/6 background (Madan et al., 2009; Korn et al., 2007) were bred locally under pathogen-free conditions.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:28282..28398:sentences:0fb6e6e5295bd69ee32b0b7ea7bea3ce	FCGR3B|FCGR2B	CD16|CD32	Cells were incubated at 4 C with 1% mouse serum and 1% rat anti-mouse CD16/CD32 mAb to prevent non-specific staining.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:28400..28998:sentences:6888ac09cc7860910af701ab5d3e8e85	IL10|FOXP3||CD8A	IL-10-GFP|Foxp3|FL1|CD8	Surface marker expression was examined using mAb purchased from BD Biosciences ( . Virus specific CD8 + T cells were identified using D b S510 MHC Class I tetramers (Bergmann et al., 1999; Beckman Coulter, Fullerton, CA) . Cells from IL-10-GFP and Foxp3-GFP reporter mice were analyzed without fixation and GFP expression identified in the FL1/FITC channel as previously described (Puntambekar et al., 2011) . Cells were acquired on a FACSCalibur or FACS Aria flow cytometer (BD Biosciences), and the data analyzed by FlowJo 7.6 software (Tree Star Inc., Ashland, OR).. Cytotoxic T lymphocyte assay.
+SARS:0b064096b51c4cada7b64af37eae826b7e7c9649:fulltext:d30d02daab43e6649698df356fa8eb1e:30017..30153:sentences:9df5cad8f2ebbd1daf08146554c2fb7e	PTPRC|ITGAM|PTPRC|CD4	CD45|CD11b|CD45|CD4	Bar graphs depict total CD45 hi inflammatory cells (A), CD11b + CD45 hi macrophages (B) and CD4 + T cells (C) per brain of infected mice.
+SARS:0b2c383c48f644edcb7c4dcf40046bd58dd5e0f8:fulltext:e180b37fa01d7a804e33a8d13f5aee3d:11842..12405:sentences:c6c221d5f2931cc989e6ddb19a546a2a	CD81|PCNA	CD81|PCNA	Western blots confirmed exosome presence with the exosome marker CD81, and a lack of cellular contamination was verified using the nuclear protein PCNA (Figure 1B) . Exosome size was confirmed to be 95 nm via NTA and TEM imaging confirmed the round morphology of exosomes (Figure 1C-D) . It was not possible to directly determine the exosome labelling; NTA was not able to differentiate between labelled and unlabeled exosomes ( Figure 1C) . Instead we used indirect methods to test whether the addition of a targeting peptide would increase retention of exosomes.
+SARS:0b2c383c48f644edcb7c4dcf40046bd58dd5e0f8:fulltext:e180b37fa01d7a804e33a8d13f5aee3d:15327..15677:sentences:ac4c7c9f05af824ac28e1c04906422cb	MKI67|VWF|VWF	Ki67|Von Willebrand factor|VwF	Imaging of Ki67 showed that there was increased cardiomyocyte proliferation following CHP-XO treatment (Figure 4A-B) . Angiogenesis was measured by imaging of Von Willebrand factor (VwF) and showed significant increases with CHP-XO treatment (Figure 4C-D) . As the exosomes were from human origin, negative effects by an immune response were possible.
+SARS:0b2c383c48f644edcb7c4dcf40046bd58dd5e0f8:fulltext:e180b37fa01d7a804e33a8d13f5aee3d:16015..17636:sentences:51e398a6cde8a1edcde53af9302a00f3	MIR21|MIR146A|MIR21|PDCD4|FASLG|AKT1|MIR146A|IRAK1|IRAK1|TRAF6|TRAF6|MIR21|MIR146A|MAPK14|MAPK14|CHP1	miR21|miR146a|miR21|PDCD4|FasL|AKT|miR146a|interleukin-1 receptorassociated kinase1|IRAK1|tumor necrosis factor (TNF) receptor-associated factor 6|TRAF6|miR21|miR146a|p38|p38 MAPK|CHP	Exosomes secreted by cardiospherederived stem cells have been shown to promote cardiac regeneration [18, 20, 41] . It has been indicated that the beneficial effects of exosomes are due to its ability to shuttle miRNA between cells [11] [12] [13] [14] [15] [16] . CDC-XOs contain numerous miRNAs, in particular miR21 and miR146a [18] , both of which have been shown to have beneficial effects on the injured myocardium [42] [43] [44] [45] [46] . miR21 reduces myocardial apoptosis by modulating expression of programmed cell death 4 (PDCD4), FasL, and AKT pathways [47] [48] [49] . miR146a represses interleukin-1 receptorassociated kinase1 (IRAK1) and tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6), reducing activation of nuclear factor  (NF-) [18, 44] . The effects of the miRNAs do not appear to be the result of any single miRNA, but rather the effects are dependent upon multiple miRNAs working in tandem [18, 49] . When combined, miR21 and miR146a result in significant reduction of p38 mitogenassociated kinase phosphorylation (p-p38 MAPK) [49] . As miRNAs do not require an exact match to the target mRNA, miRNAs can repress many different proteins [50] [51] [52] [53] [54] [55] [56] . When co-expressed or inhibited, this leads to multiple interactions and alterations as overlapping portions of pathways are modulated [50, [57] [58] [59] . Of the many possible outcomes of the miRNA modulation, we demonstrate that CHP-XOs promote cardiac repair through reduced scar size ( Figure 3D-E) , increased cardiac proliferation ( Figure  4A-B) , and increased angiogenesis (Figure 4C-D) .. Discussion.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:14..536:sentences:64a0f5a53bb674201385b77998af5326	FOXP3|NRP1|NRP1|IL2RB|IL2RA|CD4	Foxp3|neuropilin 1|Nrp-1|IL-2 receptor|CD25|CD4	Regulatory T cells (Treg) which express the Foxp3 transcription factor, neuropilin 1 (Nrp-1) and the IL-2 receptor (CD25) comprise $10% of CD4  T cells in the nave animal and play an essential role in regulating the immune response to infection, progression of clinical disease and tissue damage (Langier et al., 2010; Lourenco and La Cava, 2011; Rouse et al., 2006; Rowe et al., 2012) . During viral infection the host is challenged to mount an effective anti-viral immune response while minimizing immune mediated damage.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:538..1342:sentences:d6947123f27b81bf9889da428a7e7abd	FOXP3|IL10|FOXP3|FOXP3	Foxp3|IL-10|Foxp3|Foxp3	Exuberant T cell effector function and tissue damage are regulated by sustained natural Treg (nTreg), induction of antigen specific Foxp3  Treg (iTreg), secretion of the antiinflammatory cytokine IL-10 by both Foxp3  and Foxp3  T cells, as well as inhibitory ligand receptor interactions (Belkaid, 2007; Curotto de Lafaille and Lafaille, 2009; Langier et al., 2010; Rowe et al., 2012) . Treg influence the immune response during a variety of acute viral infections (Rouse et al., 2006; Rowe et al., 2012; Zelinskyy et al., 2009) and are implicated in facilitating persistent infections in both humans and mice (Dittmer et al., 2004; Rowe et al., 2012; Xu et al., 2006) . However, their suppressive role and the mechanism(s) of suppression vary depending upon both the pathogen and primary tissue infected.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:2616..3611:sentences:9ff46b07cd96c144430a3a6366091ee6	IL2RA|IL2RA|CD4	CD25|CD25|CD4	Depletion and/or functional inactivation of CD25  Treg did not affect CNS inflammation or TMEV replication in mice resistant to chronic infection (Richards et al., 2011) . The identical depletion strategy resulted in both enhanced inflammation and control of TMEV replication in the CNS of mice susceptible to chronic infection (Richards et al., 2011) . By contrast, Treg depletion prior to acute infection with a neuronotropic MHV, which also produces chronic demyelination, did not alter CNS inflammation or virus specific T cell responses (Cervantes-Barragan et al., 2012) . Following CNS infection with an MHV variant containing a mutation in the immunodominant CD4  T cell epitope which ameliorates disease, anti-CD25 mediated Treg depletion increased both morbidity and mortality (Anghelina et al., 2009) . A beneficial role of Treg was also supported by adoptive transfer of nTreg at a time when CNS infection by a sub-lethal, glial tropic JHM strain of MHV (JHMV) was already established.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:3884..4188:sentences:09c916fab4bc5a7d79e7c61adda6caa0	IL2RA|IL10|IL2RA	CD25|IL-10|CD25	To better define the role of CD25  Treg early during JHMV induced encephalomyelitis and potential consequences on the chronic infection associated with sustained demyelination, the present study examined depletion/functional inactivation of CD25  cells in wild type (WT) and syngeneic IL-10 reporter mice.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:4385..4531:sentences:b79485bb86e09ff12c74fcf1d301a258	IL2RA|CD8A|CD4	CD25|CD8|CD4	The absence of CD25  CD4  T cells did not influence the composition or extent of the CNS inflammatory cells, including virus-specific CD8  T cells.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:5077..5352:sentences:a7859bd7adba2f257e9df433aa952afe	IL2RA|NRP1|NRP1|IL2RA|IL2RA|FOXP3|CD4	CD25|Nrp-1|Nrp-1|CD25|CD25|Foxp3|CD4	Kinetics of CD25  Nrp-1 hi nTreg and Nrp-1 low iTreg accumulation in the CNS Prior to initiating anti-CD25 monoclonal antibody (mAb) treatment the kinetics and relative composition of CD25  and Foxp3  CD4  T cells recruited into the CNS were assessed following JHMV infection.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:5354..5455:sentences:d0e647e80153e7ddce8b1e0d96848feb	IL2RA|FOXP3|CD4	CD25|Foxp3|CD4	CNS accumulation of CD25  and Foxp3  CD4  T cells followed similar patterns throughout infection (Fig.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:5457..5595:sentences:ed6060bc3593a9f6bc2ecb8c01f8fd5c	IL2RA|CD4|FOXP3|CD4	CD25|CD4|Foxp3|CD4	1A) . Total numbers of both CD25  CD4  and Foxp3  T cells peaked at day 7 post infection (p.i.) comprising $20% of total CD4  T cells (Fig.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:5652..5759:sentences:5debab898762488ff64616179f6b7f9d	FOXP3|IL2RA	Foxp3|CD25	and stabilized thereafter ( Fig. 1B and C) . Importantly, 475% of CD25  cells expressed Foxp3  at day 7 p.i.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:5761..6048:sentences:491a3b25a67edc59bc6a615e4a5119fe	IL2RA|FOXP3|IL2RA|CD4	CD25|Foxp3|CD25|CD4	indicating a minority of $ 25% non Treg CD4  effector cells expressed CD25 ( Fig. 1A and D) . These data show that the vast majority of the Foxp3  population expressed CD25 ( Fig. 1A and D) and this proportion remained stable at 75-80% throughout the infection ( Fig. 1A and D).. Results.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:6050..6353:sentences:e78968fa16a1354b043664e22bf3af95	IL2RA|NRP1|NRP1|FOXP3	CD25|Nrp-1|Nrp-1|Foxp3	To distinguish a phenotypic transition of Treg populations, possibly accompanied by differential expression of CD25, nTregs were identified based on high Nrp-1 expression Yadav et al., 2012) . At day 7 p.i., Nrp-1 hi nTreg represented the majority ( $ 75%) of Foxp3  Treg within the CNS ( Fig. 2A and B).
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:6600..6668:sentences:03151e308d58def3235a1b427b45eb35	IL2RA|NRP1	CD25|Nrp-1	1D ), CD25 expression remained stable at $ 75% on both Nrp-1 hi (Fig.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:6743..6841:sentences:64c32e43393c69f16d4b9e540c6c1f8b	IL2RA|FOXP3|IL2RA	CD25|Foxp3|CD25	These data predicted that the majority of CD25  Foxp3  Treg are susceptible to anti-CD25 treatment.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:6843..7086:sentences:c5695139f23d0bc6200f21b1db11fb50	IL2RA|NRP1|IL2RA|IL2RA	CD25|Nrp-1|CD25|CD25	Moreover, CD25 treatment at early times during infection was anticipated to primarily target prevailing Nrp-1 hi Treg and only a minor population of CD25  effector T cells.. Early CD25  T cell depletion does not alter morbidity or inflammation.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:7860..8081:sentences:9b868f07f911e146a7f37711089c7687	IL2RA|CD4|IL2RA|IL2RA	CD25|CD4|CD25|CD25	Anti-CD25 mAb eliminated essentially all CD25  T cells from the cervical lymph nodes (CLN) at least until day 14 p. i.; a small percentage of CD4  CD25  T cells, representing $ 15% of control levels, emerged by day 21 p.i.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:8101..8268:sentences:6c2fba7000367b5f1d4195c3bedf89b1	IL2RA|CD4	CD25|CD4	Flow cytometric analysis of CD4  T cells recruited into the CNS indicated the anti-CD25 treatment was also effective at the site of infection at least until day 14 p.i.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:8287..8493:sentences:9de02fcb690ca1408afa224984b0766a	IL2RA|IL2RA|IL2RA|CD4|CD4	CD25|CD25|CD25|CD4|CD4	At day 21 p.i., the frequency of CD25  CD4  cells within the CNS of the anti-CD25 treated group, returned to control levels, suggesting accumulation of CD25  CD4  T cells from the reemerging peripheral pool.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:8495..8726:sentences:989d81e87b2cdff9804796abe9dee6c7	PTPRC|ITGAM|IL2RA	CD45|CD11b|CD25	Neither total numbers of CD45 hi inflammatory cells nor CD11b  macrophages recruited into the CNS were altered in the anti-CD25 treated group compared to controls ( Fig. 4A and B), consistent with the similarity in clinical disease.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:8728..8809:sentences:3318e344cf2b494792d49f92f2338275	IL2RA|CD4	CD25|CD4	Although CD25  T cells comprise up to 30% of CD4  T cells in the CNS at day 7 p.i.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:10679..11096:sentences:842861b72c7283c3df1d082d3e22b821	IFNA1|IFNA1|IL2RA|CD8A|IFNA1	IFN-|IFN-|CD25|CD8|IFN-	T cell mediated cytolytic activity and IFN- are the primary immune effectors controlling JHMV replication within the CNS (Bergmann et al., 2006) and Treg depletion enhances CD8  T cell number and activity (Dietze et al., 2011; Haeryfar et al., 2005) . Comparison of anti-CD25 treated and control mice indicated no affect on CNS IFN- mRNA levels or frequencies of virus-specific T cells secreting IFN- (data not shown).
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:11098..11270:sentences:5a7f8c2b0971eb1e24c3ba83b8f7a91f	IL2RA|CD8A	CD25|CD8	The limited control of viral replication at day 7 p.i. in the absence of CD25  T cells ( Fig. 5A ) did not coincide with impaired CNS recruitment of total CD8  T cells (Fig.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:11565..11799:sentences:9434be3f4579b60c41f2dd85a5e243e0	IL10|CD4|IL2RA|CD8A|CD4|CD8A	IL-10|CD4|CD25|CD8|CD4|CD8	During influenza virus infection of the lung, highly cytolytic IL-10 producing CD8  T cells are dependent upon CD4  T cells (Sun et al., 2011) , suggesting a possible influence of CD4  CD25  T cells on CD8  T cell function during JHMV.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:11801..11946:sentences:c58909ffb7247933c699a78892d56541	IL10|CD8A|CD8A	IL-10|CD8|CD8	Furthermore, an IL-10  CD8  T cell population constituting $ 25% of virus-specific CD8  T cells resides within the JHMV infected CNS at day 7 p.i.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:11948..12200:sentences:94694a27a1de21f66079e5a84002486b	IL10|IL10|IL2RA|CD8A|CD8A	IL-10|IL-10|CD25|CD8|CD8	(Puntambekar et al., 2011) , comprising CD8  T cells with high cytolytic potential (Trandem et al., 2011a) . Anti-CD25 treated and control IL-10 reporter mice were therefore infected to examine the possibility of diminished IL-10  effector CD8  T cells.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:12202..12381:sentences:83ae7f88a78031a572ef0ba539838daa	IL2RA|IL2RA|IL10|CD4	CD25|CD25|IL-10|CD4	Similar to WT mice, anti-CD25 mAb treatment was effective at eliminating CD25  CD4  T cells from the CNS of infected IL-10 reporter mice until at least day 14 p.i (data not shown).
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:12383..12547:sentences:4c0abdd557834bb678c63aa7f378072e	IL2RA|IL10|CD4	CD25|IL-10|CD4	Anti-CD25 treatment reduced the frequency of IL-10  CD4  T cells by $30% at day 7 p.i.; however, the population returned to WT levels by day 10 p.i (data not shown).
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:13122..13218:sentences:6e91ef30da857779df984b1a651595dc	IL2RA|CD8A	CD25|CD8	5A) , cytolytic activity by CNS derived CD8  T cells was not altered by anti-CD25 treatment (Fig.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:13332..13598:sentences:8b516b89385545def13f6827d19e5284	IL2RA|CD8A|CD4|IFNA1	CD25|CD8|CD4|IFN-	(data not shown), consistent with previous results (Bergmann et al., 1999) . Thus the transiently increased viral load in the absence of CD25  CD4  T cells could not be correlated with either reduced IFN-, virus-specific CD8  T cell recruitment or cytolytic activity.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:13600..13908:sentences:965eb8e312233054a8ba45c921439b7b	IL2RA|IL2RA|CD4	CD25|CD25|CD4	Transiently decreased anti-viral activity may thus be due to insufficient help provided by CD25  CD4  T cells or induction of inhibitory molecules (Phares et al., 2009) , neither of which would be directly reflected by in vitro analysis.. Early CD25  T cell depletion does not alter morbidity or inflammation.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:13910..14216:sentences:edb896bf4b87b488d9d2df7d7a5d391b	IL2RA|CD4|IL2RA|IL2RA	CD25|CD4|CD25|CD25	Early CD25  T cell depletion does not alter persistence but limits demyelination A number of chronic viral infections are associated with CD25  CD4  Treg (Belkaid, 2007; Rowe et al., 2012) . However, no clinical or virological evidence for viral recrudescence was found in the anti-CD25 treated group (Figs.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:14833..15190:sentences:3d4f27e4352e54dba5426f037656d460	IL2RA|IL2RA|CD4	CD25|CD25|CD4	6A) , the predominant site of JHMV persistence (Bergmann et al., 2006; Marten et al., 2000) . These results indicate that diminished viral control during the acute phase of coronavirus mediated encephalomyelitis in the absence of CD25  CD4  T cells did not facilitate viral persistence.. Early CD25  T cell depletion does not alter morbidity or inflammation.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:15192..15551:sentences:ca8544e83fe65fd6464b8a1df28d61f6	IL2RA|IL2RA|CD4	CD25|CD25|CD4	The transient decrease in control of CNS viral replication, decreased demyelination mediated by nTreg adoptive transfer in a similar model of JHMV infection (Trandem et al., 2010) and the delayed onset of demyelination in anti-CD25 treated TMEV infected mice (Richards et al., 2011) suggested that CD25  CD4  T cells might influence JHMV induced tissue damage.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:16866..17006:sentences:1ce69312e322931057bc0b6abb938d0c	IL2RA|CD4	CD25|CD4	These data support the notion that the early events of viral induced tissue damage within the CNS are not regulated by CD25  CD4  Treg cells.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:19717..20565:sentences:67b9cef08068654f5576a29a05d48de2	IL2RA|IL2RA|IL2RA|IL2RA|CD4|CD8A	IL-2R|CD25|CD25|CD25|CD4|CD8	Inhibition of IL-2-IL/ IL-2R interactions may explain the limited inflammation in some viral infections (Fulton et al., 2010; Ruckwardt et al., 2009) , but it has no effect on inflammation in others (Betts et al., 2011) . In addition, anti-CD25 treatment increases CD8  T cells responses under some, but not all circumstances (Betts et al., 2011; Dietze et al., 2011; Fulton et al., 2010; Haeryfar et al., 2005; Ruckwardt et al., 2009) . Both CD25  CD4  T cells and CD4  IL-10  T cells are rapidly recruited into the JHMV infected CNS (Anghelina et al., 2009; Puntambekar et al., 2011) . However, both virus control and inflammation are Treg independent following infection with a related MHV (Cervantes- Barragan et al., 2012) . Therefore, it was not surprising that anti-CD25 treatment did not alter recruitment of inflammatory cells into the CNS.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:20977..21193:sentences:523db8a150eaaa9df5eeaaa5b4bc8ed2	CD274|IL10	PD-L1|IL-10	Programmed death-1 ligand (PD-L1), as well as the antiinflammatory cytokine IL-10 influence JHMV pathogenesis (Phares et al., 2010; Trandem et al., 2011b) potentially exhibiting more potent regional effects than Treg.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:21195..21779:sentences:1ad817a951c23b98048cbed222917cbb	IL10|IL10|IL2RA|IL2RA|IL10|IL2RA|IL2RA|IL10|CD4|CD4	IL-10|IL-10|CD25|CD25|IL-10|CD25|CD25|IL-10|CD4|CD4	For example, JHMV infection of IL-10 deficient mice demonstrated accelerated viral clearance, yet dramatically enhanced tissue destruction (Trandem et al., 2011a) . During JHMV infection IL-10 secretion within the CNS is limited to the T cell compartment with CD25  IL-10  CD4  T cells, characteristic of nTreg, rapidly recruited into the CNS (Puntambekar et al., 2011) . The absence of a suppressive effect suggested by anti-CD25 treatment may reside in the rapid replacement of this population by CD25 -IL-10  CD4  T cells (Puntambekar et al., 2011) , or the loss of CD25 expression.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:21781..22324:sentences:79a9be2eebb573b3687036b16e1451ee	IL2RA|IL10|FOXP3|IL10|IL27|IL2RA|IL2RA|FOXP3|CD4	CD25|IL-10|Foxp3|IL-10|IL-27|CD25|CD25|Foxp3|CD4	Although the precise phenotype of the CD25 -IL-10  CD4  T cell population is unclear, it is possible it comprises virus-specific Foxp3  Treg (Zhao et al., 2012) or virus-specific IL-10  Foxp3cells regulated by IL-27 (Wojno and Hunter, 2012) . Interestingly, $5% of Treg infiltrating the CNS during JHMV infection are virusspecific (Zhao et al., 2011) . As CD25 expression was not assessed on this population, our data cannot exclude that enrichment of this population in the CD25 -Foxp3  subset may contribute to JHMV pathogenesis.. Discussion.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:22326..22493:sentences:86bc6bd6865794c5c55d4ec48b3d8188	IL2RA|CD4	CD25|CD4	Control of CNS virus replication was partially inhibited at the peak of replication, suggesting that CD25  CD4  T cells enhanced the initial phase of adaptive immunity.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:22495..22743:sentences:370e5379a07379e31e7e92bcd8e49200	IL2RA|IL2RA|CD4	CD25|CD25|CD4	Although anti-CD25 treatment did not alter numbers of inflammatory cells recruited into the CNS or the proportions of anti-viral effectors, we cannot rule out a transient CD25 dependent CD4  helper T cell effect , independent of the Treg population.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:22976..23241:sentences:063b18b10316dfbcf78fa299c335571d	IL2RA|CD274|CD4	CD25|PD-L1|CD4	One possibility to account for the limited clearance of infectious virus in the absence of CD25  CD4  T cells is inhibition of CTL activity in vivo via the inhibitory ligand PD-L1 on CNS targets (Phares et al., 2009 ) which is not apparent in a direct ex vivo assay.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:23243..23439:sentences:c3acbdf853f4d8d16f6e2ced3a885a94	CD274|IL2RA|CD4	PD-L1|CD25|CD4	Although PD-L1 mRNA expression was slightly increased in the CNS of the CD25  CD4  T cell depleted mice relative to controls (data not shown), the difference did not reach statistical significance.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:23799..24328:sentences:b4354cfe38484616b7a3cdf6d6824231	IL2RA|IL2RA|CD4|CD4	CD25|CD25|CD4|CD4	These data contrast with data from a number of both human and viral infections suggesting that CD25  CD4  Treg facilitate chronic viral infection (Belkaid, 2007; Rouse et al., 2006; Rowe et al., 2012) . Although CD25  CD4  T cells are rapidly recruited to the site of infection, depletion and/or functional inactivation demonstrates the effect on the inflammatory response within the CNS is transient, appearing to decrease the initial set point for control of virus replication without influencing viral persistence.. Discussion.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:25059..25231:sentences:56907f5236e90017d5f7e5206e4ef6ed	IL2RA|CD4	CD25|CD4	Thus despite the minimal influence of CD25  CD4  Treg on JHMV viral load and persistence, these minimal alterations were sufficient to influence the extent of tissue damage.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:25807..25959:sentences:e8b38956196b9a63b34bd74da23aa5ef	IL10|FOXP3	IL-10-GFP|Foxp3	IL-10-GFP and Foxp3-GFP reporter mice on the C57BL/6 background (Madan et al., 2009; Korn et al., 2007) were bred locally under pathogen-free conditions.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:28212..28329:sentences:120ac4d2f799d2d94f67f96345065552	FCGR3B|FCGR2B	CD16|CD32	Cells were incubated at 4 1C with 1% mouse serum and 1% rat anti-mouse CD16/CD32 mAb to prevent non-specific staining.
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:28450..28651:sentences:7aa10a7e230cb4be3d67418936eee0b7	PTPRC|CD4|CD8A	CD45|CD4|CD8	Staining used fluorescein isothiocyanate (FITC), phycoerythrin (PE), Peridinin chlorophyll protein (PerCP) and allophycocyanin (APC)-conjugated mAb specific for: CD45 (30-F11), CD4 (L3T4), CD8 (53-6.7),
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:28653..28798:sentences:354d2404dba10cd28add13c7316fec8f	IL2RA|SELL|CD44|CD69|NPR1	CD25|CD62L|CD44|CD69|Npr-1	F4/80 (Serotec, Raleigh, NC), MHC Class II (2G9), CD25 (PC61), CD62L (Mel-14), CD44 (IM7), CD69 (H1-2F3) and Npr-1 (R&D Systems, Minneapolis, MN).
+SARS:0bb97577b1f4c0a5f456ac10d593b4c46f285e9c:fulltext:cfb6a66c88ddb143670b36f5a83da2a2:28800..29314:sentences:1ddfd4946e89179aab5a3d3716b7399d	IL10|FOXP3||CD8A	IL-10-GFP|Foxp3|FL1|CD8	Virus specific CD8  T cells were identified using D b S510 MHC Class I tetramers (Bergmann et al., 1999; Beckman Coulter, Fullerton, CA) . Cells from IL-10-GFP and Foxp3-GFP reporter mice were analyzed without fixation and GFP expression identified in the FL1/FITC channel as previously described (Puntambekar et al., 2011) . Cells were acquired on a FACSCalibur or FACS Aria flow cytometer (BD Biosciences), and the data analyzed by FlowJo 7.6 software (Tree Star Inc., Ashland, OR).. Cytotoxic T lymphocyte assay.
+SARS:0c04a2b5c4c91d76c26736dd05ce6fc6385cc167:title:aa819c185c7da44d436be1fa9292f866:0..141:sentences:61d134e653b127921fcf4ffdd4665b30	LILRA3|LILRB1|LILRB2	LILRA3|LILRB1|LILRB2	LILRA3 Binds Both Classical and Non-Classical HLA Class I Molecules but with Reduced Affinities Compared to LILRB1/LILRB2: Structural Evidence
+SARS:0c22edd80a03a1b9de7f3d29b729ad1006d10674:abstract:8c982659b56f69e8e0916ff5a0708403:281..442:sentences:76b198acd338623d1af95716b1a31263	TFRC|GTPBP1|TFRC|GTPBP1	TfR1|GP1|TfR1|GP1	TfR1 residues essential for this interaction have been described, and a co-crystal of MACV GP1 bound to TfR1 suggests GP1 residues important for this association.
+SARS:0c22edd80a03a1b9de7f3d29b729ad1006d10674:abstract:8c982659b56f69e8e0916ff5a0708403:444..635:sentences:81a06d3eaa37619b723350769ad34cd3	GTPBP1|TFRC	GP1|TfR1	We created MACV GP1 variants and tested their effect on TfR1 binding and virus entry to evaluate the functional significance of some of these and additional residues in human and simian cells.
+SARS:0c22edd80a03a1b9de7f3d29b729ad1006d10674:abstract:8c982659b56f69e8e0916ff5a0708403:637..810:sentences:00fba24cca5f2b1fec5b7616c0d21214	GTPBP1|TFRC|MYBBP1A	GP1|TfR1|P160	We found residues R111, D123, Y122, and F226 to be essential, D155, and P160 important, and D114, S116, D140, and K169 expendable for the GP1-TfR1 interaction and MACV entry.
+SARS:0c22edd80a03a1b9de7f3d29b729ad1006d10674:abstract:8c982659b56f69e8e0916ff5a0708403:812..985:sentences:93cb527c085163fcb6c7ab0163c04137	GTPBP1|TFRC	GP1|TfR1	Several MACV GP1 residues that are critical for the interaction with TfR1 are conserved among other New World arenaviruses, indicating a common basis of receptor interaction.
+SARS:0c3be9775e24a07931a5644899df5c99636895be:abstract:feeb93427d38cf405ab0919d64b71d30:248..437:sentences:ef46210b06c9724a968ebef73f42d0ce	||PSEN1	Ad7|Ad5|Ad3	Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively.
+SARS:0c3be9775e24a07931a5644899df5c99636895be:abstract:feeb93427d38cf405ab0919d64b71d30:439..695:sentences:2f3fc8a67a78a3c9cb62a56c6d3a59e9	TMEM185A|PSEN1	E1A, E1B, E2, E3, and E4|Ad3	The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:9826..10239:sentences:dec8ae71150fa59fb7cfa5d44dab2cac	DSCAM|HLA-E	Dscam|MHC	TLR, Toll-like receptor; AMP, antimicrobial peptide; Dscam, Down syndrome cell adhesion protein; VCBPs, variable region-containing chitin-binding proteins; NLRs, intracellular NOD-like receptors; LRR, leucine-rich repeat; IgSF, immunoglobulin superfamily; Ab, antibodies; TCR, T cell receptor; MHC, major histocompatibility complex.. IMMUNOLOGICAL NOVELTY AMONG ANIMAL PHYLA: AN UNDERAPPRECIATED FORM OF DIVERSITY.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:14580..15135:sentences:fe118299b01ae7fa6e5193d934b11bb1	RAG1|RAG2|HLA-E	RAG1|RAG2|MHC	The latter gene family produces a repertoire of defense proteins more diverse than the sequence diversity encoded in the genes, indicative of the presence of another mechanism to generate diversity (Ghosh et al., 2010) . Sea urchins also possess an NF-B pathway, lectin and alternative complement pathways and homologs of RAG1 and RAG2, but do not produce immunoglobulins (Ig), T cell receptors (TCRs), or have a major histocompatibility complex (MHC; Hibino et al., 2006) .. IMMUNOLOGICAL NOVELTY AMONG ANIMAL PHYLA: AN UNDERAPPRECIATED FORM OF DIVERSITY.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:15137..16248:sentences:1207867d5dc2940ac0329da2465d67a5	RAG1|RAG2	RAG1|RAG2	With respect to our own phylum, the Chordata, the cephalochordate Branchiostoma (better known as Amphioxus or the lancelet), is novel in having expanded families of TLRs, NLRs, and SRCRs (Huang et al., 2008) , over 1,200 C-type lectins, and an extraordinary diversity in adaptors/facilitators and signaling/effector domains functioning downstream from their NLRs (Huang et al., 2008; Messier-Solek et al., 2010) . Amphioxus also possesses distinctive variable region-containing chitin-binding proteins (VCBPs; Dishaw et al., 2008; Cannon and Litman, 2009) which are further distinguished by high levels of polymorphism, resulting in yet another distinct "hyper-diversified," multigene immune receptors family (Dishaw et al., 2010) . Cephalochordates have a functioning complement system operating via the alternative and lectin pathways, including with a distinctive expanded number of C1q-like genes (Huang et al., 2008; Messier-Solek et al., 2010) . A RAG1 gene is present, and possibly a RAG2 gene as well (Dong et al., 2005) .. IMMUNOLOGICAL NOVELTY AMONG ANIMAL PHYLA: AN UNDERAPPRECIATED FORM OF DIVERSITY.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:16516..16605:sentences:2f295a6d5195c4455c24170225e35be1	AICDA|AICDA|HLA-E	activation-induced cytidine deaminase|AID|MHC	MHC, TCRs, Ig, RAG, and activation-induced cytidine deaminase (AID) genes are all lacking.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:17248..17879:sentences:8a7393cd5a342ee0ceee6293706eb03b	RAG1|RAG2	RAG1|RAG2	We now know they lack RAG1 and RAG2 and do not produce TCRs or Ig, however, they have a remarkable ability to make highly diverse variable lymphocyte receptors (VLRs) that consist of somatically re-arranged modules containing leucine-rich repeats (Pancer et al., 2004) . It is striking that agnathans and gnathostomes have adopted divergent solutions to the same problem of generation of recognition capability, both of which involve rearrangements of germ-line encoded genes, but in entirely different ways with different starting sets of molecules.. IMMUNOLOGICAL NOVELTY AMONG ANIMAL PHYLA: AN UNDERAPPRECIATED FORM OF DIVERSITY.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:18023..18634:sentences:dac3b1551242afb10fc1ce5632077e6a	RAG1|RAG2|HLA-E	RAG1|RAG2|MHC	As noted above, relative to some of the invertebrate deuterostomes such as echinoderms or cephalochordates, gnathostome innate immune components are modest in numbers, typically possessing 10-25 TLRs and 20-35 NLRs (Messier-Solek et al., 2010) . The gnathostome adaptive immune system features somatic diversification of both TCRs and Ig, requiring for this process RAG1 and RAG2, the former likely derived and modified from a transib-like transposon (Fugmann, 2010) . The gnathostome immune system works in conjunction with a unique antigen processing and presentation system, the MHC, to limit self-reactivity.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:37265..38237:sentences:75316f9106ecd6b92ff38b8838588c80	NELFCD|APOL1	Th1|apolipoprotein L-1	Infection of the crab Pachygrapsus marmoratus with the rhizocephalan barnacle Sacculina carcini results in melanization of larvae in thoracic ganglia (Kuris et al., 2007) Antibody/factor that activates complement in serum of the non-host Raja radiata kills the tapeworm Acanthobothrium quadripartitum whereas larvae survive in serum of the normal host, Raja naevus (McVicar and Fletcher, 1970) Destruction of cercariae of avian schistosomes in the skin of mammals associated with a mixed Th1/Th2 lymphocyte cytokine response followed by more polarized Th2 response upon repeated exposures (Horak and Kolarova, 2005) Encapsulation of hymenopteran parasitoids by hemocytes of non-permissive insect hosts (Schmidt et al., 2001) Lysis of the trypanosome Trypanosoma brucei brucei by apolipoprotein L-1 in serum of humans who are refractory to this subspecies (Wheeler, 2010) .. IMMUNITY IS OFTEN RESPONSIBLE FOR THE SPECIALIZATION TO PARTICULAR HOST SPECIES SHOWN BY PARASITES.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:38239..39045:sentences:7168285a95458439f0ee7bab831bf9e3	EPHB2|STAT1|APOBEC3G|C3	Erk|STAT1|APOBEC3G|C3b	Disruption of the Erk-STAT1 signaling pathway allows cross species transmission of the normally rabbit-specific myxoma virus to mice (Wang et al., 2004) Animal handlers who were exposed to a new coronavirus developed antibodies to the new virus and did not develop clinical infections (Guan et al., 2003) Species specific forms of APOBEC3G and other innate, intracellular defense components, can prevent cross species transfer of lentiviruses (Mangeat et al., 2004; VandeWoude et al., 2010) . Table 4 | Examples of parasite immune evasive factors that are host specific in their action.. A staphylococcal complement inhibitor that specifically blocks human C4b2a and C3bBb, interfering with additional C3b deposition through classical, lectin or alternative pathways (Rooijakkers et al., 2005) . Sung et al.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:39222..39599:sentences:65b99cbb3ab983e1332f552e13ea0b91	GIF|CSF2|IL2	GIF|GM-CSF|IL-2	Human and murine chlamydial infections depend on different virulence factor genes that coevolved to counter host species specific IFN--mediated effector responses mounted by the particular host species (Nelson et al., 2005) .. Orf virus encodes a secreted protein GIF that binds to and inhibits GM-CSF and IL-2 of ovines but not humans or murines, consistent with the idea that.
+SARS:0b627ea5840e5e48709565840313984dc900af8d:fulltext:5cfb1e38d4116751ab8dfbae66fdbf3d:40075..40453:sentences:2825cef1b04cd11fdc4db891928ad3bd	SPICE1|C3|C4B	SPICE|C3b|C4b	(2002) noted that the smallpox inhibitor of complement enzymes (SPICE) is nearly 100-fold more potent than the vaccinia homolog in inactivating human C3b and sixfold more potent at inactivating C4b, providing evidence for how variola proteins are particularly adept at overcoming human immunity relative to vaccinia.. 2006).. The host specificity of three species of Bacillus (B.
+SARS:0c6cf4b1ae6e85e30b13383d5c3409e220d387b6:abstract:1f60aa7824594e92e7323f6af9bcc8b2:204..260:sentences:dab342da0f3f06858a8c03bb994a4b89	ACE|ACE2	ACE|ACE(2	Recently, a homologue of ACE, ACE(2) has been discovered.
+SARS:0c6cf4b1ae6e85e30b13383d5c3409e220d387b6:abstract:1f60aa7824594e92e7323f6af9bcc8b2:381..550:sentences:e5738d8415dfc58e28d5699e022ac2da	KNG1|ACE	bradykinin|ACE	Moreover, ACE(2) appears to be an important enzyme outside the classical RAS, as it hydrolyzes apelins, dynorphin A 1-13, des-Arg-bradykinin and other peptide substrates.
+SARS:0c6cf4b1ae6e85e30b13383d5c3409e220d387b6:abstract:1f60aa7824594e92e7323f6af9bcc8b2:552..666:sentences:0ec9cc0be0f51946973ba6aed73d3d7f	ACE|ACE2	ACE|ACE(2	The precise interplay between tissue ACE, ACE(2), and their substrates and by-products are presently still unclear.
+SARS:0c6cf4b1ae6e85e30b13383d5c3409e220d387b6:abstract:1f60aa7824594e92e7323f6af9bcc8b2:668..777:sentences:61dc7b575ebb0c409d468e0c5423416f	AGT|KNG1|ACE|ACE	angiotensin II|bradykinin|ACE|ACE	ACE-inhibitors reduce angiotensin II formation and bradykinin degradation, but do not inhibit ACE(2) activity.
+SARS:0c6cf4b1ae6e85e30b13383d5c3409e220d387b6:abstract:1f60aa7824594e92e7323f6af9bcc8b2:1230..1422:sentences:fbbcd3e14336d73f00a77f8aafb4a4b5	ACE|AGT	ACE|angiotensin II	Although, the precise significance of the outside-in signaling is still unclear, this new role of ACE-inhibitors may represent a discriminant factor versus angiotensin II receptors antagonists.
+SARS:0c6cf4b1ae6e85e30b13383d5c3409e220d387b6:abstract:1f60aa7824594e92e7323f6af9bcc8b2:1424..1612:sentences:419933dc860141d092f987585a6f4390	ACE|ACE2|ACE	ACE|ACE(2)|ACE	This mini review will summarize some new aspects concerning the recently discovered biological functions of RAS and in particular of ACE, ACE(2) and ACE-inhibitors in cardiovascular system.
+SARS:0c929ca540bf82c726f7d2875cb3a9dadacbf663:title:ff2ee9ee6bfab49e675a05c654d06800:0..105:sentences:079be77bd38eb385d98b742f53710d27	CCR2|CX3CR1	CC Chemokine Receptor 2|CX3CR1	CC Chemokine Receptor 2 is Protective Against Noise-Induced Hair Cell Death: Studies in CX3CR1(+/GFP) Mice
+SARS:0c4b19d02fd4fad087f3571c64cc5c33dcb5a3fb:abstract:0d6fac60819b05ab462cb36413be9246:216..289:sentences:9fcd53857f0566958a55422e76d56d3a	GTPBP1|TFRC	GP1|TfR1	We report the structure of Machupo virus (MACV) GP1 bound with human TfR1.
+SARS:0c4b19d02fd4fad087f3571c64cc5c33dcb5a3fb:abstract:0d6fac60819b05ab462cb36413be9246:291..416:sentences:21acb713bd4fedc615022dee404f5b50	GTPBP1|TFRC|TFRC	GP1|TfR1|TfR1	Atomic details of the GP1:TfR1 interface clarify the importance of TfR1 residues implicated in NW arenavirus host specificity.
+SARS:0cb9c296684ca5e71462d825cab2827854a01544:title:3d5b3a44646ee9a2adf6fe6b16191707:0..38:sentences:7a6663a4cef48c9d2e55fdcff536a405	TP53|hsa-mir-8078	p53|DUX4	p53 is not necessary for DUX4 pathology
+SARS:0cd1453fb9f28809b7544dcdcb0d6b3b4e42b3cc:abstract:d226c0287413f20c1f782bce10ab7517:212..560:sentences:f3c5faef6ae40bbe416f7b956c75037f	G3BP1|PABPC1|TNRC6A	G3BP|PABP|GW182	TIA/G3BP/PABP-specific stress granules (SG) and GW182/DCP-specific RNA processing bodies (PB) are two major distinguishable RNA granules in somatic cells and contain various ribosomal subunits, translation factors, scaffold proteins, RNA-binding proteins, RNA decay enzymes and helicases to exclude mRNAs from the cellular active translational pool.
+SARS:0cb9c296684ca5e71462d825cab2827854a01544:abstract:92d96e4b4feba970b2ebfc31e223f0b3:305..536:sentences:1dc1ab4cfe36e8a69bffd8e81ec70760	hsa-mir-8078|TP53|hsa-mir-8078|TP53	DUX4|p53|DUX4|p53	A previous report using adeno-associated virus to deliver high levels of DUX4 to mouse skeletal muscle demonstrated severe pathology that was suppressed on a p53 knockout background, implying that DUX4 acted through the p53 pathway.
+SARS:0cb9c296684ca5e71462d825cab2827854a01544:abstract:92d96e4b4feba970b2ebfc31e223f0b3:538..643:sentences:1308a4130e417ab92b2b2e27c516c5a9	TP53|hsa-mir-8078	p53|DUX4	Here, we investigate the p53-dependence of DUX4 using both in vitro cellular and the transgenic iDUX4[2.7]
+SARS:0cb9c296684ca5e71462d825cab2827854a01544:abstract:92d96e4b4feba970b2ebfc31e223f0b3:659..735:sentences:740617d813b0078c14f7c066af8e0218	TP53|hsa-mir-8078	p53|DUX4	We find that inhibiting p53 has no effect on the cytoxicity of DUX4 in vitro.
+SARS:0cb9c296684ca5e71462d825cab2827854a01544:abstract:92d96e4b4feba970b2ebfc31e223f0b3:737..959:sentences:cf659b074a24a8c578698ea76063a74b	TP53|hsa-mir-8078|hsa-mir-8078	p53|DUX4|DUX4	When crossed onto the p53 null background, we find no suppression of the male-specific lethality or skin phenotypes of the DUX4 transgene, and find that primary myoblasts from this mouse are still killed by DUX4 expression.
+SARS:0cb9c296684ca5e71462d825cab2827854a01544:abstract:92d96e4b4feba970b2ebfc31e223f0b3:961..1123:sentences:6145e0788824047ed2565aaf9f9cf34d	TP53|hsa-mir-8078|TP53	p53|DUX4|p53	These data challenge the notion that the p53 pathway is central to the pathogenicity of DUX4.Summary StatementDUX4 is thought to mediate cytopathology through p53.
+SARS:0cd96fd42139b22b63e5752eda2c38990a18763a:title:2c28f1b9bd5235db777e85740832a990:0..98:sentences:eceef2c46237944aa638ec38d11c9e2a	POU5F1P4|PROM1	Oct-4|CD133	Oct-4 Expression Maintained Cancer Stem-Like Properties in Lung Cancer-Derived CD133-Positive Cells
+SARS:0cf5cd1d540a88eb0efe3ba8815805508c8bfc0f:abstract:55339d6d95ceb0a1a18b81f8a402023d:607..800:sentences:71511db55e685913fc16e85134307835	PPIA|PPIG	CypA|Cyp	This review summarizes our current understanding of this class of nidovirus-host interactions, including the potential function of in particular CypA and the inhibitory effect of Cyp inhibitors.
+SARS:0caa109e0faf5c5fefe81a8108e1199058cb3a27:fulltext:18dde51230b1cda68f22e6e363601f27:9713..10111:sentences:ffa6a2dac2e718f3c7c09b56aed78dc0	TOPORS|SARS	Lun|SARS	Large outbreaks of SARS occurred in China (5327 cases with 349 deaths) Hong Kong (1755 cases with 299 deaths) and Taiwan (346 cases with 37 deaths); accounting for 91.7% of cumulative cases and 88.5% of total death globally (2) . According to Treatise on Febrile Disease (Shang Han Lun), a variety of herbal formulas have been employed to treat patients with infectious diseases for over 1800 years.
+SARS:0caa109e0faf5c5fefe81a8108e1199058cb3a27:fulltext:18dde51230b1cda68f22e6e363601f27:13261..13407:sentences:dc93c8fe9da79ec48afb83cfefca637b	IARS|SARS	IRS|SARS	However, there are gaps in our understanding of the immunopathogenesis of SARS (27) . This study was designed only to detect changes in IRS and DI.
+SARS:0cbd1447be1208e6013a8af7a24920b7899a7abf:abstract:69237f8d836d85ed8e9da11708ff352e:532..696:sentences:fa458617ed6955ce06f8580f69e3eeff	PGP|ABCC1|POU2F2|ABCC2	Pgp|MRP1|OCT2|MRP2	Concentrations of colchicine (substrate of Pgp and MRP1) and cisplatin (substrate of OCT2 and MRP2) were determined by high-performance liquid chromatography (HPLC).
+SARS:0cbd1447be1208e6013a8af7a24920b7899a7abf:abstract:69237f8d836d85ed8e9da11708ff352e:870..1014:sentences:8d2d9a5cb85cb96e65d87c0a67b7e5b9	SPSB2|ABCC1	SSb2|Mrp1	Key findings: SSb2 increased colchicine efflux in HEK293 cells by primarily increasing Mrp1 activity, independent of gene and protein expression.
+SARS:0cbd1447be1208e6013a8af7a24920b7899a7abf:abstract:69237f8d836d85ed8e9da11708ff352e:1016..1173:sentences:70865a10f133940f3a4e2e7987dfb28e	SPSB2|ABCC2|ABCC2|PGP	SSb2|Mrp2|Mrp2|Pgp	SSb2 enhanced Mrp2 function and increased cisplatin efflux in BRL3A cells by upregulating Mrp2 gene expression, with a marginal effect on Pgp in normal cells.
+SARS:0cbd1447be1208e6013a8af7a24920b7899a7abf:abstract:69237f8d836d85ed8e9da11708ff352e:1175..1443:sentences:facec832fd13e6971821bbcf8fa276d5	SPSB2|POU2F2|POU2F2|SPSB2|ABCC2|ABCC2|ABCC2|PGP|ABCC1|PGP|ABCC1|POU2F2	SSb2|OCT2|OCT2|SSb2|MRP2|MRP2|MRP2|Pgp|MRP1|Pgp|MRP1|OCT2	SSb2 increased OCT2 activity in OCT2-HEK293 cells by increasing the expression of OCT2 protein and mRNA; however, SSb2 inhibited MRP2 activity in MRP2-HEK293 cells by decreasing MRP2 protein expression, and decreased Pgp and MRP1 activity in Pgp- and MRP1-HEK293 cells.
+SARS:0cbd1447be1208e6013a8af7a24920b7899a7abf:abstract:69237f8d836d85ed8e9da11708ff352e:1445..1704:sentences:e8d291b7dca4577198e4fd977f26b875	SPSB2|PGP|ABCC1|ABCC2	SSb2|Pgp|MRP1|MRP2	Significance: SSb2 might potentially be the key active component of VBRB that enhances the hepatotargeting of anticancer drugs through the inhibition of multidrug resistance-associated drug transporters (Pgp, MRP1, and MRP2) in an environment-dependent manner.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:5188..5522:sentences:37450c0d7683e7d9c3f3d74f728108f7	CD40LG|IL4|IL10|IL21	CD40L|IL-4|IL-10|IL-21	Clones of human B cells have also been obtained by expanding individual cells with CD40L and cytokines like interleukin (IL)-2, IL-4, IL-10, and IL-21 (9) . Although a number of interesting monoclonal antibodies have been generated (for instance, 10), this technology has its limitations as B cells expand transiently in this protocol.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:5896..6418:sentences:3ee0635925aa52c21b45acc65610e21f	BCL6|CD40LG	BCL-6|CD40L	The observation by our group that forced expression of BCL-6 (which is known to inhibit terminal differentiation to plasma cells) in activated B cells enables these cells to continue proliferating in response to cytokines and CD40L is consistent with this hypothesis (11, 12) . In this review, we will give an overview of our work on regulation of self-renewal of B cells and how this knowledge led to the development of a convenient antibody discovery platform that is applicable to a wide range of species.. Introduction.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:6420..6640:sentences:29de474aba5a780b1682d53b77275ff3	STAT5B|BCL6	STAT5|BCL-6	Regulation of self-renewal of human B cells by STAT5 and BCL-6 B cells develop and are selected in the germinal center (GC) (13) structures in secondary lymphoid organs which arise as a consequence of antigen stimulation.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:6919..7135:sentences:83edb1145ca04bb8f5cb42eea1d08f8f	IL2|IL4|IL21||STAT3|STAT5B	IL-2|IL-4|IL-21|STAT|STAT3|STAT5	Cytokines that support B-cell differentiation in the GC include IL-2, IL-4 and IL-21, all of which activate signal transducers of activation and transcription (STAT), particularly STAT3 and STAT5 (14) .. Introduction.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:7137..7781:sentences:7d4ccc4fdb46dfe4c6cccb77224fca65	IL2RA|STAT5B|STAT5B|STAT5B|STAT5B|CD40LG|IL2|IL4|STAT5B|STAT5B|STAT3	CD25|STAT5|STAT5|STAT5|STAT5|CD40L|IL-2|IL-4|STAT5|STAT5|STAT3	CD25 + B cells that expressed phosphorylated STAT5 were found in the LZ of GCs of human tonsils suggesting that STAT5 plays a role in B cells in humans (15) . STAT5 is likely to be involved in the proliferation of human B cells as knockdown of STAT5 using RNA interference strongly decreased proliferation of B cells stimulated with CD40L in the presence of IL-2 and IL-4 (15) . To determine the exact role of STAT5 in B-cell functions, we expressed a fusion of STAT5 with a mutated domain of the estrogen receptor (ER) and STAT3 in activated B cells and examined the response of these cells following incubation with 4-hydroxy tamoxifen (4 HT).
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:7878..8123:sentences:81f0a953732ea82b3085552082daea2b	STAT5B|CD40LG	STAT5|CD40L	Interestingly, ectopic expression of a constitutive active form of STAT5 resulted in long-term in vitro proliferation of B cells cultured with CD40L and cytokines, whereas control transduced B cells proliferated only for a limited period of time.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:8286..8679:sentences:27fa01a0e49118eae4cd6e3fb0ee879c	STAT5B|CD19|STAT5B|STAT5B|IL4|IL4|STAT6|STAT5B	STAT5|CD19|STAT5|STAT5|IL-4|IL-4|STAT6|STAT5	Deletion of STAT5 in B cells using CD19 CRE and floxed STAT5 alleles did not result in diminished antibody production (16) . Also, STAT5-deficient mouse B cells proliferate normally in response to IgM stimulation and IL-4 (16) . Perhaps the growth-promoting effect of IL-4 in mice is exclusively mediated by STAT6, whereas in humans STAT5 may be involved in this process as well.. Introduction.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:8681..9075:sentences:c68387d5e24a1fb81ae9d5bbfd8ad510	STAT5B|BCL6|BCL6|CD40LG|STAT5B|BCL6	STAT5|BCL-6|BCL-6|CD40L|STAT5|BCL-6	The continued expansion of human B cells by constitutive activation of STAT5 is most likely mediated by control of its target BCL-6 because forced expression of BCL-6 in human B cells also resulted in sustained proliferation of human B cells in response to cytokines and CD40L (15, 17) . The effects of overexpression of active STAT5 in human B cells are however not identical to those of BCL-6.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:9077..9860:sentences:85bb13a191a14e931bf1e72b6a3cf802	STAT5B|STAT5B|BCL6|BCL6|BCL6|BCL6|AICDA|AICDA|SCARA3	STAT5|STAT5|BCL-6|BCL-6|BCL-6|BCL-6|activation-induced cytidine deaminase|AID|CSR	Most notably, continued overexpression and activation of STAT5 eventually result in downregulation of Ig gene expression and other B cell markers, presumably because of epigenetic repression (18) . STAT5-overexpressing cells eventually acquire features of Hodgkin lymphoma cells (19) . BCL-6 is highly expressed in GC B cells and studies in mouse have demonstrated that BCL-6 is essential for the formation of GC (20) . BCL-6 functions to support proliferation and to inhibit differentiation of proliferating B cells to plasma cells in mice (20) and humans (11) . BCL-6 also allows activation-induced cytidine deaminase (AID)mediated somatic hyper mutations (SHM) and class switch recombinations (CSR) which involves extensive DNA modifications by counteracting a DNA damage response.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:9862..10582:sentences:75856841f1073de896cbd547ae9ad9a8	BCL6|AICDA|PRDM1|PRDM1|XBP1|BCL6|PRDM1|BCL6|PRDM1|BCL6|PRDM1	BCL-6|AID|BLIMP-1|PRDM1|XBP-1|BCL-6|BLIMP1|BCL-6|BLIMP1|BCL-6|BLIMP1	BCL-6 regulates AID through repression of the microRNA, mir-155 (21) . Plasma cells are characterized by the expression of a different set of transcription factorsthe most important are BLIMP-1 (encoded by PRDM1), which is essential for plasma cell differentiation (22) , and XBP-1, which is needed for the formation of the machinery to secrete large amounts of antibodies (23, 24) . BCL-6 and BLIMP1 crossregulate each other as BCL-6 protein can bind to the PDRM1 locus and repress expression of BLIMP1, thereby inhibiting plasma cell differentiation (11, 25) . The ratio of BCL-6 and BLIMP1 is therefore one of the determining factors whether an activated B cell is poised to become a plasma cell or a memory cell type.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:11071..11236:sentences:008453103525c11944dc2005e27bc23f	BCL6|CD40LG	BCL-6|CD40L	In line with this, upon forced expression of BCL-6 in activated peripheral blood B cells cultured with cytokines and CD40L these cells acquire features of GC B cells.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:11512..11944:sentences:7ab9b8c4dffc6522ce7840f6a70525d3	BCL6|SCARA3|AICDA|BCL6|BCL6|AICDA	BCL-6|CSR|AID|BCL-6|BCL-6|AID	Not only do BCL-6 transduced peripheral blood-derived memory B cells express cell surface antigens that are also found on GC B cells, they also express AID (12, 13) . This enzyme mediates two important processes in GC B cells -SHM and CSR (26) . AID is functional in BCL-6-expressing B cells as cloned lines of BCL-6-expressing human B cells show mutations in the IgG H and L chains of the monoclonal antibody accumulating over time.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:11946..12066:sentences:68b3e42071a9790e75d02f7c0cdd566f	SCARA3|BCL6|SCARA3	CSR|BCL-6|CSR	Intriguingly, however, CSR does not occur in the BCL-6+ B cells indicating that SHM and CSR are differentially regulated.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:12068..12195:sentences:1ca71eb7c4b44353e071b748325db305	SCARA3|AICDA	CSR|AID	That CSR and SHM use different domains of AID and therefore can be uncoupled from SHM and gene conversion has been shown before.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:12298..12497:sentences:94761d41a8174cf49970a594b8f2aaea	BCL6|IL21|STAT3	BCL-6|IL-21|STAT3	Taken together, BCL-6 seems to be a master regulator conferring a GC phenotype and function to peripheral blood memory B cells.. IL-21 is a strong inducer of human B-cell maturation by inducing STAT3.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:12994..13346:sentences:922ff24fe77e8101ed46561cc7a9f632	STAT3|STAT3|STAT3|IL10|IL21	STAT3|STAT3|STAT3|IL-10|IL-21	Although STAT3 deficiency impairs the function of T follicular helper cells, thereby hampering B-cell help (29) , deficiencies in STAT3 function also intrinsically affect the capacity of B cells to differentiate into antibody-secreting plasmablasts (30) . There are several cytokines that can induce STAT3 in activated B cells including IL-10 and IL-21.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:13348..13963:sentences:954359cbafe1ed3aaacf7e5eb77842cc	IL21|STAT3|IL21R|IL21|XBP1|STAT3|STAT5B|STAT3	IL-21|STAT3|IL-21R|IL-21|XBP-1|STAT3|STAT5|STAT3	Of those, IL-21 is most likely the dominant STAT3 inducer in B cells as patients with IL-21R mutations have deficiencies in antibody responses (31) . Moreover, IL-21 most strongly induces expression of PDRM1 and XBP-1 in activated naive and memory B cells resulting in plasma cell differentiation and increased antibody production (11, 32) . To study the effects of STAT3 activation in the absence of cytokine signaling, we followed the same approach as with STAT5, expressing a fusion of STAT3 with a mutated domain of ER in activated B cells and examined the response of these cells following incubation with 4 HT.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:13965..14229:sentences:9a1b27f2e8cc540f58d4b52d44144836	STAT3|PRDM1|XBP1|IL21|STAT3|BCL6|IL21|STAT3	STAT3|BLIMP1|XBP1|IL-21|STAT3|BCL-6|IL-21|STAT3	These experiments revealed that activation of STAT3 itself increased expression of BLIMP1 and XBP1 similar to IL-21, suggesting that these transcription factors are controlled by STAT3 (11) . However, whereas BCL-6 was induced by IL-21, it was not induced by STAT3.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:14231..14401:sentences:2e50d64deac4cdfe9798603013a6b0e6	IL21|STAT5B|BCL6|STAT5B|IL21|BCL6|STAT5B	IL-21|STAT5|BCL6|STAT5|IL-21|BCL-6|STAT5	Because IL-21 transiently induces STAT5 phosphorylation and BCL6 is a direct target of STAT5 in human B cells (15) , it is likely that IL-21 regulates BCL-6 through STAT5.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:14403..14625:sentences:38199d663fa4b053145a9e6337ab45b2	STAT5B|BCL6|IL21|IL21|CD40LG|BCL6|BCL2L1	STAT5|BCL-6|IL-21|IL-21|CD40L|BCL-6|BCL-XL	However, STAT5 and BCL-6 are not sustained by IL-21, and eventually B cells cultured with IL-21 and CD40L differentiate terminally to plasma cells (11) .. Immortalization of human B cells by overexpressing BCL-6 and BCL-XL.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:14876..15092:sentences:e0c002c2e868635618235472b0918943	BCL6|CD40LG	BCL-6|CD40L	By forced expression of BCL-6 into B cells by retrovirus-mediated gene transfer, we prevent those cells from differentiating into plasma cells in a culture system with CD40L-expressing mouse fibroblasts and cytokines.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:15376..15515:sentences:a7f96f42ba7780a928d4d081a4220347	BCL2|BCL6	BCL-2|BCL-6	Indeed co-expression of a variety of genes encoding BCL-2 family members resulted in a strong inhibition of death of BCL-6-transduced cells.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:15517..15683:sentences:166a1dbe361ea48e6979d13628f65f5d	BCL2L1|BCL2|MCL1|BCL6|BCL2L1	BCL-XL|BCL-2|MCL1|BCL-6|BCL-XL	The best effect was observed with BCL-XL but BCL-2 and MCL1 were also effective (data not shown).. Immortalization of human B cells by overexpressing BCL-6 and BCL-XL.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:15685..15802:sentences:cb29dc72ee18912f2783064c9223bfb9	BCL6|BCL2L1|IL4|IL10|IL21	BCL-6|BCL-XL|IL-4|IL-10|IL-21	BCL-6/BCL-XL-transduced B cells expand rapidly in response to a variety of cytokines including IL-4, IL-10, and IL-21.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:16061..16213:sentences:6cd3192a1d1ac082624600bb46f1d930	IL4|IL21	IL-4|IL-21	Besides the differences in effects on proliferation, we also observed differences in the capacities of IL-4 and IL-21 to induce production of antibodies.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:16215..16430:sentences:c4e3c34aa0966847cd9661249c05da74	IL21|IL4|STAT3|BCL6|BCL2L1	IL-21|IL-4|STAT3|BCL-6|BCL-XL	IL-21 induced the highest antibody titers most likely because, in contrast to IL-4, it activates STAT3 which promotes the secretion of antibodies.. Immortalization of human B cells by overexpressing BCL-6 and BCL-XL.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:16432..16633:sentences:9901450617b694263dc8a6c10d29ca42	BCL6|BCL2L1|CD40LG|IL21	BCL-6|BCL-XL|CD40L|IL-21	The combination of BCL-6 and BCL-XL overexpression and the CD40L/IL-21 culture system provides us with B cells that have several properties that enable the isolation of antigen-specific antibodies (Fig.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:16917..17456:sentences:d30c7323da1843aa2410778ad6a51ae7	MTRF1|BCL6|BCL2L1	rF1|BCL-6|BCL-XL	Using this direct functional screening approach, we identified the respiratory syncytial virus (RSV)-specific antibodies D25, AM14, AM16, and AM23 (12), cross-neutralizing antibodies against Parecho virus (33) , and the Staphylococcus aureus-specific antibody rF1 (34) . Antibody secretion is maintained and stable during B-cell culture allowing multiple rounds of cellular cloning and the ability to perform multiple screening assays during the selection process (35) .. Immortalization of human B cells by overexpressing BCL-6 and BCL-XL.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:25449..25688:sentences:eedb0f0f35634af2488cc9b6cdedc2f2	|HIST1H1E|HIST1H1B	group 1 comprises H1, H2, H5, H6, H8, H9, H11, H12, H13, H16, H17, and H18|H14|H15	Eighteen subtypes of HA have been identified which cluster in two groups (62) based on their sequence homology (group 1 comprises H1, H2, H5, H6, H8, H9, H11, H12, H13, H16, H17, and H18 and group 2 comprises H3, H4, H7, H10, H14, and H15).
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:25690..25834:sentences:85e8825cc0e30e858ac1c7625fd942ac	H1FOO|H1FNT	H18|H17	Of note, H17 and H18 have been recently identified in bats and do not bind to sialic acids (reviewed in 63).. Antibodies against influenza virus.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:26331..26714:sentences:ed709744aff76242c9112957b6627502	HMHA1|MYO1G	HA1|HA2	Although these antibodies are directed against HA and prevent viral infection, they do not block the sialic acid binding site located at the top of HA molecule (HA1) but inhibit the conformational changes needed for the fusion of the viral and endosomal membranes (66, 67) . This is mediated by binding of the antibody to a conserved hydrophobic pocket in the stem domain of HA (HA2).
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:30468..30873:sentences:4f08ac6f0cd99cd5fcfb482238d95d79	AICDA|BCL6|BCL2L1	AICDA|BCL6|BCL-XL	In line with their GC-like phenotype AICDA transcripts are expressed in BCL6/BCL-XL-transduced B cells in similar quantities as tonsil-derived GC B cells (12) . Sequence analysis of transduced B cells revealed that mutations are present in the Ig locus and that they are mainly localized in the CDRs and framework region-3 indicating that the occurrence of these mutations was site-directed and not random.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:31117..31328:sentences:33942b31a7b8626cb46576dd7d372503	BCL6|BCL2L1	BCL6|BCL-XL	This ongoing somatic hypermutation does not lead to the loss specificity of the whole B-cell pool as mutated B cells only form a very small part of the total population of cultured BCL6/BCL-XL-transduced B cells.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:31652..31763:sentences:c2876d50fc4b4f06a4d072561f328315	AICDA|TCF3	AID|E47	It has been documented that AID expression is controlled by the basic helix-loop-helix transcription factor E47.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:31765..32136:sentences:db9d6d038557afc551c85382ef075fcb	ID2|ID3|TCF3|ID3|AICDA|AICDA|AICDA	Id2|Id3|E47|Id3|AID|AID|AICDA	The activity of this transcription factor can be inhibited by Id2 and Id3, which bind to E47 forming an inactive complex (78) . As a consequence, overexpression of helix-loop-helix factor inhibitor of DNA binding-3 (Id3) strongly reduced AICDA transcripts thereby providing a method to prevent AID-induced mutations.. Application of AID expression in immortalized B cells.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:32677..32902:sentences:485460c41d4d4daadeb7e58e3d7966d8	BCL6|BCL2L1	BCL6|BCL-XL	The ability to optimize antibody performance without the need for extensive sequence analysis and molecular cloning is one of the unique properties of the BCL6/BCL-XL antibody discovery platform.. Application in other species.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:33261..33370:sentences:15972dabc03370ee708bd8e8096d4ca4	BCL6|BCL2L1	BCL-6|BCL-XL	We explored if immortalization by introduction of BCL-6 and BCL-XL could also be applied to non-human species.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:35540..35827:sentences:5389dd1f53ff372dc3a809c8bbd3ea86	BCL6|BCL2L1	BCL-6|BCL-XL	As indicated in the previous paragraph, the identification of rare B cells producing exceptional antibodies for instance with desired cross-reactivities is not a problem when using BCL-6 and BCL-XL-transduced rabbit B cells.. Discovery of monoclonal antibodies from rabbit memory B cells.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:38521..38920:sentences:69698fdcda47eafbe281688f87b36c16	CD40LG|IL4|BCL6|BCL2L1	CD40L|IL-4|BCL-6|BCL-XL	Thus, in physiological conditions, only antigens for which the B cells have a BCR are taken up, processed, and presented to T cells (82) . Human B cells expanded with CD40L and IL-4 have been shown to present antigenic peptides (83) . Antigen-specific BCL-6/BCL-XL-transduced B cells are able to present native antigen to T cells as was also demonstrated for antigen-specific EBV-transformed B cells.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:39191..39330:sentences:e10674da20afd05312992c4ad4e9d4ba	BCL6|BCL2L1	BCL-6|BCL-XL	As expected, the BCL-6/BCL-XL B cells present various antigenic peptides efficiently to autologous T cells independently of BCR specificity.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:39786..39883:sentences:23083cb810613f4455db5d765bfc0cc9	BCL6|BCL2L1	BCL6|BCL-XL	As antigen-presenting cell, they used BCL6/BCL-XL-transduced B cells established from the patient.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:39992..40221:sentences:e1a33cb869c45ffe9c3d54e4bc2b72a4	BCL6|BCL2L1	BCL-6|BCL-XL	By contrast, EBV-transformed B cells derived from patient's B cells stimulate EBV antigen-specific T cells which mask the response to neoantigens (84) showing the importance of the BCL-6/BCL-XL-transduced B cells in this strategy.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:40223..40480:sentences:9f615f7a73b893c91879d63feba9f072	BCL6|BCL2L1	BCL-6|BCL-XL	Neoantigens could also be found by screenings using monocyte-derived dendritic cells (DC) (85) but those DC cannot be expanded in vitro, in contrast to BCL-6/BCL-XL-transduced B cells, limiting their use in large-scale high-throughput screening.. Conclusion.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:40575..40714:sentences:5d56896e4f39a75f250dbc1b0a3ea51b	BCL6|BCL2L1	BCL6|BCL-XL	Nearly the complete B-cell repertoire is captured using a highly efficient transduction of a retroviral construct harboring BCL6 and BCL-XL.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:40851..41076:sentences:31ad8ad1f6272f351ffccfff1e4f18de	BCL6|BCL2L1	BCL6|BCL-XL	BCL6/BCL-XL-transduced B cells have a plasmablast-like phenotype secreting antibodies in the supernatant and expressing the BCR on their surface, which makes them an excellent source for the discovery of monoclonal antibodies.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:42748..42823:sentences:e6eb1f1dfa08e07e43dff88e17cb6906	AICDA|BCL6|BCL2L1	AID|BCL-6|BCL-XL	One example concerns the function of AID in BCL-6/BCL-XL-transduced B cells.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:42825..42962:sentences:b6c17cbf936f2006c1e9f5097518b185	AICDA|SCARA3|SCARA3	AID|CSR|CSR	Surprisingly, SHM are observed in these cells but not CSR, indicating that yet to be identified signals are required for AID-mediated CSR.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:42964..43375:sentences:fdf15ba573a5ee505928ab74cc1744ce	AICDA|BCL6|BCL2L1	AID|BCL-6|BCL-XL	Aside from the scientific questions that AID expression in BCL-6/BCL-XL-transduced B cells raises, we could use this feature to generate subclones of antigenspecific B cells that secrete antibodies with either higher or lower affinities than of the antibody produced by the parental clone, thereby offering a method to affinity mature antibodies without the need for extensive molecular engineering.. Conclusion.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:43377..43456:sentences:1d4b94a46695e9ea6096f47fe03df822	BCL6|BCL2L1	BCL-6|BCL-XL	Finally, BCL-6/BCL-XL-transduced B cells are excellent antigen-presenting cells.
+SARS:0bcc4d843bd37ae1c8623e45dab6fff11263f798:fulltext:65a363460755b8ad1379eb27345d3feb:43708..43867:sentences:9b8d98f8c722a5832884b7bcda88ea51	BCL6|BCL2L1	BCL6|BCL-XL	Importantly, cultures of BCL6/BCL-XL-transduced B cells can be established from any cancer patient providing a convenient source of APC to discover neoantigens.
+SARS:0d0a0fdfcb384b60703d3ea329672f668d7c118e:abstract:771934638a218885059c95773ceefbdb:244..395:sentences:43bf2f0a43c4d0e9459df224e72a370a	ABCB1|	multidrug resistance protein 1|PfMDR1	Two multi-spanning food vacuole membrane proteins are known, the multidrug resistance protein 1 (PfMDR1) and Chloroquine Resistance Transporter (PfCRT).
+SARS:0d3de075e16c6d2e02c68e541b4d2654c78bea04:fulltext:66f1f9a8a1b1f8a78d744323383a469c:4935..5113:sentences:18c48ccf52740224d8b21c34f6b9738a	CD34|ACTB	CD34|actin	On immunohistochemistry (IHC), diffuse positivity for HHV8 and CD34 was seen in the tumoural area, and that for factor VIII, actin and smooth muscle actin in the rich vasculature.
+SARS:0d3de075e16c6d2e02c68e541b4d2654c78bea04:fulltext:66f1f9a8a1b1f8a78d744323383a469c:5115..5326:sentences:03541338783966730298ec2ab81c09be	ITIH4|||FCGR3B|CD4|	gp120|p24|p17|CD16|CD4|CD16/56	At the same time, an HIV test was positive (HIV-1 gp120, gp41, p24 and p17 were detected), and a T-lymphocyte count in peripheral blood showed no CD4 + cells, and reduced counts of CD3 + and CD16/56 + CD3  cells.
+SARS:0d3de075e16c6d2e02c68e541b4d2654c78bea04:fulltext:66f1f9a8a1b1f8a78d744323383a469c:8817..8887:sentences:3a46f598fb8322674f9a9d785b1abfe7	PECAM1|CD34	CD31|CD34	On IHC, typical markers are CD31, CD34 and factor VIII-related antigen.
+SARS:0d3de075e16c6d2e02c68e541b4d2654c78bea04:fulltext:66f1f9a8a1b1f8a78d744323383a469c:8889..9094:sentences:c737873165214b8722b642e157988e22	LYVE1|FLT4|FLT4|PROX1|PROX1	LYVE-1|VEGFR-3|vascular endothelial growth factor receptor-3|Prox-1|Prospero-related homeobox-1	Spindle cells express lymphatic markers such as LYVE-1 (lymphatic vessel endothelial hyaluronan receptor-1), VEGFR-3 (vascular endothelial growth factor receptor-3) and Prox-1 (Prospero-related homeobox-1).
+SARS:0d0eb05f0122ccefa581d331130bb9e2a7e62630:abstract:7d5e950147f625169c1bf94721c7692f:1104..1488:sentences:2884dde09c7d3ce321d0f8eda7506fb2	HLA-A|HLA-DRB1	HLA-A|HLA DRB1	Subsequently, the molecular docking studies were verified molecular interaction of these prime antigenic peptides with the residues of HLA-A*11-01 allele for MHC Class I and HLA DRB1*04-01 allele for MHC class II. After vigorous analysis, these peptides were predicted to be suitable epitopes which are capable to elicit the strong cell-mediated immune response against the SARS-CoV-2.
+SARS:0d32ef4cf9de814b91863b82011724356136aeb1:abstract:a761fe0d2c763fa348cea1c08792111c:0..184:sentences:fc508667b4a6d8b31831ee33b1bad2d7	ACE2|TMPRSS2	ACE2|TMPRSS2	Abstract Objective To describe detection of SARS-CoV-2 in seminal fluid of patients recovering from COVID-19 and describe the expression profile of ACE2 and TMPRSS2 within the testicle.
+SARS:0d32ef4cf9de814b91863b82011724356136aeb1:abstract:a761fe0d2c763fa348cea1c08792111c:597..733:sentences:e0b35333807ad3ed4e6f15472c304de7	ACE2|TMPRSS2	ACE2|TMPRSS2	Expression patterns of ACE2 and TMPRSS2 in the human testis are explored through previously published single-cell transcriptome datasets.
+SARS:0d32ef4cf9de814b91863b82011724356136aeb1:abstract:a761fe0d2c763fa348cea1c08792111c:972..1101:sentences:6dffef1d4b96d7b22adf59cc079e4bfc	ACE2|TMPRSS2	ACE2|TMPRSS2	Single-cell transcriptome analysis demonstrates sparse expression of ACE2 and TMPRSS2, with almost no overlapping gene expression.
+SARS:0d32ef4cf9de814b91863b82011724356136aeb1:abstract:a761fe0d2c763fa348cea1c08792111c:1229..1375:sentences:e0afbf209ad376bbd136918ee2b07494	ACE2|ACE2|TMPRSS2	ACE2|ACE2|TMPRSS2	ACE2-mediated viral entry of SARS-CoV-2 into target host cells is unlikely to occur within the human testicle based on ACE2 and TMPRSS2 expression.
+SARS:0d8f8313ebf345a47ae755d7f470b393a79893fe:abstract:0aa3584c7c43676580759fc7c7e81919:1185..1354:sentences:ae3f72bf283a905e393dcbf2bd6d1fd4	CD63|LAMP1	CD63|Lamp1	ORF6 showed partial colocalization with cellular proteins CD63 and Lamp1, suggesting that the vesicular structures may be a subpopulation of endosomal/lysosomal vesicles.
+SARS:0da2ec30d7dfdef624833a36890f0297f19d09ec:abstract:9187aa85a75b5ff8d1a141bd3d415338:1093..1136:sentences:8a5961171f87cc8b85da28ff4bc90432	MAF|TNC	MAF|TNC	1% MAF, combined ancestries), TNC (p=0.0221%
+SARS:0da2ec30d7dfdef624833a36890f0297f19d09ec:abstract:9187aa85a75b5ff8d1a141bd3d415338:1138..1184:sentences:7705b29dc8860cdf73b32f420e9669ad	MAF|MACF1	MAF|MACF1	MAF, combined ancestries), and MACF1 (p=0.0245,
+SARS:0da2ec30d7dfdef624833a36890f0297f19d09ec:abstract:9187aa85a75b5ff8d1a141bd3d415338:1456..1635:sentences:aa37cf7e706cab5aa8ec4af449083583	PRTG|TNC|MACF1	PRTG|TNC|MACF1	However, PRTG, TNC, and MACF1 are potential novel recessive epilepsy genes and our results highlight that compound heterozygous mutations should be considered in sporadic epilepsy.
+SARS:0d8784d230453109b9340461f2692f0f2d048927:title:075f859174c892cead71500ad9d117b8:0..85:sentences:e7696a643860c4981740b3e2a6ce484d	IFITM5|FKBP11	IFITM5|FKBP11	Role of S-Palmitoylation on IFITM5 for the Interaction with FKBP11 in Osteoblast Cells
+SARS:0d8784d230453109b9340461f2692f0f2d048927:abstract:d51998c48a6ad73189e177b466ddb987:651..861:sentences:c08ee0ccd51206c302264d3e4626b128	IFITM5|FKBP11|FKBP11	IFITM5|FK506-binding protein 11|FKBP11	IFITM5 is another IFITM family protein and interacts with the FK506-binding protein 11 (FKBP11) to form a higher-order complex in osteoblast cells, which induces the expression of immunologically relevant genes.
+SARS:0d8784d230453109b9340461f2692f0f2d048927:abstract:d51998c48a6ad73189e177b466ddb987:863..1050:sentences:f96ad7c22b8a2c22dacdfc1961e45760	IFITM5|FKBP11	IFITM5|FKBP11	In this study, we investigated the role played by S-palmitoylation of IFITM5 in its interaction with FKBP11 in the cells, because this interaction is a key process for the gene expression.
+SARS:0d8784d230453109b9340461f2692f0f2d048927:abstract:d51998c48a6ad73189e177b466ddb987:1052..1267:sentences:817e244974a2f23e9c6f379dc92c51bc	IFITM5|IFITM3	IFITM5|IFITM3	Our investigations using an established reporter, 17-octadecynoic acid (17-ODYA), and an inhibitor for the S-palmitoylation, 2-bromopalmitic acid (2BP), revealed that IFITM5 was S-palmitoylated in addition to IFITM3.
+SARS:0d8784d230453109b9340461f2692f0f2d048927:abstract:d51998c48a6ad73189e177b466ddb987:1384..1530:sentences:1d3d5a52cd6906966d8bde4ec8ca52a9	IFITM5|FKBP11	IFITM5|FKBP11	Then, we revealed by immunoprecipitation and western blot analyses that the interaction of IFITM5 with FKBP11 was inhibited in the presence of 2BP.
+SARS:0d8784d230453109b9340461f2692f0f2d048927:abstract:d51998c48a6ad73189e177b466ddb987:1629..1724:sentences:28db794edd80a311165b2c1fa67a20fa	IFITM5|FKBP11	IFITM5|FKBP11	These results indicate that the S-palmitoylation on IFITM5 promotes the interaction with FKBP11.
+SARS:0dfb48c89f5609eb7c645aad320b3a2c70d07ec7:abstract:c5754be3deac2c7850af102b8bba8a19:360..430:sentences:2677cc010e65ee0071b14fed467f949b	CXCL10|IL8	IP-10|IL-8	By contrast, chemokines such as IP-10 or IL-8 are strongly upregulated.
+SARS:0df4acedd15922e72eb97cc24fcc7c77f866aa11:abstract:322aa6fa205260f96ae0c4b23b8b1432:235..392:sentences:88273cf6c511d1b4a90a6ecfa6ef3135	|SARS	scFv|SARS	To profile the anti-N antibodies, a phage-displayed scFv library was prepared from mice immunized with heat-inactivated SARS-CoV-infected Vero E6 cell lysate.
+SARS:0df4acedd15922e72eb97cc24fcc7c77f866aa11:abstract:322aa6fa205260f96ae0c4b23b8b1432:531..765:sentences:6a610eaf526bb74fe050c8bd40cb0246	|IL11|IL11|	scFv|interleukin 11|IL-11|scFv	Sequence analysis indicated that two of the isolated anti-N scFv clones were identical and displayed a high homology with an scFv specific for interleukin 11 (IL-11), an anti-inflammatory cytokine derived from bone marrow stroma cells.
+SARS:0df4acedd15922e72eb97cc24fcc7c77f866aa11:abstract:322aa6fa205260f96ae0c4b23b8b1432:767..929:sentences:6073de13ae2b938ba9fae60c6c768c44	IL11|STAT3|	IL-11|STAT 3|scFv	In a neutralization assay, IL-11-induced STAT 3 phosphorylation in rat intestinal epithelial IEC-18 cells was completely suppressed by the anti-N scFv clone L9N01.
+SARS:0e24e06b66ebf676c3d15bbcaf7120dc60413702:abstract:b986d0cc244aa469defa0413ccbe1fa3:420..705:sentences:b64511fbf91353101e71c5b3317a0fd2	IL6|IL8|CXCL10	interleukin (IL)-6|IL-8|IP-10	Analysis of gene signatures revealed induction of a strong innate immune response characterized by the stimulation of various cytokine and chemokine genes, including interleukin (IL)-6, IL-8, and IP-10, which corresponds to the host response seen in acute respiratory distress syndrome.
+SARS:0e24e06b66ebf676c3d15bbcaf7120dc60413702:abstract:b986d0cc244aa469defa0413ccbe1fa3:707..926:sentences:304343cf4aab037f0ca1e8b4bc5928a3	STAT1|SARS	signal transducer and activator of transcription 1|SARS	As opposed to many in vitro experiments, SARS-CoV induced a wide range of type I interferons (IFNs) and nuclear translocation of phosphorylated signal transducer and activator of transcription 1 in the lungs of macaques.
+SARS:0e26889f9cffa6531cfef5b27d1f09734d98333f:fulltext:aa43aa3ffbb8db9a89768c9f775b7807:10923..11148:sentences:4911aa24dac61138d1f074939e6a0f95	|RRAD	IgH|Rad	The goat anti-human IgH (A + G + M) (Millipore, Zug, Switzerland) was diluted 1:60 000, the goat anti-mouse IgG (Bio-Rad, Reinach, Switzerland) diluted 1:1000 and the goat anti-rabbit IgG (Abcam, Cambridge, UK) diluted 1:2000.
+SARS:0e26889f9cffa6531cfef5b27d1f09734d98333f:fulltext:aa43aa3ffbb8db9a89768c9f775b7807:34402..34575:sentences:4f7ca13e4347586ffc83d0d1d5dd679c	OMP|HSPD1	Omp|GroEL	Consequently, some interesting proteins showing low identity with other Chlamydiales proteins such as the Omp were detected in the same spot of conserved proteins like GroEL.
+SARS:0dc8d11784da63b899dbb2b404be4efd330e4ac3:fulltext:d8c44dc0f89d92d0fddfa6e534e9a447:694..998:sentences:4dd3307cc30801d9a1c9ddd664357959	CFTR|RRAD	CFTR|rAd	2 In 1993, the first human gene therapy study based on Ads was performed, a 23-year-old man with cystic fibrosis homozygous received the first in vivo gene therapy with administration of an E1-E3-deleted rAd vector expressing the normal human CFTR, and the subsequent clinical studies were then initiated.
+SARS:0dc8d11784da63b899dbb2b404be4efd330e4ac3:fulltext:d8c44dc0f89d92d0fddfa6e534e9a447:3483..3591:sentences:c5c705172e0da854903541573d077b5a	|TP53|BAK1|BAX	E1B|p53|Bak|Bax	The E1B protein generally suppresses the apoptosis of the host cells by binding to p53, Bak and Bax proteins.
+SARS:0dc8d11784da63b899dbb2b404be4efd330e4ac3:fulltext:d8c44dc0f89d92d0fddfa6e534e9a447:6825..6981:sentences:8a8c1f819046697fe94f042aaafb28e5	CD46|DSG2	CD46|DSG2	In fact, many other receptors for the entry of Ad have been found, for examples, CD46 or DSG2 for subtype B Ads, 40, 41 and sialic acid and integrins, et al.
+SARS:0dc8d11784da63b899dbb2b404be4efd330e4ac3:fulltext:d8c44dc0f89d92d0fddfa6e534e9a447:11700..12176:sentences:2bc4c63a5e0ea4d17dd6cde001a3e449	CD8A|CD4	CD8|CD4	As reported by Churchyard GJ and Koup RA, et al, 53 ,102 a DNA plasmid encoding multiple HIV genes from multiple clades for priming at 0,1 and 2 month respectively at a dose of 4 mg, and AdHu5 expressing multiple HIV genes for boosting at 6 month induced polyfunctional CD4 C and CD8 C T cells as well as the anti-envelop binding antibodies, which revealed the heterologous prime-boost regimen was a potent immunization strategy for inducing both antibody and T cell responses.
+SARS:0dc8d11784da63b899dbb2b404be4efd330e4ac3:fulltext:d8c44dc0f89d92d0fddfa6e534e9a447:20256..20504:sentences:fe27829253c564c6e6eff33ac8f9d922	CD8A|CD4	CD8|CD4	In this study, the preexisting neutralizing antibodies to AdHu5 was also noted, but it didn't appear to affect the T cell response to Ebola GP since 32% to 82% subjects responded with more CD4 C than CD8 C T cells.. Ebola vaccine based on Ad vector.
+SARS:0dc8d11784da63b899dbb2b404be4efd330e4ac3:fulltext:d8c44dc0f89d92d0fddfa6e534e9a447:27118..27233:sentences:46190c2f960451ad0bb71787ebaccd80	CSF2|DKK3	GMCSF|REIC	126 Ads can be armed with immune modulator such as GMCSF or REIC to induced cytotoxic T lymphocytes against cancers.
+SARS:0dc8d11784da63b899dbb2b404be4efd330e4ac3:fulltext:d8c44dc0f89d92d0fddfa6e534e9a447:28298..28478:sentences:cd16a87bed8fefe5ec981c2c123774b5	VEGFA|	VEGF|E1B	To induce and maintain the long-lasting silencing of VEGF, the study constructed E1A-mutated, E1B-deleted Ads with shVEGF expressing at the E3 region under the drive of U6 promoter.
+SARS:0dc8d11784da63b899dbb2b404be4efd330e4ac3:fulltext:d8c44dc0f89d92d0fddfa6e534e9a447:29453..29709:sentences:20a47664910ba9b49379a586b6312000	ERBB3|ERBB3|ERBB4|ERBB4|ERBB3	HER3|ErbB3|HER4|ErbB4|HER3	The fiber-modified Ad virions showed enhanced infection of cells expressing the cognate receptors HER3/ErbB3 and HER4/ ErbB4, so the HER3-expressing Chinese hamster ovary (CHO) cells could be transduced by the HRG-modified virus, but not by wild type virus.
+SARS:0e5c57371f4f2cf8e3d56871a391c25ee43aaa4f:abstract:1f437c965225f9b8491fe2019e3761c5:1410..1557:sentences:25e8ca953042fa349a70f7530767b26b	CCND1|CDK4	cyclin D1|cyclin-dependent kinase 4	After lycorine treatment, cyclin D1 and cyclin-dependent kinase 4 expressions were inhibited and retinoblastoma protein phosphorylation was reduced.
+SARS:0e5c57371f4f2cf8e3d56871a391c25ee43aaa4f:abstract:1f437c965225f9b8491fe2019e3761c5:1559..1663:sentences:1f9e642c0c42a909d3da7933623b1925	TP53|CDKN1A	p53|p21	Lycorine treatment also significantly upregulated the expression of p53 and its target gene product, p21.
+SARS:0e56e0cbabdc46578f0d5aed2b46e68f370cd1b1:abstract:eb180efd19340e630fc88450c8fd9eaf:1671..1899:sentences:0113f090aafa02005bd482cf37d4f604	IRF3|IRF7|IRF3|IRF7	IRF3|IRF7|IRF3|IRF7	In addition, overexpression of EcTRIM8 significantly increased the transcription of interferon regulator factor 3 (IRF3) and IRF7, and enhanced IRF3 or IRF7 induced interferon-stimulated response element (ISRE) promoter activity.
+SARS:0e2c97d34c8c6042f26cc11e83e1a2fbac521203:fulltext:c4db833debfec34e0672fe22dd3d7ab3:9515..9626:sentences:fee058202628b28134bdc3a3e5cb57e2	STAG1|	SA1|SE N	and the MERS-CoV SA1 isolate and then demonstrated that these sera recognized the BtCoV HKU5-SE N protein ( Fig.
+SARS:0e2c97d34c8c6042f26cc11e83e1a2fbac521203:fulltext:c4db833debfec34e0672fe22dd3d7ab3:25695..26026:sentences:464bd9641b72a51cab122661035bfb9e	SPECC1|NR3C1|SPECC1	nsp5|GRL|nsp5	Among the Coronaviridae, nsp5 (3CLpro) inhibitors have been shown to be successful in inhibiting SARS-CoV replication in vitro (22, 23) . Using biochemical assays, the candidate drug GRL-001 inhibits MERS-CoV and BtCoV HKU5-SE nsp5 protease activity (24) and reduces MERS-CoV and BtCoV HKU5-SE replication by over 100-fold in vitro.
+SARS:0e2c97d34c8c6042f26cc11e83e1a2fbac521203:fulltext:c4db833debfec34e0672fe22dd3d7ab3:26996..27410:sentences:ed0069b6332e4afe04f4a76e2b2e5f9a	CEACAM1|CEACAM1|ACE2	carcinoembryonic antigen-related cell adhesion molecule 1|CEACAM1|ACE2	In contrast to other coronaviruses, such as mouse hepatitis virus, which can still replicate and produce disease in carcinoembryonic antigen-related cell adhesion molecule 1-deficient (CEACAM1 / ) animals (44) , the replication and pathogenesis of BtCoV HKU5-SE was completely dependent upon the presence of the mouse ACE2 receptor, as the ACE2 / mice clearly showed no weight loss or evidence of virus replication.
+SARS:0f066adacdbf0610f4a16ce884250d53586d3040:abstract:6baaa4d572dfcccffe607865860bef09:623..723:sentences:c4b0fc230400a90307cf009b5adef08d	SF1|SRSF1	SF1|SF2	Viral helicases belong to three out of the six currently recognized superfamilies, SF1, SF2, and SF3.
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:4125..4878:sentences:2de344dbaef4b712cff8aec91f6e320b	RAF1|	NS5|MK-0608	Often, such chimeric structures are nonfunctional (10) . Applying this principle to viral infections, we have shown that, although mutant poliovirus genomes that are resistant to capsid inhibitor V-073 could be readily generated, they were not selected in cultured cells or in mice (11) . We termed viral targets such as the poliovirus capsid, for which drug-susceptible genomes are dominant over their drug-resistant siblings, "dominant drug targets.". . To identify dominant drug targets in the dengue virus genome, we tested the effects of two different antiviral compounds: MK-0608, a nucleoside analog that inhibits the viral NS5 polymerase, and ST-148, a planar compound that inhibits the function of core protein, an oligomeric structural protein.
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:11021..11364:sentences:09d512e1f60f07f586fffae9230008d9	RAF1|	NS5|MK-0608	That the drug-resistant protein fractionates differently when in the presence of the drug-susceptible protein supports the hypothesis that the two kinds of proteins coassemble.. Susceptibility to core inhibitor ST-148 is genetically dominant.. Mutations in the NS5 methyltransferase domain confer resistance to the nucleoside inhibitor MK-0608.
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:12583..12862:sentences:4911bdfa845696152d17516d8a65bf07	RAF1|RAF1|RAF1|	NS5|NS5|NS5|MK-0608	Notably, only the two viral pools passaged in the presence of MK-0608 acquired mutations in the NS5 coding region: A60T in pool 1 and Y201H in pool 2 (Table 1) . When tested individually, the NS5-A60T and NS5-Y201H mutations to select for resistance to the inhibitor (black bars).
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:13463..13591:sentences:ebd8a3b404c984268cb51d16093c9e67	RAF1|RAF1|	NS5|NS5|MK-0608	(C) Wild-type, NS5-A60T, and NS5-Y201H viruses were used to infect BHK cells in the absence or presence of MK-0608, as indicated.
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:17015..17281:sentences:39ea7ac2c9465e1199f13c6fbb386b61	IFNAR1|IFNGR1	IFNAR|IFNGR	A frequently used mouse model for dengue virus infection is intravenous inoculation into strain 129 IFNAR / IFNGR / (alpha and gamma interferon [IFN]-deficient) mice (15, 17, 18) . Virus could be readily detected in spleens of infected mice 4 days postinfection (Fig.
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:17488..18141:sentences:aa256a7967cf8557862bcd546fb61fff	IFNGR1|IFNGR1|	IFNGR|IFNGR|MK-0608	As this higher yield facilitated the detection of subpopulations such as drug-resistant viruses, we employed C57BL/6 IFNAR / IFNGR / mice to measure drugresistant viruses during treatment of dengue virus-infected mice with ST-148 or MK-0608.. Susceptibility to core inhibitor ST-148 is genetically dominant.. To ask whether ST-148-resistant viruses could be selected during murine infection, C57BL/6 IFNAR / IFNGR / mice were inoculated with dengue virus and treated orally with ST-148, or vehicle solution as a control, twice daily for 4 days as described previously (12) . Treatment with ST-148 led to a significant decrease in dengue virus yield (Fig.
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:18658..18848:sentences:b89d03c979cecbea8b88a57979880b66	IFNGR1||	IFNGR|MK-0608|MK-0608	To document any selection for resistance to MK-0608 during murine infection, C57BL/6 IFNAR / IFNGR / mice were infected and treated orally twice daily with MK-0608 at 40 mg/kg of body weight.
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:23476..23620:sentences:f2ed017cf235323ab6092dae1c899e39	RAF1|	NS5|MK-0608	It is intriguing that the two mutations conferring MK-0608 resistance identified in this work mapped to the methyltransferase domain of NS5 (Fig.
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:28974..29142:sentences:6e7e7190e1b7ce79ba70e3c019906fe1	IFNGR1|IFNAR1	IFNGR|IFNAR	Envelope muta- tions N124D and K128E, which confer increased pathogenicity in dengue virus-susceptible 129 IFNAR / IFNGR / mice (31), were introduced as described above.
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:32797..32941:sentences:5326a1f3d056dabed3a3aae01c504326	IFNAR1|IFNGR1	IFNAR|IFNGR	The 129 IFNAR / IFNGR / (129/SvEv-Ifnar1 tm1Agt Ifngr1 tm1Agt ) mice were obtained from Harry Greenberg (Stanford University School of Medicine).
+SARS:0e7c4297d1710cac2a64886cb9a748777b0cd03d:fulltext:7d377320f58b502fb5b8ffe638401b34:33453..33619:sentences:b4e3731ae47e236448d59aaa7ebf95e6	IFNAR1|IFNGR1|IFNGR1	IFNAR|IFNGR|IFNGR	The 129 IFNAR / IFNGR / and C57BL/6 IFNAR / IFNGR / mouse colonies are monitored for adventitious viral, bacterial, and parasitic pathogens by dirty-bedding sentinels.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:974..1382:sentences:61d53031424b248e38b6f5156213b34f	CXCR3|CXCR3|CD4|CD8A	CXCR3|CXCR3|CD4|CD8	of immune cells to lesion sites [5] . The chemokine receptor CXCR3, which belongs to the CXC chemokine receptor family, is a G protein-coupled receptor that plays a vital role in mediating chemotactic migration, cell proliferation, and survival [6] [7] [8] . CXCR3 is mainly expressed by various effector T lymphocytes including CD4 + Th1 cells, CD8 + cytotoxic T cells, and natural killer (NK) cells [9, 10].
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:1384..1742:sentences:f81cec4dced42e4baf2025d1b1215d05	CXCR3|PF4|CXCL9|CXCL10|CXCL11|PF4|CXCR3|IFNA1|CXCL9|CXCL10|CXCL11	CXCR3|CXCL4|CXCL9|CXCL10|CXCL11|CXCL4|CXCR3|interferon gamma (IFN-)|CXCL9|CXCL10|CXCL11	The principle chemokine ligands of CXCR3 are CXCL4, CXCL9, CXCL10 and CXCL11 [11] [12] [13] [14] . CXCL4, a plateletderived CXCR3 ligand, is weakly chemotactic for neutrophils, monocytes and fibroblasts [15] . Mainly induced by interferon gamma (IFN-), CXCL9, CXCL10 and CXCL11 are potent chemoattractants for monocytes, T cells, NK cells and dendritic cells.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:1744..2670:sentences:f1c21f771ed2a25ece0248e83effbbd7	CXCR3|CXCR3|CXCR3|CXCR3|CXCR3|CXCR3|OPN1SW	CXCR3|CXCR3|CXCR3|CXCR3|CXCR3|CXCR3|BCP	Although they share the same chemokine receptor CXCR3, these three ligands are regulated by unique promoters and exhibit distinct temporal and spatial expression patterns ( Table 1) . Recent studies have shown that the chemokine receptor CXCR3 was expressed in central nerv-ous system (CNS) diseases and involved in their pathogenesis [16] [17] [18] [19] [20] . It was shown that the expression levels of CXCR3 and its ligands were elevated in the periphery blood and cerebrospinal fluid (CSF) of patients with neurological diseases [21] [22] [23] , and were correlated with prognosis in certain cases [24] . Additionally, treatment with CXCR3 antagonists could alleviate bone cancer pain (BCP) induced mechanical allodynia [25] . These studies suggested an important role of CXCR3 in neurological diseases, indicating that targeting CXCR3 may reveal novel therapeutic interventions for the management of neurological diseases.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:3384..3544:sentences:9afc84801a1a9ee83b30afe76dd57a6b	CXCL10|CXCR3	CXCL10|CXCR3	They also found that CXCL10, one of the CXCR3 ligands, was expressed by astrocytes in MS brain lesions but not unaffected white matter of control or MS subjects.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:3546..3757:sentences:357d699fe89e5173d955d93653ad7f60	CXCL10|CXCR3|CXCR3	CXCL10|CXCR3|CXCR3	These results suggested that CXCL10/CXCR3 expression level may be used for immunologic staging of MS and provided a rationale for the use of agents blocking CXCR3 as a therapeutic approach in the treatment of MS.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:3801..3958:sentences:819dff5b1b07f40558878b94a7b29f6c	CXCL9|CXCL10|CXCR3	CXCL9|CXCL10|CXCR3	[37] confirmed the expression of CXCL9 and CXCL10, and their receptor CXCR3 in post-mortem CNS tissue from MS cases at different stages of lesion development.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:3960..4167:sentences:9054688140f9fb9fb34064cbe1989203	CXCL9|CXCL10|CXCR3	CXCL9|CXCL10|CXCR3	Their results showed that both macrophages and astrocytes were active in demyelinating lesions predominantly expressed CXCL9 and CXCL10, and CXCR3 was expressed by T cells and by astrocytes within the plaque.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:4305..4524:sentences:54ee4abdcc3d540f495c2d99c96dc9da	CXCL10|CXCR3|CXCL10	CXCL10|CXCR3|CXCL10	On the other hand, CXCL10 and CXCR3 were significantly increased in the CSF of patients with MS compared with controls [38] [39] [40] . Moreover, the increased level of CXCL10 was associated with clinical relapses in MS.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:4526..4757:sentences:0cd1be98a451222b5f2fe7deb00bc259	CXCL10|CXCR3|CD4	CXCL10|CXCR3|CD4	Compared with secondary progressive MS, the concentration of CXCL10 was significantly greater in patients with relapsing/remitting, which was correlated significantly with CXCR3 expression on CSF CD4 + T cells from patients with MS.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:5356..5582:sentences:cbe2ba2b81f9265634243ee7e3b11627	CXCR3|CD4|CXCR3	CXCR3|CD4|CXCR3	[42] found that the increased expression of CXCR3 on peripheral blood CD4 + lymphocytes was associated with all relapses and that the fluctuations of CXCR3 expression was significantly greater in patients with MS than controls.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:5827..5967:sentences:d5826431f94f9e5cd151d9db82fa1f0c	CXCR3|CD4|CD8A	CXCR3|CD4|CD8	[46] found that the expression of CXCR3 on CD4 + and CD8 + T cells was significantly reduced, whereas the expression of other receptors (e.g.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:5969..6006:sentences:fa212fac37ec97deeccf3733c535f3b5	CCR1|CCR2|CCR3|CCR5	CCR1|CCR2|CCR3|CCR5	CCR1, CCR2, CCR3, CCR5) was unaltered.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:6008..6148:sentences:99de0288f95a9640bb7f66a8a77d8778	IFNA1|CXCR3	IFN-|CXCR3	This results indicated that IFN- may exert its therapeutic effect on MS patients by suppressing the expression of CXCR3.. MULTIPLE SCLEROSIS.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:6150..6358:sentences:226986c5f9efd290f02746ebcab59d28	CD4|CXCR3	CD4|CXCR3	Experimental autoimmune encephalomyelitis (EAE), a rodent model of human MS, is a CD4 + Th1 cell-and Th17 cell-mediated demyelinating disease of the CNS [47] . The role of CXCR3 in EAE has been widely studied.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:6742..7053:sentences:4c1cd8e9d242584a3da2907f1a381ee3	CXCL10|CXCL10|CXCL11|CXCR3	CXCL10|CXCL10|CXCL11|CXCR3	The smaller draining lymph nodes in EAE rats treated with anti-CXCL10 mAb might be explained by the following mechanism: neutralization of CXCL10 causes an increased release of Th1 cells from lymph nodes, which results in increased migration to the CNS where CXCL11, another ligand for CXCR3, is induced as well.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:7889..8023:sentences:9fb9a0c41d5f192b73dead52566b7262	FOXP3|CXCR3	Foxp3|CXCR3	Furthermore, Foxp3 + regulatory T cells were significantly reduced in number and were scattered in the spinal cord of CXCR3 _ / _ mice.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:8025..8330:sentences:7bca242bc35e8ef5e8345bd99db90f1d	CXCR3|CD4	CXCR3|CD4	These results suggested that CXCR3 signaling plays a major protective role in EAE by constraining CD4 + T cells to the perivascular space in the CNS, promoting regulatory T cell accumulation and facilitating interaction of these cells with effector T cells, thus limiting autoimmune-mediated tissue damage.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:8417..8516:sentences:b3451473c64ca91cf3e31eafea7301d8	CXCR3|PYCARD	CXCR3|ASC	[52] found that the accumulation of antibody secreting cells (ASC) in the CNS was mediated by CXCR3.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:8518..8606:sentences:7e50ad099ee3f0be5c00871d5e6a4b15	CXCR3|PYCARD	CXCR3|ASC	In CXCR3 _ / _ mice, both the total and virus-specific ASC were reduced greater than 80%.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:8910..9086:sentences:121222cdf57b978a410b668df3cb6030	CXCR3|PYCARD	CXCR3|ASC	These results indicated that CXCR3 played a vital role in the recruitment of activated ASC into the inflamed CNS and highlighted its protective role during persistent infection.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:9088..9446:sentences:0f06f2888350da7487d3e5dd8d57607d	CXCL10|PYCARD|CXCL10|CXCL9|PYCARD|PYCARD	CXCL10|ASC|CXCL10|CXCL9|ASC|ASC	A further study demonstrated that CXCL10 is critical for the recruitment of ASC to the CNS vasculature and ASC entry into the CNS parenchyma in a mouse model of viral encephalomyelitis [53] . In this study, they found reduced CNS IgG and -light chain mRNA and virus-specific Ab as well as impaired ASC recruitment in CXCL10 _ / _ rather than CXCL9 _ / _ mice.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:9448..9615:sentences:b71e5d8fb4344e8265855fcea233f802	PYCARD|CXCL10|CXCL9	ASC|CXCL10|CXCL9	Moreover, the ASC recruited to the CNS in CXCL10 _ / _ mice restricted to the vasculature, whereas it was localized in the parenchyma in wild-type and CXCL9 _ / _ mice.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:9617..10039:sentences:0a3b5de13b170596505a7c7a6cbf39be	CXCR3|CXCL10|CXCR3|CXCL10	CXCR3|CXCL10|CXCR3|CXCL10	Recently, the CXCR3-CXCL10 axis was also demonstrated to have a role in recruiting pathogenic T lymphocytes in the brains of patients with Rasmussen encephalitis [54] . Using surgical specimens of children with Rasmussen encephalitis, they found that CXCR3 was expressed in cytotoxic T lymphocytes infiltrating the damaged areas of primary biopsies, whereas CXCL10 was expressed in neurons and astrocytes in the same areas.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:10041..10270:sentences:0869826da427e5ca2c8105be51da3d40	CXCL10|CXCL10|CXCR3	CXCL10|CXCL10|CXCR3	Additionally, in vitro study demonstrated that astrocytes upregulated the mRNA expression level of CXCL10 and the release of CXCL10 to the supernatants in response to infections, which was completely abolished by CXCR3 antagonist.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:10272..10461:sentences:7670398f9dcd8edf06dcecb6bd6a1c03	CXCL10|CXCR3	CXCL10|CXCR3	These results suggested that astrocytes and neurons may recruit pathogenic T lymphocytes into areas of the brain of Rasmussen encephalitis through the CXCL10-CXCR3 axis.. MULTIPLE SCLEROSIS.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:11492..11601:sentences:f011dcc4e6bc12311a19e5d5d22ad59b	CXCR3|CXCL10	CXCR3|CXCL10	[65] first reported that CXCR3 and CXCL10 were increased in glioma cells compared with adult human astrocytes.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:11985..12100:sentences:04bde838078b00c8451a3e3bd6abb925	CXCL10|CXCL9|CXCL10	CXCL10|CXCL9|CXCL10	They found that Murine glioma GL261 cells express CXCL10 in vitro and GL261 tumors express CXCL9 and CXCL10 in vivo.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:15055..15175:sentences:5dff7993bbba51f9c353a8d650b9dbbc	CXCR3|PSEN1|PSEN1|APP	CXCR3|presenilin 1|PS1|APP	[22] examined the impact of CXCR3 in the amyloid precursor protein (APP)/presenilin 1 (PS1) transgenic mouse model of AD.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:15177..15325:sentences:50d73ca86b1f0853cb16feab1557036a	CXCR3|PSEN1|PSEN1|APP|APP	CXCR3|PS1|PS1|APP|APP	They found that amyloid beta (A) deposition and A levels were significantly decreased in CXCR3 _ / _ APP/PS1 mice compared with control APP/PS1 mice.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:15327..15573:sentences:d3510c9527d539ce937a623399d2c99c	CXCR3|CXCR3|TNF	CXCR3|CXCR3|TNF	Their in vitro and in vivo analysis of microglial phagocytosis showed that CXCR3 deficiency facilitated the microglial uptake of A. Moreover, preincubation of CXCR3 antagonist increased primary microglial A phagocytosis and reduced TNF- secretion.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:15575..15800:sentences:b636e4792829ebb43842df3f5ca52ccb	PSEN1|CXCR3|PSEN1|APP|APP	PS1|CXCR3|PS1|APP|APP	Compared with control APP/PS1 mice, brain tissue from CXCR3 _ / _ APP/PS1 mice had reduced concentrations of proinflmmatory cytokines and the microglia exhibited obvious morphological activation and reduced plaque association.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:15802..16003:sentences:7c4c0bbb3ffb75425a99e1a161d28144	CXCR3|PSEN1|CXCR3||APP	CXCR3|PS1|CXCR3|APP/PS1|APP	Furthermore, Morris watermaze testing showed improved spatial memory of CXCR3 _ / _ APP/PS1 mice compared with controls, suggesting that lack of CXCR3 attenuated the behavioral deficits of APP/PS1 mice.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:16005..16200:sentences:77963c07f1a716f2aec1491c10d0d427	CXCR3|PSEN1|CXCR3|APP	CXCR3|PS1|CXCR3|APP	Taken together, these results indicated that CXCR3 signaling mediated development of AD-like pathology in APP/PS1 mice and suggested that CXCR3 had the potential to be a therapeutic target for AD.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:16202..16383:sentences:b0ff0a78b84bde6bfcb6f0d1b9c5a851	CCL4|CXCL10	CCL4|CXCL10	Furthermore, a very recent study reported that peripheral blood mononuclear cells of Alzheimer's disease patients control CCL4 and CXCL10 levels in a human blood brain barrier model.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:16552..17301:sentences:1b95d1d3276efdde8869db56faa1858a	CXCL10|CXCR3|OPN1SW|OPN1SW	CXCL10|CXCR3|BCP|BCP	Pain plays a vital role in protecting us against damaging stimuli [74] [75] [76] . However, chronic pain presents a major challenge due to its complex natural history, unclear etiology, and poor response to therapy [77] [78] [79] . There is compelling evidence supporting the involvement of neuroinflammation in chronic pain [80] [81] [82] [83] [84] . Our lab has been investigating the mechanisms of chronic pain for decades [85] [86] [87] [88] [89] [90] [91] . Previously, we have shown the involvement of CXCL10/CXCR3 signaling in BCP rat models [23, 92] . After intra-tibial inoculation of Walker 256 mammary gland carcinoma cells, the BCP model was established, indicated by downregulation of paw withdrawal threshold (PWT) and bone destruction.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:17303..17477:sentences:379096e0ef759ca8382a129d7c64cc20	CXCL10|CXCR3|OPN1SW	CXCL10|CXCR3|BCP	Our real-time polymerase chain reaction (PCR) and immunohistochemical analyses showed that both CXCL10 and its receptor CXCR3 were up-regulated in the spinal cord of BCP rats.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:17479..17625:sentences:824c07e688db9b521e63ea43a7c263c5	CXCL10|CXCR3|CXCL10|CXCR3|OPN1SW	CXCL10|CXCR3|CXCL10|CXCR3|BCP	Blocking the CXCL10/CXCR3 signaling via anti-CXCL10 antibody or CXCR3 antagonist AMG487 prevented the development of BCP and microglial activation.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:17627..17712:sentences:5bfefe7611f670861caa5a70480d619c	CXCL10|OPN1SW	CXCL10|BCP	Moreover, inhibiting microglial activation attenuated CXCL10 upregulation in BCP rats.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:17714..17827:sentences:817ff6001002669559c918c2bfaba3b3	CXCL10|CXCR3|OPN1SW	CXCL10|CXCR3|BCP	These results suggested that CXCL10/CXCR3 signaling participated in BCP via activation of microglia in rat models.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:17829..18166:sentences:da72439289faecf015f5b048143d037b	CXCR3|OPN1SW|CXCR3|OPN1SW	CXCR3|BCP|CXCR3|BCP	Our further study revealed the cellular mechanism of how CXCR3 mediated BCP [25] . We confirmed that CXCR3 was significantly increased in the spinal cord of BCP rats and co-localized with either neurons, microglia, and astrocytes in the spinal cord, or non-peptidergic-, peptidergic-, and A-type neurons in the dorsal root ganglion (DRG).
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:18168..18322:sentences:e5e23d84286a68f0ff170b88abd3fa00	AKT1|MAPK1||OPN1SW	Akt|extracellular signal-regulated kinase|ERK1/2|BCP	Moreover, spinal phosphorylation of Akt and extracellular signal-regulated kinase (ERK1/2) were markedly upregulated in BCP rats in a timedependent manner.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:18324..18385:sentences:e8fd623a5ab60ca5251f5a450cc77008	CXCR3|AKT1	CXCR3|pAkt	Meanwhile, CXCR3 was co-localized with either pAkt or pERK1/2.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:18387..18467:sentences:7b12b652d2e170be8953c289b6b272da	AKT1||OPN1SW	Akt|ERK1/2|BCP	Blockage of either Akt or ERK1/2 attenuated the mechanical allodynia in BCP rats.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:18469..18553:sentences:7fd7f86a037cb1ec7078429632534390	CXCR3|AKT1	CXCR3|pAkt	Furthermore, CXCR3 antagonist AMG487 suppressed the upregulation of pAkt and pERK1/2.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:18555..18686:sentences:d626f0d406accc63113539ed6023b0f4	CXCR3|OPN1SW|AKT1|MAPK1	CXCR3|BCP|Akt|ERK	Taken together, these results indicated that the activation of spinal chemokine receptor CXCR3 mediated BCP through Akt-ERK pathway.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:18734..18932:sentences:c0771033acd9e99d06d10eeaea8f2617	CXCR3|CXCR3|FSCN1	CXCR3|CXCR3|SNL	confirmed the pivotal role of CXCR3 in neuropathic pain [93] . They found that the expression of CXCR3 was significantly upregulated mainly in the spinal neuron following spinal nerve ligation (SNL).
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:18934..19051:sentences:b7f2a95d997fb8575a9aceb2c368531e	CXCL10|CXCR3|FSCN1	CXCL10|CXCR3|SNL	Moreover, CXCL10, a ligand of CXCR3, was also considerably increased in the spinal neurons and astrocytes in SNL mice.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:19053..19271:sentences:0fd6101040af7e7b16ce5eaf7e485cd9	CXCR3|CXCR3|CXCR3|CXCR3|FSCN1	CXCR3|CXCR3|Cxcr3|CXCR3|SNL	Additionally, inhibiting the expression of CXCR3 by CXCR3-/-mice and shRNA targeting the sequence of mice Cxcr3 as well as CXCR3 antagonist NBI-74330 attenuated SNL-induced mechanical allodynia and thermal hyperalgesia.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:19825..19921:sentences:d998fc16bc8f8869013db57502e82d3b	CXCL10|CXCR3|THBS1	CXCL10|CXCR3|TSP	[96] investigated the possible role of CXCL10/CXCR3 signaling in chronic inflammation of HAM/TSP.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:19923..20185:sentences:264a52f59561a67db1228420fdeceac3	CXCL10|THBS1|CD14	CXCL10|TSP|CD14	They found that the expression level of CXCL10 was markedly high in the CSF of HAM/TSP patients and a great deal of CSF cells expressed the CXCL10-binding receptor CXCR3, which mainly consist of CD3 + cells (>90%) and small populations of CD14 + and CD19 + cells.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:20187..20317:sentences:69fec9a8be3bfec90c2ec137a691d7d9	CXCL10|THBS1	CXCL10|TSP	Their immunofluorescence results showed that astrocytes were the major producers of CXCL10 in the spinal cords of HAM/TSP patients.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:20319..20482:sentences:fd55f123563756bfb4bf3b86e9607fe2	THBS1|CXCL10|IFNA1|CD4|CD4	TSP|CXCL10|IFN|CD4|CD4	Coculture of human astrocytoma cells with CD4 + T cells from HAM/TSP patients revealed that astrocytes produce CXCL10 in response to IFN- secreted by CD4 + T cells.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:20686..20983:sentences:005356c32fde48d0d8790aa793789780	IFNA1|CXCL10|CXCR3	IFN|CXCL10|CXCR3	These results demonstrated that HTLV-1 infected cells in the CNS produced IFN- that induces astrocytes to secrete CXCL10, which recruits more infected cells to the area via CXCR3, constituting a T helper type 1-centric positive feedback loop that results in chronic inflammation.. BIPOLAR DISORDER.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:21403..21602:sentences:ac91a78f75644f9c4c57fe23bcd5d1bb	CXCL10|CCL24	CXCL10|CCL24	They found that the serum levels of CXCL10 were increased and CCL24 levels were decreased in BD patients in contrast with controls, suggesting an association between BD and changes in chemokine level.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:21604..21783:sentences:4811fafd536342f70857cbe11446cb69	CCL24|CCL11|CCR3|CXCR3	CCL24|eotaxin|CCR3|CXCR3	It is worth mentioning that CCL24 is an eotaxin, which not only binds CCR3 and recruit eosinophils and Th2 cells, but also act as an antagonist of CXCR3 [103, 104] . Barbosa et al.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:21965..22127:sentences:f4f6a79a59822076a035311f4ebf5341	CXCL11|CCL24|CXCL10|IL8	CXCL11|CCL24|CXCL10|CXCL8	Their results showed that BD patients had increased plasma levels of CXCL11, CCL24, CXCL10, and decreased plasma levels of CXCL8 in contrast with healthy controls.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:22242..22383:sentences:3a869f12dd5f3f0ccca2011cb3b23ac0	CXCL10|IL8	CXCL10|CXCL8	Furthermore, the logistic regression stressed the main effect of increased plasma levels of CXCL10 and decreased plasma levels of CXCL8 to BD.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:22385..22562:sentences:226864a279e2e22fd1044febc11efeb7	CXCL10|CXCL11|CXCR3	CXCL10|CXCL11|CXCR3	These studies indicate that CXCL10, CXCL11 and their receptor CXCR3 should be further investigated with regard to their potential role as longstanding markers of BD.. CONCLUSION.
+SARS:0c92f5b237572a3461ae2205a62ba7622c07a6ab:fulltext:061ff95591ffb3d1110bfeb44b6b9f4d:22672..22820:sentences:c26632143abedbc435568e18200c0e70	CXCR3|THBS1	CXCR3|TSP	These studies provided hard evidence that CXCR3 plays a vital role in the pathogenesis of MS, glioma, AD, chronic pain, HAM/TSP and bipolar disorder.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:abstract:89af1c41458ff5fbb6204e23fe56c868:569..761:sentences:0573a2bad0216596bef7a90249977228	CXCR1|CXCR2|SELL|SELL|IL8|IL8	CXC-chemokine receptor (CXCR)1|CXCR2|L-selectin|CD62L|interleukin-8|IL-8	The results showed that LPS decreased the expression levels of CXC-chemokine receptor (CXCR)1, CXCR2 and L-selectin (CD62L), and increased the expression of interleukin-8 (IL-8) by neutrophils.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:abstract:89af1c41458ff5fbb6204e23fe56c868:763..938:sentences:94eb6cfb80faec494e3576e3247bf3a8	CXCR1|CXCR2|SELL|IL8	CXCR1|CXCR2|CD62L|IL-8	The addition of n-butanol extract from Folium isatidis inhibited this LPS-induced downregulation of CXCR1, CXCR2 and CD62L, and decreased the expression of IL-8 on neutrophils.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:title:f5424f69896f4591e054b801a089704d:0..132:sentences:3b2225fe3165ad12d069bc42d5526b1d	CXCR1|CXCR2	CXCR1|CXCR2	n-butanol extract from Folium isatidis inhibits the lipopolysaccharide-induced downregulation of CXCR1 and CXCR2 on human neutrophils
+SARS:0eff8cb176dc1e97612266b1ed94badfeab4e575:abstract:8161d50bb5ad391a65aa02be0b34c8a1:901..1103:sentences:e473ac0a592f767499661a2226f377c7	CD8A|RAG1	CD8|Rag1	Furthermore, CD8 T cell function is maintained during the persistent phase of infection and adaptive immune cells from persistently infected mice are functional when transferred to Rag1 (-/-) recipients.
+SARS:0f157fb0a719dd0d52fb921fb1369ccb6477636e:abstract:b0d5db6db36bc369249a0f8567dc3e5e:409..591:sentences:97e6c37de1130ee4866bbcbfa728d7e7	FURIN|GTPBP1|GP2	furin|GP1|GP2	BDV G is post-translationally cleaved by the cellular subtilisin-like protease furin into two subunits, a 41 kDa amino terminal protein GP1 and a 43 kDa carboxyl terminal protein GP2.
+SARS:0e18097a83b2801c4865c72065b7933fa24face3:fulltext:36b46cee8665d1fa133ca681d8f4cba9:15653..15826:sentences:da9538908a210408b64858a3e439d4f5	COX8A|FN1|JUN	VIII|fibronectin|Jun	Descemet's membrane is comprised of a highly ordered hexagonal array of collagen (type IV, VIII, XVIII), laminin, and fibronectin (Smith, Sundberg, and John 2002a; Jun et al.
+SARS:0e18097a83b2801c4865c72065b7933fa24face3:fulltext:36b46cee8665d1fa133ca681d8f4cba9:37208..37474:sentences:c78cf954e0cc2f2c4a32f46855e55bc6	PTPRC|FCGR1A|ITGAL	CD45|CD64|CD11a	Hyalocytes express cell surface antigens characteristic of monocyte/macrophage leukocyte lineage including CD45 (leukocyte common antigen), CD64 (Fc receptor I), CD11a (leukocyte-function antigen-1), and histocompatibility complex (MHC) class II antigens (Kita et al.
+SARS:0e18097a83b2801c4865c72065b7933fa24face3:fulltext:36b46cee8665d1fa133ca681d8f4cba9:64607..64686:sentences:444e3de853d7948998b1b2f674831cbb	VEGFA|ANGPT2	VEGF|Ang-2	metalloproteinases, VEGF, Ang-2) that favors angiogenesis.. Diagnostic Features.
+SARS:0e18097a83b2801c4865c72065b7933fa24face3:fulltext:36b46cee8665d1fa133ca681d8f4cba9:89539..89712:sentences:ccd00d7c4090e069e3fdd2eb1f4c5308	FOXC1|FOXC2	Foxc1|Foxc2	Abnormalities of the aqueous plexus and the trabecular meshwork occur in Foxc1 and Foxc2 mutant mice (Smith, Sundberg, and John 2002b) .. Narrowed filtration angle (N) fa/tM.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:842..1897:sentences:2db60a63330577cf3e5d6a608bd0075e	CXCR1|CXCR2|CXCR2|TNF|TLR4|TLR4|CXCR2	CXC-chemokine receptor (CXCR)1|CXCR2|CXCR2|TNF|Toll-like receptor 4|TLR4|CXCR2	Polymorphonuclear neutrophils (PMNs) are an essential component of the innate immune system, involved in the clearance of extracellular pathogens (5) . As the most abundant subset of leukocytes, the involvement of PMN in sepsis is significant (3, 6, 7) . The migration of PMNs is regulated by chemoattractants and chemokine gradients (3, 7, 8) . CXC-chemokine receptor (CXCR)1 and CXCR2 are the major chemokine receptors on PMNs, with interleukin (IL)-8 acting as a ligand of these receptors (9) . Severe sepsis is associated with the failure of PMNs to migrate (10) . In a previous clinical study, patients with suppression of PMN receptors were predisposed to inflammatory response syndrome (11) . Previous in vitro investigations have demonstrated that CXCR2 is downregulated upon stimulation with tumor necrosis factor- (TNF-) (12) . The activation of Toll-like receptor 4 (TLR4) also suppresses the expression of CXCR2 (13) . In an experimental mouse model of sepsis, the failure of PMNs to migrate was shown to result in a high rate of mortality (1).
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:1899..2357:sentences:09d9350dd390d4f983134bf309dd207f	CXCR1|CXCR2	CXCR1|CXCR2	Tancevski et al and Van Zee et al reported that promoting the recruitment of PMNs ameliorates sepsis and attenuates sepsis-related injury and infection, respectively (14, 15) . Therefore, in order to improve treatment of inflammatory disorders, including sepsis, the promotion of PMN chemotaxis is an attractive target (6).. n-butanol extract from Folium isatidis inhibits the lipopolysaccharide-induced downregulation of CXCR1 and CXCR2 on human neutrophils.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:9743..9907:sentences:eb9c3e8a9b2196544e403e30f1d7468d	CXCR1|CXCR2	CXCR1|CXCR2	GraphPad Prism 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA) was used for statistical analysis.. LPS downregulates neutrophil expression of CXCR1, CXCR2.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:9920..10122:sentences:7515874d0b00c92793d5ac24fba93b43	TLR2|TLR4|CXCR1|CXCR2	TLR2|TLR4|CXCR1|CXCR2	TLR2 and TLR4/myeloid differentiation factor 2 are vital in the recognition of LPS in the host, and the triggering of these receptors can lead to neutrophil recruitment and migration via CXCR1 and CXCR2.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:10124..10233:sentences:ae47ca4d74fa131cfd4821a9a6b9ca20	ITGAM|SELL	CD11b|CD62L	CD11b and CD62L, which are expressed on the surface of neutrophils, are critical for the occurrence of sepsis.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:10508..10742:sentences:534f7b1b7dd19b87017d5f4e1e5f76e9	CXCR1|CXCR2|TLR2|TLR4|ITGAM|SELL	CXCR1|CXCR2|TLR2|TLR4|CD11b|CD62L	The isolated neutrophils were treated with either vehicle or increasing concentrations (10, 100 and 1,000 ng/ml) of LPS for 4 h, and the expression levels of CXCR1, CXCR2, TLR2, TLR4, CD11b and CD62L were measured using flow cytometry.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:10744..10879:sentences:d199f156e1c9ce9b5feb14891a5e051c	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	The results showed that LPS treatment resulted in decreased expression levels of CXCR1, CXCR2 and CD62L in a dose-dependent manner (Fig.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:10881..11133:sentences:58563ab6a608db737dde03ec96625d1d	TLR2|TLR4|ITGAM	TLR2|TLR4|CD11b	1A-C) , which was in accordance with the results of a previous study (23) . However, no significant changes were observed in the expression levels of TLR2, TLR4 or CD11b in the LPS-treated neutrophils, compared with the vehicle-treated neutrophils (Fig.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:11135..11311:sentences:f8e614fdfd6d3d2bd1b761031a7ee43b	TLR2|TLR4|ITGAM|CXCR1|CXCR2	TLR2|TLR4|CD11b|CXCR1|CXCR2	1D-F) . Therefore, the expression levels of TLR2, TLR4 and CD11b were not examined in the remainder of the experiments.. LPS downregulates neutrophil expression of CXCR1, CXCR2.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:11313..11417:sentences:d9760f5acf0d445d1a62f225c2d81bdb	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	n-butanol extract from Folium isatidis prevents the LPS-induced downregulation of CXCR1, CXCR2 and CD62L.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:11419..11563:sentences:0a215cc6b845a74f4c954ba2e636a5f5	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	CXCR1, CXCR2 and CD62L may be important in sepsis, however, whether n-butanol extract affects these chemokine receptors remains to be elucidated.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:11565..11672:sentences:0b0b259b0a2fd706ed53d294d992ec30	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	Therefore, the present study assessed the effect of the extract on the expression of CXCR1, CXCR2 and CD62L.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:11674..12115:sentences:b1bbcfbea32d9cee8586d549f1741414	CXCR1|CXCR2|SELL|CXCR1|CXCR2	CXCR1|CXCR2|CD62L|CXCR1|CXCR2	The isolated neutrophils were pre-incubated with either vehicle or increasing concentrations of extract (100, 250 and 500 g/ml) for 2 h, and were subsequently treated with LPS (0.5 g/ml) for 4 h. Subsequent analysis of the cells using flow cytometry indicated that the extract inhibited the LPS-induced downregulation of CXCR1, CXCR2 and CD62L ( Fig. 2A-C) in a dose-dependent manner.. LPS downregulates neutrophil expression of CXCR1, CXCR2.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:12117..12221:sentences:0f3f583ecf6378575aea3a0b2e45e620	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	Effect of n-butanol extract from Folium isatidis on the gene expression levels of CXCR1, CXCR2 and CD62L.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:12525..12839:sentences:b6054a90d3ecae640a230e5aaeda3976	CXCR1|CXCR2|SELL|IL8|IL8|CXCR1|CXCR2|MPO	CXCR1|CXCR2|CD62L|IL-8|IL-8|CXCR1|CXCR2|MPO	3A-F) . The extract increased the gene expression levels of CXCR1, CXCR2 and CD62L in a dose-dependent manner.. n-butanol extract from Folium isatidis decreases the expression of IL-8 and increases the activity of MPO.. IL-8, as the ligand of CXCR1 and CXCR2, is important in the regulation of neutrophil migration.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:14711..14848:sentences:b1e896feec2aab51f6fa4b7660d242f4	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	As previously reported, the present study observed that LPS stimulation decreased the expression of CXCR1, CXCR2 and CD62L on neutrophils.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:15010..15230:sentences:b2e54b5f178cb6c3f430e223673cb4d9	CXCR1|CXCR2	CXCR1|CXCR2	The failure of neutrophils to migrate can lead to an inability to control infection due to weakened neutrophil phagocytic and bactericidal abilities (26) . CXCR1 and CXCR2 are the major chemokine receptors on neutrophils.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:15722..15854:sentences:3356a647961bc066cc36e78e4c67f187	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	In the present study, it was demonstrated that n-butanol extract prevented the downregulation of CXCR1, CXCR2 and CD62L.. Discussion.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:15856..16403:sentences:7cf92ac55714e27776ef132a4c6614cb	TLR4|TNF|CXCR2|CXCR1|CXCR2|TLR4|TNF	TLR4|TNF|CXCR2|CXCR1|CXCR2|TLR4|TNF	In our previous study, it was demonstrated that n-butanol extract from Folium isatidis significantly inhibited the activation of TLR4 and its signaling pathways (22) . It has been reported that the systemic activation of TLRs and high levels of TNF- are involved in the reduction of neutrophil recruitment through the downregulation of CXCR2 in neutrophils (28) . Therefore, it was hypothesized that n-butanol extract from F. isatidis prevents the downregulation of CXCR1 and CXCR2 through the activation of TLR4 and secretion of TNF-.. Discussion.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:16501..16586:sentences:8db410018d46971373a80263dfb7a2ee	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	In addition to CXCR1 and CXCR2, neutrophil migration requires the assistance of CD62L.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:16933..17015:sentences:75f077fb85c276d4f8a99e23bc3db6a4	IL8|CXCR1|CXCR2	IL-8|CXCR1|CXCR2	IL-8 is a ligand of CXCR1 and CXCR2, and is rapidly secreted upon cell stimulation.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:17101..17277:sentences:20473ba14e89a830480735908cb0ebc0	IL8|CXCR1|CXCR2	IL-8|CXCR1|CXCR2	4A) . However, n-butanol extract decreased the expression of IL-8 in a dose-dependent manner ( Fig. 4B and C) , and prevented the decreases in the expression of CXCR1 and CXCR2.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:17279..17486:sentences:7907938f62177ebda6e811ae9d428c4b	CXCR1|CXCR2|IL8	CXCR1|CXCR2|IL-8	This suggested that the extract increased the activity of neutrophils and upregulated the expression of chemokine receptors, including CXCR1 and CXCR2, rendering neutrophils more sensitive to the ligand IL-8.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:17623..17777:sentences:63063046752b68c102d73d3b92af6a0f	CXCR1|CXCR2	CXCR1|CXCR2	The extract also promoted the ability of neutrophils to migrate by increasing the expression of CXCR1 and CXCR2 on the surface of neutrophils.. Discussion.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:17779..18185:sentences:73b8bd649001ec57c8983cf9f1e025c3	CXCR1|CXCR2|CXCR1|CXCR2|SELL	CXCR1|CXCR2|CXCR1|CXCR2|CD62L	To date, the treatment of sepsis consists primarily of supportive measures and experimental therapeutic approaches (29) . Therefore, novel pharmacological strategies are urgently required to promote the treatment of sepsis (30) . With the ability to promote the expression of CXCR1, CXCR2 Figure 2 . n-butanol extract from Folium isatidis inhibits the downregulated protein levels of CXCR1, CXCR2 and CD62L.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:18187..18447:sentences:206073054c7f4ca575a6f6395c7664b0	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	Following pretreatment with a vehicle control (DMSO) or n-butanol extract at the indicated concentration for 2 h, neutrophils were incubated with LPS (0.5 g/ml) for 4 h. Expression levels of (A) CXCR1, (B) CXCR2 and (C) CD62L were measured using flow cytometry.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:18680..18788:sentences:08de9bfbdef6ad38c36cb8784ddacb62	CXCR1|CXCR2|CXCR2|SELL|SELL	CXCR1|CXCR2|CXC-chemokine receptor 2|CD62L|L-selectin	LPS, lipopolysaccharide; CXCR1, CXC-chemokine receptor 1; CXCR2, CXC-chemokine receptor 2; CD62L, L-selectin.
+SARS:0f0bb7346d45679cc1bb2435c66d5ad3ef52c108:fulltext:9b97f2d3f27b85c9f9d78c9b5d6e29d0:19369..19545:sentences:d53634944a7fbc913a62fcad1f8affe7	CXCR1|CXCR2|SELL	CXCR1|CXCR2|CD62L	In conclusion, the present study demonstrated that n-butanol extract obtained from F. isatidis prevented the LPS-induced downregulation of CXCR1, CXCR2 and CD62L on neutrophils.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:623..1046:sentences:f4b640cd2a1b7dac45be0915d8e328c0	CAP2|CAP1	cap2|cap1	The mRNA cap consists of N7-methylguanosine linked to the first nucleotide via a 5 0 -5 0 ppp bridge: in the minimal RNA cap structure, named 'cap0', methylation is restricted to the N7 position of the guanine base, but in higher eukaryotes, additional methylation occurs at the 2 0 -position of riboses of the next two nucleotides, yielding the 2 0 -Omethylated 'cap1' (m 7 GpppNmN) and 'cap2' (m 7 GpppNmNm) ( Figure 1A ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:2100..2519:sentences:d517e278d50751e7b1f7aa7eba0b7373	IFIT1|IFIT2|IFIT3|IFIT5|IFIT5|IFIT1|IFIT1B|IFIT5	IFIT1|IFIT2|IFIT3|IFIT5|IFIT5|IFIT1|IFIT1B|IFIT5	The IFIT family arose by gene duplication and is conserved in vertebrates (11) (12) (13) . Most mammals encode IFIT1, IFIT2, IFIT3 and IFIT5, with the exception of mice and rats (which lack IFIT5) and horses (which lack IFIT1), but many species also have additional IFIT-like genes, encoding IFIT1B (in humans, mice and rabbits), IFIT1C (in mice), IFIT3B (in dogs and mice) and IFIT5-like proteins (in dogs and rabbits).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:2741..3512:sentences:8064cbb1a91e233028b57303a60b5133	IFIT2|IFIT5|IFIT5|IFIT2|	IFIT2|IFIT5|IFIT5|IFIT2|IFITs 1, 1B, 2 and 3	The regular repeating relationship between TPRs is disrupted by two insertions in IFIT2 and IFIT5, so that the TPRs form three distinct subdomains producing a V-shaped clamplike structure (15) (16) (17) (18) . The concave surface of subdomain II, the 'pivot' helices between subdomains II and III and the N-terminal TPRs of subdomain III form a deep cylindrical cavity that is lined with positively charged residues (16) (17) (18) . Whereas IFIT5 is a monomer, IFIT2 forms a domain-swapped homodimer in a manner that may account for conformational switching of subdomains during binding of ligands (15) and for homo-and heterodimerization of human IFITs 1, 1B, 2 and 3 (10, 18) . The functional importance of homo-and heterodimerization of IFITs is unknown.. INTRODUCTION.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:3774..4314:sentences:b69a8eaa46ff33c0478c8866fda88891	IFIT1B|IFNA1|IFNA1	IFIT1B|IFN|IFN	A few IFIT genes, including human IFIT1B, lack ISRE-containing promoters and are not transcriptionally induced by IFN or dsRNA (11, 12) . Sequence similarity between the different IFIT proteins within a species is high (44-98% identity) (11), but they are differentially expressed depending on the cell and tissue type, respond differently to IFN and different viruses, and have different effects on replication of individual viruses, suggesting that different IFITs have non-redundant functions in the host response to viral infection (e.g.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:4457..4814:sentences:e1ade256d8341b3692e5af38655758bb	IFIT3|IFIT5|IFIT1|IFIT2	IFIT3|IFIT5|IFIT1|IFIT2	Thus, IFIT3 and IFIT5 potentiate antiviral signaling (24, 25) , whereas some reports indicate that IFIT1 exhibits the opposite modulatory effect (26) . IFIT2, on the other hand, has been shown to promote apoptosis via a mitochondrial pathway (27, 28) . However, the principal antiviral function of IFITs is thought to involve inhibition of viral translation.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:4816..5531:sentences:a3dd5c9fbc874d1c8905bc500d21b0da	IFIT1|IFIT1|IFIT2|EIF3A|IFIT2|IFIT2|EIF3A	IFIT1|IFIT1|IFIT2|eIF3|IFIT2|IFIT2|eIF3	Over-expression of human IFIT1 in HT1080 cells reduced overall translation by $40%, and addition of recombinant human IFIT1 and IFIT2 abrogated cap-dependent translation in rabbit reticulocyte lysate (RRL) (29) . Originally, their mechanism of action was reported to involve interaction with and impairment of the functions of eukaryotic initiation factor eIF3 (30, 31) , a large multisubunit factor that binds to the ribosomal 40S subunit and promotes recruitment of mRNA and the eIF2GTP/initiator tRNA (Met-tRNA i Met ) ternary complex (32, 33) . However, subsequent studies were unable to confirm the repression of translation in RRL by 35 mM IFIT2 (10) or the interaction of IFIT2 with eIF3 (15) .. INTRODUCTION.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:5751..6082:sentences:003c3a5235f9f53095dc4c7c485aedf3	IFIT2|IFIT5	IFIT2|IFIT5	Determination of the crystal structure of IFIT2 showed that it has a positively charged RNA-binding channel on the inner surface of its carboxy-terminal subdomain that binds AU-rich RNAs (15) , whereas IFIT5 has a deep positively charged RNA-binding pocket that can accommodate single-stranded nucleic acid with a 5 0 -terminal ppp.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:6685..7160:sentences:0dce0cd2b58d68a1167865a2eae84b37	IFIT1|IFIT1|IFIT1|IFIT1|IFIT1B|	IFIT1|IFIT1|IFIT1|IFIT1|IFIT1B|K 1/2,app $ 9	Human IFIT1 was previously reported to specifically bind 5 0 ppp-ssRNAs with moderate affinity (K d $ 250 nM) (10) . Two independent groups have recently reported specific interaction of human IFIT1 with cap0-RNAs (35, 36) . These latter reports support our current finding, using a novel equilibrium-based binding assay, that human IFIT1, rabbit IFIT1 and rabbit IFIT1B specifically bind to cap-proximal regions of cap0-mRNAs with very high affinity (K 1/2,app $ 9 to 23 nM).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:7294..7617:sentences:daab8b2b4f4fca1291b9bb9830f04c25	IFIT1|IFIT5|CAP1	IFIT1|hIFIT5|cap1	Molecular modeling and mutagenesis of human IFIT1 suggest that the ppp moiety of cap0 interacts with an extended cleft leading to a pocket that binds the N7-methylguanosine portion of the cap Figure 1 . Continued hIFIT5, rIFIT1 and rIFIT1B (400 nM) with cap0-, cap1-and 5 0 ppp-b-globin(G) mRNAs assayed by primer extension.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:7818..7938:sentences:f9b9c52ef267c7648fe480f5289bcb39	IFIT1|IFIT2|IFIT3|IFIT5	hIFIT1|hIFIT2|hIFIT3|hIFIT5	(H) UV cross-linking of hIFIT1, hIFIT2, hIFIT3, hIFIT5, rIFIT1 and rIFIT1B with [ 32 P]cap-labeled cap0-b-globin(G) mRNA.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:7940..8024:sentences:29e7670f8785ad1735c03a561fd1c929	ATF4|SNCB	ATF4|Sncb	(I) Interaction of rIFIT1B (300 nM) with cap0-GCN4, ATF4, Sncb and b-globin(A) mRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:8301..8761:sentences:79212e02d9f589b93dd86716dc3deec9	IFIT1|IFIT1B|IFNA1	IFIT1|IFIT1B|IFN	Whereas the specific and stable interaction of IFIT1 with cap0-mRNA may account for its ability to inhibit translation and thus impair replication of specific viruses, the observation that IFIT1B, which lacks an ISRE-containing promoter and is not transcriptionally induced by IFN or dsRNA, also binds cap0-mRNAs suggests that it might regulate translation of specific cellular mRNAs in circumstances that are unrelated to the innate immune response.. Plasmids.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:8763..9075:sentences:4a556991a0af224b27c36c5a359e55f4	EIF1|EIF1|EIF4A2|EIF4B|EIF4E|IFIT1|IFIT2|IFIT3|IFIT5|MARS	eIF1|eIF1A|eIF4A|eIF4B|eIF4E|hIFIT1|hIFIT2|hIFIT3|hIFIT5|methionyl tRNA synthetase	Expression vectors for eIF1 and eIF1A (37), eIF4A and eIF4B (38) , eIF4E (39), hIFIT1 (17), hIFIT2 (10), hIFIT3 (10), hIFIT5 (17) and Escherichia coli methionyl tRNA synthetase (40) , as well as transcription vectors for Stem-MVHL-STOP mRNA (41) , tRNA i Met (42) , tRNA Leu and tRNA His (43) have been described.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:9229..9528:sentences:dbfe9829ead73b0e4e298cf7ef08756a	ATF4|SNCB	ATF4|Sncb	The transcription vectors for b-globin, ATF4, GCN4 and Sncb mRNAs were made by inserting DNA sequences (corresponding to their 5 0 -terminal 235, 442, 600 and 247 nt, respectively) flanked by a T7 promoter and HindIII, EcoRV, EcoRV and HindIII restriction sites, respectively, into pUC57 (GenScript).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:10360..10862:sentences:c8c8683fc8e180ddd87a1f05b6df5ad5	EIF2S2|EIF3A|EIF4G1|EIF1|EIF1|EIF4A2|EIF4B|EIF4E|MARS|MARS	eIF2|eIF3|eIF4F|eIF1|eIF1A|eIF4A|eIF4B|eIF4E|methionyl tRNA synthetase|methionyl tRNA synthetase	Purification of initiation factors, 40S ribosomal subunits and aminoacylation of tRNA i Met Native 40S ribosomal subunits, eIF2, eIF3 and eIF4F, and recombinant eIF1, eIF1A, eIF4A, eIF4B, eIF4E and E. coli methionyl tRNA synthetase were purified as described in (40, 44, 45) . In vitro transcribed tRNA i Met was aminoacylated using E. coli methionyl tRNA synthetase (45) . For experiments on 43S complex formation, aminoacylation was done in the presence of [ 35 S]Met.. Purification of native rIFIT1B.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:12137..12298:sentences:29c0b1034891e576be04f0a7bdbb9831	IFIT1|IFIT2|IFIT3|IFIT5|IFIT1	hIFIT1|hIFIT2|hIFIT3|hIFIT5|hIFIT1	Recombinant wild-type hIFIT1, hIFIT2, hIFIT3, hIFIT5, rIFIT1 and rIFIT1B, and hIFIT1 mutants were expressed in 1 l of BL21 DE3 Star Escherichia coli (Invitrogen).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:16425..16585:sentences:27fe4ec01758581eadee8a4a5147e44a	IFIT1|IFIT2|IFIT3|IFIT5	hIFIT1|hIFIT2|hIFIT3|hIFIT 5	A total of 500 ng of recombinant hIFIT1, hIFIT2, hIFIT3, hIFIT 5, rIFIT1 and rIFIT1B were separated on a 4-16% non-denaturing Bis-Tris gradient gel (Invitrogen).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:16869..16985:sentences:3673419470faad8faeddab1663da68bb	IFIT1|IFIT1B|IFIT2|IFIT3|IFIT5	IFIT1|IFIT1B|IFIT2|IFIT3|IFIT5	IFIT1 and IFIT1B, but not IFIT2, IFIT3 and IFIT5, interact specifically with the 5 0 -terminal regions of cap0 mRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:17827..18083:sentences:6bea542d4df6f1897ad9febfd38d30e9	IFIT1B|IFIT1|IFIT2|IFIT3|IFIT5|IFIT1|IFIT1B	IFIT1B|IFIT1|IFIT2|IFIT3|IFIT5|IFIT1|IFIT1B	To determine whether this mRNA-binding activity was specific for rabbit IFIT1B, the following members of the IFIT family were expressed and purified in recombinant form: human (h) IFIT1, IFIT2, IFIT3 and IFIT5, and rabbit (r) IFIT1 and IFIT1B ( Figure 1E ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:18158..18476:sentences:422d19d6ee82ef320da16ae994ff5dfa	ATF4|SNCB|SNCA	ATF4|Sncb|beta-synuclein	To investigate the influence of the nature of mRNA nucleotides on IFIT/mRNA binding, five mRNAs with different 5 0 -terminal sequences were employed: b-globin(G) and b-globin(A) mRNAs with a 5 0 -terminal guanosine or adenosine, respectively, GCN4 mRNA, ATF4 mRNA and Sncb (beta-synuclein) mRNA ( Figure 1B) .. RESULTS.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:18478..18890:sentences:57ddae0fc5996580c16cf8f768cf3fc5	IFIT1|IFIT2|IFIT3|IFIT5|IFIT1	hIFIT1|hIFIT2|hIFIT3|hIFIT5|hIFIT1	At 400 nM, hIFIT1, rIFIT1 and rIFIT1B (but not hIFIT2, hIFIT3 or hIFIT5) induced +7 nt toe-prints on cap0-b-globin(G) mRNA ( Figure 1F, top panel) . Although the +7 nt stop was the most prominent in all cases, the intensity of additional stops at flanking +6 and +8 positions differed: the strongest stop at +8 nt was induced by rIFIT1, whereas the +6 nt stop was most obvious in the case of hIFIT1 ( Figure 1G ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:19531..19773:sentences:adae3daafd31aa74421da4d0d77f8b5a	IFIT5|IFIT1	hIFIT5|hIFIT1	On b-globin(G) mRNA containing a 5 0 -terminal ppp, a prominent toeprint at the +7 position was observed in the presence of hIFIT5, whereas hIFIT1, rIFIT1 and rIFIT1B induced only trace-level stops at this position ( Figure 1F , bottom panel).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:19775..20173:sentences:bfca94ed883772ddfe4b222ee4f3fdd8	IFIT1|IFIT5|CAP1	hIFIT1|hIFIT5|cap1	Interestingly, toe-prints induced by hIFIT1 on cap0-b-globin(G) mRNA, and to a greater extent toeprints induced by rIFIT1B and hIFIT5 on cap1-and on 5 0 ppp-b-globin(G) mRNAs, respectively, were sensitive to elevation of [Mg 2+ ] above 6 mM during the primer extension stage, which most likely indicates that at these [Mg 2+ ], RT displaces these IFITs from mRNA (PK, TRS and TVP, unpublished data).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:20175..20337:sentences:a170fe906772176ebb170122f9de2eb3	IFIT2|IFIT3	hIFIT2|hIFIT3	No specific toe-prints were observed in the presence of hIFIT2 and hIFIT3, irrespective of the structure present at the 5 0 -end of mRNA ( Figure 1F , all panels).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:20339..20484:sentences:70be1e120631df764d37a88276d4673f	IFIT1|IFIT2|IFIT3|IFIT5	hIFIT1|hIFIT2|hIFIT3|hIFIT5	Consistently, hIFIT1, rIFIT1 and rIFIT1B, but not hIFIT2, hIFIT3 and hIFIT5 crosslinked to [ 32 P]cap-labeled cap0-b-globin(G) mRNA ( Figure 1H ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:21066..21478:sentences:487a23e9d67b561c6cd0c47f6bd9969a	IFIT1|CAP1|IFIT5	hIFIT1|cap1|hIFIT5	To determine the affinity of hIFIT1, rIFIT1 and rIFIT1B for cap0-b-globin(G) mRNA, of rIFIT1B for cap1-bglobin(G) mRNA, and of hIFIT5 for 5 0 ppp-b-globin(G) mRNA, the primer extension technique was employed (Figure 2A-E) . Importantly, primer extension is performed under conditions of binding equilibrium, which represents a significant advantage of this method over non-equilibrium techniques such as the EMSA.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:21686..21888:sentences:148b22558b1049b50ea4265bd0b5d412	||KRT1|APP|APP|APP	hIFIT1, K 1/2|rIFIT1 and K 1/2|K 1|app|app|app	All tested IFITs bound to cap0-b-globin(G) mRNA very tightly (Figure 2A-C) , with similar affinities: K 1/2,app = 23  4 nM for hIFIT1, K 1/2,app = 20  1 nM for rIFIT1 and K 1/2,app = 9  2 nM for rIFIT1B.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:22065..22363:sentences:b8181f71e1e0b33961ccf7879bfde727	IFIT5|IFIT1|KRT1|KRT1|APP|APP	hIFIT5|hIFIT1|K 1|K 1|app|app	The affinities of rIFIT1B for cap1-b-globin(G) mRNA ( Figure 2D ; K 1/2,app = 457  24 nM) and of hIFIT5 for 5 0 ppp-bglobin(G) mRNA ( Figure 2E ; K 1/2,app = 372  21 nM) were similar, but were more than one order of magnitude lower than those of hIFIT1, rIFIT1 and rIFIT1B for cap0-b-globin(G) mRNA.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:23014..23229:sentences:922c93068778e4ad38085acd847551b7	IFIT2|IFIT3|IFIT1|IFIT5	hIFIT2|hIFIT3|hIFIT1|hIFIT5	hIFIT2 migrated as a dimer consistent with a previous report (15) . hIFIT3 also showed a high tendency to dimerization, whereas dimerization of hIFIT1 was lower, and hIFIT5 and rIFIT1 were mostly monomeric.. RESULTS.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:23231..23644:sentences:ad33d2a1f2adfa73d53abbdfffc57c67	IFIT1|IFIT2|IFIT3|IFIT5	hIFIT1|hIFIT2|hIFIT3|hIFIT5	Consistent with primer extension experiments ( Figure 1F ), EMSA also detected binding of cap0-RNA (comprising 62 5 0 -terminal nucleotides of cap0-bglobin(G) mRNA; Figure 2F , upper panel) only to hIFIT1, rIFIT1 and rIFIT1B ( Figure 2F , four left panels), confirming that the lack of binding of hIFIT2, hIFIT3 and hIFIT5 to cap0 mRNA in primer extension experiments was not caused by displacement of IFITs by RT.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:24426..24689:sentences:7babcda447414a4f686e2792abab1f60	CAP1|IFIT1|IFIT2|IFIT3|IFIT5	cap1|hIFIT1|hIFIT2|hIFIT3|hIFIT5	Again, as in primer extension experiments ( Figure 1F ), no binding to cap1-RNA was observed for hIFIT1, rIFIT1, hIFIT2, hIFIT3 and hIFIT5, and only a small amount of complexes formed in the case of rIFITB at the highest concentration of the protein ( Figure 2G ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:24691..24777:sentences:f12be2ec8f7d23dd5279569211a632d8	EIF4E|CAP1	eIF4E|cap1	In control experiments, eIF4E bound to both cap0-and cap1-RNAs ( Figure 2H ).. RESULTS.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:24779..25053:sentences:730a2c6b139631034c08e721b8cd1c0e	IFIT1|EIF4E|EIF4G1|IFIT1	hIFIT1|eIF4E|eIF4F|hIFIT1	Sensitivity of hIFIT1, rIFIT1 and rIFIT1B to N7methylation of the cap, and their competition with eIF4E and eIF4F for binding to cap0-mRNAs Next, we investigated the requirement for N7-methylation of the cap for binding of hIFIT1, rIFIT1 and rIFIT1B to cap0-b-globin(G) mRNA.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:25553..25701:sentences:0a867cf8ea5498b478848356892c4f5c	KRT1|APP	K 1|app	In contrast, binding of rIFIT1 to unmethylated cap0-globin(G) mRNA was weaker (K 1/2,app = 81  5 nM) than to the methylated equivalent ( Figure 3B ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:25703..25881:sentences:e1f17df7aaef65e5edc5f7d692179247	KRT1|APP	K 1|app	The highest dependence on N7-methylation was observed for rIFIT1B, which bound to unmethylated cap0-globin(G) mRNA with the lowest K 1/2,app of 340  15 nM ( Figure 3C ).. RESULTS.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:25883..26156:sentences:7dd9c702b0963e63af4e989a9ebe3e22	IFIT1|EIF4E|EIF4G1	hIFIT1|eIF4E|eIF4F	In competition experiments, association of hIFIT1 and rIFIT1B with N7-methylated cap0-b-globin(G) mRNA was not affected by 5-or even 10-fold excess of eIF4E ( Figure 3D ) or eIF4F ( Figure 3E ), irrespective of the presence of ATP or ADPNP in the reaction mixture.. RESULTS.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:26158..26291:sentences:be0cd939d9f65320f6249e1afbf266c3	IFIT1|IFIT2|IFIT3|IFIT5|CAP1	hIFIT1|hIFIT2|hIFIT3|hIFIT5|cap1	The effect of hIFIT1, hIFIT2, hIFIT3, hIFIT5, rIFIT1 and rIFIT1B on 48S initiation complex formation on cap0-, cap1-and 5 0 ppp-mRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:26420..26664:sentences:a50d6cfed7a846a26fe41aa9d38a2acc	EIF2S2|EIF3A|EIF1|EIF1|EIF4A2|EIF4B|EIF4G1|CAP1	eIF2|eIF3|eIF1|eIF1A|eIF4A|eIF4B|eIF4F|cap1	48S complexes were assembled from individual purified 40S subunits, Met-tRNA i Met , eIF2, eIF3, eIF1, eIF1A, eIF4A, eIF4B and eIF4F on cap0-, cap1-and 5 0 ppp-b-globin(G) mRNAs in the presence and absence of IFITs, and analyzed by toe-printing.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:26666..26991:sentences:97166baf89f23f057c5e93f490f6ad43	CAP1|IFIT5	cap1|hIFIT5	Although IFIT/ mRNA complexes (particularly rIFIT1B/cap1-mRNA and hIFIT5/5 0 ppp-mRNA complexes) were sensitive to dissociation by RT at high Mg 2+ concentrations, the toe-printing stage in these experiments was nevertheless performed at an elevated Mg 2+ concentration in order to 'freeze' 48S complexes after their assembly.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:26993..27131:sentences:104732dae4ddcdedcfba77f2234bf15b	CAP1|IFIT5	cap1|hIFIT5	As a result, toe-prints corresponding to rIFIT1B/cap1-mRNA and hIFIT5/5 0 ppp-mRNA binary complexes were not apparent in these experiments.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:27133..27336:sentences:7f177ab743af80dd213016143fdb60ff	IFIT1|IFIT2|IFIT3|IFIT5	hIFIT1|hIFIT2|hIFIT3|hIFIT5	At 800 nM, hIFIT1, rIFIT1 and rIFIT1B nearly abrogated 48S complex formation on cap0-b-globin(G) mRNA, whereas hIFIT2, hIFIT3 and hIFIT5 did not influence the level of 48S complex formation ( Figure 4A ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:27338..27575:sentences:b7e630c743e07d38cc99dac6976b9639	CAP1|IFIT5	cap1|hIFIT5	In addition, consistent with their binding to cap1-and 5 0 ppp-mRNAs ( Figures 1F, 2D and E) , rIFIT1B and hIFIT5 strongly inhibited 48S complex formation on cap1-b-globin(G) and 5 0 ppp-b-globin(G) mRNAs, respectively ( Figure 4B and C).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:27577..28153:sentences:ec99cfe286e56495993f88f8677e9ca5	IFIT1|CAP1|IFIT5	hIFIT1|cap1|hIFIT5	Thus, the ability of different IFITs to inhibit 48S complex formation on a specific mRNA correlated with their ability to interact with its 5 0 -terminal region ( Figures 1F and 2A-E) . Titration experiments showed that 48S complex formation on cap0-b-globin(G) mRNA was sensitive even to low concentrations of hIFIT1, rIFIT1 and rIFIT1B ( Figure 4D and E), whereas inhibition of 48S complex formation on cap1-bglobin(G) and 5 0 ppp-b-globin(G) mRNAs by rIFIT1B and hIFIT5 required higher protein concentrations ( Figure 4F and G) (quantitative comparison shown in Figure 4H ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:28155..28517:sentences:7dc6da6ea83153a8a853ef978c1007cf	IFIT1B|CAP1||IFIT1|KRT1|APP	IFIT1B|cap1|K 1/2,app|hIFIT1|K 1|app	Notably, the IC 50 for IFIT1B on cap1-bglobin(G) was $2-fold lower than would be anticipated on the basis of the K 1/2,app , which suggests that in this particular case, primer extension might have yielded an underestimated K 1/2,app value due to protein displacement by RT.. Identification of critical residues required for interaction of hIFIT1 with cap0-mRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:29038..29493:sentences:1df2835dc01850474f606cbb5966be20	IFIT1|IFIT5|IFIT1	hIFIT1|hIFIT5|hIFIT1	However, our structural evaluation indicated that N7-methylguanosine could be accommodated in the cleft with minimal disruption to RNA phosphate backbone and base binding if the trajectory of the ppp in the hIFIT1 binding pocket differed from that in hIFIT5 ( Figure 5A and examined their ability to bind cap0-b-globin(G) mRNA and inhibit 48S complex formation on it.. Identification of critical residues required for interaction of hIFIT1 with cap0-mRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:29495..29720:sentences:7425ac61e609da89798ad195fdc75946	IFIT5|IFIT5|IFIT1	hIFIT5|hIFIT5|hIFIT1	One set of mutations consisted of substitutions of residues (D34, K259 and R262), whose equivalents interact with 5 0 ppp-RNA in the hIFIT5 crystal structure and have been found to influence binding of RNA to hIFIT5 or hIFIT1.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:29722..30076:sentences:d9fa13d2df59886d1d86063eede48cee	IFIT5|IFIT1	hIFIT5|hIFIT1	E33 of hIFIT5 interacts with an ion, likely Mg 2+ , that bridges the aand g-phosphates of 5 0 ppp-RNA (16), and substitution by Ala of the equivalent D34 in hIFIT1 abrogated its ability to bind to cap0-bglobin(G) mRNA (as evidenced by the disappearance of the toe-print at the +67 positions; Figure 5C ) and to inhibit 48S complex formation ( Figure 5D ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:30078..30776:sentences:ecacc1f232567352e1a6697a0e963fc5	IFIT1|IFIT5|IFIT1|IFIT1|IFIT5|IFIT1|IFIT5	hIFIT1|hIFIT5|hIFIT1|hIFIT1|IFIT5|IFIT1|hIFIT5	This D34A substitution in hIFIT1 and to a lesser extent the analogous E33 substitution in hIFIT5 inhibited their binding to 5 0 ppp-RNA (16) . In hIFIT5, K257 and R260 make a salt bridge with the 5 0 -phosphate of the third nucleotide and are required for binding to 5 0 ppp-RNA (16, 18) . Similarly, K259E and R262E substitutions of equivalent residues in hIFIT1 abrogated its ability to bind to cap0-bglobin(G) mRNA and to inhibit 48S complex formation ( Figure 5C and D) . The neighboring R263E mutation also impaired the activity of hIFIT1 ( Figure 5C and D) . Thus, the residues that are involved in the interaction of IFIT5 with 5 0 ppp-RNA are also critical for binding of cap0 mRNA by IFIT1.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:32232..32370:sentences:db02bb45a581ac13c2aa2a62ed5e51fb	IFIT5|IFIT1|IFIT1	IFIT5|IFIT1|IFIT1	The conserved nature of the RNA-binding pockets of IFIT5 and IFIT1 raises the question of why only IFIT1 is able to interact with cap0-RNA.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:32372..32566:sentences:96b533ef14a229fab334b7ece67dd4fe	IFIT1|IFIT5	hIFIT1|hIFIT5	One obvious exception to the conserved character of the RNA binding cleft is the presence of R38 in hIFIT1 as compared to T37 at an analogous location in hIFIT5 ( Figure 5A , right middle panel).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:32568..33085:sentences:b7d0ce43e15d3461002113fe46c81a17	IFIT5|IFIT5|IFIT1|IFIT1|IFIT5	IFIT5|IFIT5|hIFIT1|hIFIT1|hIFIT5	In the IFIT5/RNA complex, T37 stabilizes K150, which interacts with the 5 0 ppp at both the b and g positions: both residues are essential for binding of IFIT5 to 5 0 ppp-RNA (16) . An R38A substitution abrogated the ability of hIFIT1 to bind to cap0-b-globin(G) mRNA and inhibit 48S complex formation ( Figure 5C and D) . The position of R38 might enable it to support an interaction between hIFIT1 and cap0 in which the location of the ppp moiety is distinct from that in the hIFIT5/5 0 ppp-RNA co-crystal structure.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:33087..33378:sentences:1b30da1d6424e174b5e96e1f5a815ad9	IFIT1|IFIT5|IFIT1	IFIT1|hIFIT5|hIFIT1	Moreover, the absence in IFIT1 of the stabilizing influence of a Thr residue at this location may free K151 (homologous to K150 in hIFIT5) to contribute to interaction with the ppp in the new trajectory.. Identification of critical residues required for interaction of hIFIT1 with cap0-mRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:33380..33708:sentences:083983cc78044c78364e768fe2df76bf	IFIT5|IFIT1	IFIT5|hIFIT1	Finally, substitution of F390 and K417, which are distal to the RNA binding cleft and located in a region that has been implicated in IFIT5's interaction with tRNA (17; Figure 5A ), had a very weak effect on hIFIT1 activity ( Figure 5C and D) indicating that the charged cleft is the principal determinant of binding of cap0-RNA.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:33952..34197:sentences:f90b6aa3a125cf49c25c6d26fb6f8d99	IFIT1|IFIT5|IFIT1	IFIT1|IFIT5|hIFIT1	In fact, if the positions of the first four nucleotides of cap0-RNA bound to IFIT1 are similar to those on IFIT5, then the sixth nucleotide would reach K417.. Identification of critical residues required for interaction of hIFIT1 with cap0-mRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:34199..34275:sentences:7434d7bcb15ba4d70420854174a0cee0	IFIT1|IFIT2|IFIT3|IFIT5	hIFIT1|hIFIT2|hIFIT3|hIFIT5	Interaction of hIFIT1, hIFIT2, hIFIT3, hIFIT5, rIFIT1 and rIFIT1B with tRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:34492..34674:sentences:20745fb322a3f675d020e3970bcf02ee	IFIT1|IFIT2|IFIT3|IFIT5	hIFIT1|hIFIT2|hIFIT3|hIFIT5	First, we investigated association of hIFIT1, hIFIT2, hIFIT3, hIFIT5, rIFIT1 and rIFIT1B (at a concentration of 400 nM) with [ 32 P]-labeled Met-tRNA i Met , using EMSA ( Figure 6A ).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:34676..34792:sentences:40a3b20641956fbec65789824be21267	IFIT5|IFIT1	hIFIT5|hIFIT1	The most efficient binding was observed for rIFIT1, rIFIT1B and hIFIT5, whereas binding of hIFIT1 was somewhat lower.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:34794..34908:sentences:f29ed7e3959e0034fda78ac279140983	IFIT2|IFIT3	hIFIT2|hIFIT3	In contrast, hIFIT2 showed very low affinity to Met-tRNA i Met , and no binding was detected in the case of hIFIT3.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:34910..35108:sentences:a7b3608218404f0a0cde7dad14d95d18	IFIT5|IFIT1	hIFIT5|hIFIT1	rIFIT1 and hIFIT5 bound to Met-tRNA i Met as monomers, a small proportion of hIFIT1 formed dimers and higher order oligomers, whereas almost all rIFIT1B formed very large, slowly migrating oligomers.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:35110..35488:sentences:d5620bfa8eb28551df61fc6180b9d4c5	EIF2S2|EIF2S2|EIF2S2|IFIT1	eIF2|eIF2|eIF2|hIFIT1	Interestingly, inclusion of eIF2 in a reaction mixture with Met-tRNA i Met and rIFIT1B resulted in a specific supershift ( Figure 6B ), suggesting the possibility of simultaneous interaction of rIFIT1B and eIF2 with the same tRNA molecule, or of direct interaction between eIF2 and rIFIT1B.. Identification of critical residues required for interaction of hIFIT1 with cap0-mRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:37321..37520:sentences:cd0c3d3224e8ee10b9848b06e603c5b8	IFIT1|IFIT1B|IFIT2|IFIT3|IFIT5|	IFIT1|IFIT1B|IFIT2|IFIT3|IFIT5|K 1/2,app $ 9	Here we report that IFIT1 and IFIT1B (but not IFIT2, IFIT3 or IFIT5) bind specifically and with high affinity to the cap-proximal regions of cap0-mRNAs (K 1/2,app $ 9 to 23 nM for b-globin cap0-mRNA).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:37522..37836:sentences:d013936bf1a54c41e0ae9d18c94c7679	IFIT5|IFIT1|IFIT1B	IFIT5|IFIT1|IFIT1B	Interaction with mRNA occurs in a region of these proteins that is analogous to the narrow positively charged RNA-binding cleft in IFIT5 that accommodates 5 0 ppp-RNAs (16, 18) . Binding of IFIT1 and IFIT1B to cap0-mRNAs abrogates 48S complex formation in the in vitro reconstituted translation system.. DISCUSSION.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:37838..37957:sentences:85cc722190ea7ee6d6c705863a4725bf	IFIT1|IFIT1B|EIF4E|EIF4G1	IFIT1|IFIT1B|eIF4E|eIF4F	The affinity of IFIT1 and IFIT1B enables them to outcompete eIF4E and eIF4F for binding to cap0-mRNA ( Figure 3D and E).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:38208..38724:sentences:cdc88499547cbcf5c98b0530f9bda9f1	EIF4E|EIF4G1|EIF4G1|EIF4G1|EIF4G1|IFIT1|IFIT1B|EIF4G1	eIF4E|eIF4F|eIF4F|eIF4F|eIF4F|IFIT1|IFIT1B|eIF4F	[48] [49] [50] . The exact affinity for the cap of eIF4E as a subunit of eIF4F has not been determined, but it appears not to contribute significantly to the overall affinity of eIF4F for mRNA, because the apparent dissociation constants for binding of eIF4F to capped and uncapped mRNAs differ only slightly (18  7 nM and 23  7 nM for b-globin mRNA, respectively) (51) . Although the overall affinity of eIF4F for mRNA is similar to that of IFIT1 and IFIT1B, IFITs strongly outcompete eIF4F for binding to cap0 mRNA.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:38726..38913:sentences:5ac0ec2ed81bcbfa7c48037661ddc243	EIF4E|EIF4G1|EIF4G1|IFIT1|IFIT1B	eIF4E|eIF4G|eIF4F|IFIT1|IFIT1B	This suggests that the affinity of eIF4E bound to eIF4G within the eIF4F complex for the cap-terminal region of RNA is still substantially lower than that of IFIT1 and IFIT1B.. DISCUSSION.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:39732..40418:sentences:faa3f21034afcfdafd25ea22023a737d	EIF4E|EIF4E3|IFIT1|IFIT1	eIF4E|eIF4E3|IFIT1|IFIT1	In most instances, the enhancement of binding by N7-methylation is strong, amounting to 2 to 3 orders of magnitude for eIF4E (60), eIF4E3 (49) and CBC20 (61) . The putative pocket in T  I  F  I  h   1  T  I  F  I  r  +  S  0  4   B  1  T  I  F  I  r  +  S  0  4   S  0  4   1  T  I  F  I  r   B  1  T  I  F  I  r   3  T  I  F  I  h  +  S  0  4   3  T  I  F  I  h   2  T  I  F  I  h  +  S  0  4   5  T  I  F  I  h  +  S  0  4   2  T  I  F  I  h   5  T  I  F  I IFIT1 that could accommodate the m 7 G moiety includes several aromatic residues, of which W147 and Y218 were critical for binding of IFIT1 to cap0-mRNA ( Figure 5 ), and could therefore be directly involved in cap recognition.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:40420..40697:sentences:4ff3c62507f6661d8a2c817955408821	IFIT5|IFIT1	IFIT5|IFIT1	However, any speculation concerning potential stacking interactions involving these residues is premature because considerable conformational change occurs in IFIT5 as a consequence of its binding to 5 0 ppp-RNA (16) , and might similarly accompany binding of cap0-RNA to IFIT1.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:40699..41114:sentences:ae234af079b2e9fbe536c44b03a4cf36	IFIT1|IFIT1B|IFIT1|IFIT1B	IFIT1|IFIT1B|IFIT1|IFIT1B	Although N7-methylation enhanced the affinity of IFIT1 and IFIT1B for cap0-RNA by only $3.5 -and $10-fold, respectively, these modest increases are not unprecedented, as a similar 5-fold enhancement was reported for the influenza PB2 polymerase subunit (56) . Low dependence on N7-methylation suggests that interactions other than with m 7 G contribute significantly to the affinity of IFIT1 and IFIT1B to cap0-RNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:41229..41757:sentences:75d471a6292c84f04d43477246861339	IFIT1|IFIT1B|IFIT1|IFIT1B|IFIT5	IFIT1|IFIT1B|IFIT1|IFIT1B|IFIT5	Thus, binding of CBC20 to the cap is enhanced by the first 2 nt, and influenza PB2 requires at least 4 nt for efficient interaction and binds even more strongly if 9 nt are present (62) . Based on the arrest of RT at positions +68 nt from the 5 0 -end on the IFIT1/cap0-RNA and IFIT1B/cap0-RNA complexes, the interaction of IFIT1 and IFIT1B with mRNA also involves at least 4-5 nt, which is in turn consistent with the number of nucleotides that are observed to interact with IFIT5 in the co-crystal structure (16) .. DISCUSSION.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:41759..41937:sentences:0047bacf6a7a6ef0caae29eeb174028c	IFIT1|IFIT1|CAP1	IFIT1|IFIT1|cap1	The interaction of IFIT1 with RNA was abrogated by 2 0 -O-methylation: in primer extension inhibition experiments, no binding was observed for human and rabbit IFIT1 to cap1-mRNA.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:41939..42135:sentences:dbf48fb2455abc71fffbf83dfacd2969	CAP1||SECTM1	cap1|K 1/2,app $ 450 nM|K 1/2,app $ 9	rIFIT1B, on the other hand, retained the ability to bind to cap1-RNA, but with an affinity (K 1/2,app $ 450 nM) that was more than one order of magnitude lower than for cap0-RNA (K 1/2,app $ 9 nM).
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:42137..42357:sentences:194b71d7b03eae232b8535237ed39c83	IFIT1|IFIT1B|IFIT5|CAP1|IFIT1|IFIT5	IFIT1|IFIT1B|IFIT5|cap1|IFIT1|IFIT5	If the paths for the first 4 nt of RNA bound to IFIT1 and IFIT1B are similar to that of 5 0 ppp-RNA bound to IFIT5, then a clash of the 2 0 -O-methyl group of cap1-RNA with R187 of IFIT1 (R186 in IFIT5) might be expected.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:42359..43015:sentences:d5872ac2c2a1dcf173a145728b2c9664	IFIT5||IFIT1|IFIT1|IFIT1|IFIT5|IFIT1|IFIT5	IFIT5|K 1/2,app $ 400 nM|IFIT1|IFIT1|IFIT1|IFIT5|IFIT1|IFIT5	Stable binding was also observed between IFIT5 and 5 0 ppp-mRNA, with an affinity (K 1/2,app $ 400 nM) that is comparable to that determined previously by EMSA (K d = 250-500 nM) (16) . IFIT1, on the other hand, did not stably interact with 5 0 ppp-mRNA, even though moderate-affinity binding of IFIT1 to such RNAs was detected by surface plasmon resonance (K d $ 240 nM) (10) . Although this discrepancy could be explained by potential displacement of IFIT1 by RT during primer extension, the fact that in contrast to IFIT5, IFIT1 did not inhibit 48S complex formation on 5 0 ppp-mRNA suggests that its affinity to 5 0 ppp-mRNA is lower than that of IFIT5.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:43017..43211:sentences:b9537e97a7321ee2edf91c4578322437	IFIT1B|IFIT5|CAP1|IFIT1|IFIT1B	IFIT1B|IFIT5|cap1|IFIT1|IFIT1B	Importantly, although detected, interactions of IFIT1B and IFIT5 with cap1-and 5 0 ppp-mRNAs were substantially weaker than specific interactions of IFIT1 and IFIT1B with cap0-mRNAs.. DISCUSSION.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:43213..43283:sentences:81648be31f3bfa533cffaec8674cd16a	IFIT5|IFIT1|IFIT1B	IFIT5|IFIT1|IFIT1B	Similarly to IFIT5 (17), IFIT1 and IFIT1B also bound to initiator tRNA.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:43285..43570:sentences:8ef6b0717c044dbcdebf88c0b2feaf93	IFIT5|IFIT5|IFIT1	IFIT5|hIFIT5|hIFIT1	In IFIT5, the tRNA-binding surface was assigned to an area in close proximity to the entrance of the 5 0 ppp-RNA-binding pocket (17; Figure 5A ), and tRNA binding to this site on hIFIT5, or to a homologous position on hIFIT1, would be expected to occlude the narrow ssRNA binding cleft.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:43572..43695:sentences:a16779425dbe65fcaf6f79c3a986c999	IFIT1|IFIT1B	IFIT1|IFIT1B	The observed competition between initiator tRNA and cap0-mRNA for binding to IFIT1 and IFIT1B is consistent with this model.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:44244..44461:sentences:f8d5192fd1eb5b9e898d8fe6cd6c51af	IFIT1|IFIT1B|IFIT1	IFIT1|IFIT1B|IFIT1	Importantly, despite their interactions with initiator tRNA and the 40S subunit, IFIT1 and IFIT1B did not interfere with the assembly of 43S preinitiation complexes, as suggested for human IFIT1 (30, 31) .. DISCUSSION.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:44700..44871:sentences:dbe24432dd8adeda75250cbbbdd8218c	IFIT1|IFIT1B|IFIT1|CAP1|IFIT5	IFIT1|IFIT1B|IFIT1|cap1|IFIT5	The strongest inhibition was mediated by IFIT1 and IFIT1B on cap0-mRNA, followed by IFIT1Bmediated inhibition on cap1-mRNA, and then by inhibition on 5 0 ppp-mRNA by IFIT5.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:44943..45098:sentences:cab4a44d6efb38b5ed24478499177965	IFIT1|IFIT1B	IFIT1|IFIT1B	Taking the level of inhibition into account, suppression of initiation on cap0-mRNAs by IFIT1 and IFIT1B is likely to be physiologically the most important.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:45100..45309:sentences:7c69d4db446d05432cc34ecf3b2d2a1a	IFIT1|IFIT1B|EIF4G1	IFIT1|IFIT1B|eIF4F	The abundance of IFIT1 and IFIT1B and their ability to competitively inhibit binding of eIF4F to cap0-mRNAs form the basis of a mechanism for regulation of translation of any mRNA that has a 5 0 -terminal cap0.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:45311..45821:sentences:c84dbfa9747439a0228d3288408cb172	IFIT1|IFIT1B|EIF4G1|EIF4E|EIF4E	IFIT1|IFIT1B|eIF4F|eIF4E|eIF4E	The lack of specificity of the IFIT1(IFIT1B)/cap0-mRNA interaction differentiates this mechanism from others that sequester the cap of specific mRNAs to prevent their functional interaction with eIF4F, such as the enhanced binding of the Drosophila 4 E-homologous protein (d4EHP) to the 5 0 -terminal cap of Caudal mRNA by Bicoid (which binds d4EHP and the 3 0 UTR of Caudal mRNA) (63) , and of eIF4E to the cap of Oskar mRNA by Cup (which interacts with eIF4E and the Oskar 3 0 UTR-binding protein Bruno) (e.g.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:45842..46053:sentences:18e3f66f8e84eb05ce2366e0d3b51d87	IFIT1|IFNA1|IFIT1	IFIT1|IFN|IFIT1	Expression of IFIT1 is strongly up-regulated in response to viral infection by IFN-dependent and -independent mechanisms (8, 65) , and IFIT1-mediated translational regulation likely primarily targets viral mRNAs.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:46055..46657:sentences:95f62e9e45970ea835a31bf549acaac3	IFIT1|CD34|IFIT1B	IFIT1|CD34|IFIT1B	However, IFIT1 may also have other targets, since it is constitutively expressed in various cells including human skin fibroblasts (66) and some sarcoma cell lines (67) , over-expressed in CD34 + cells of patients with hematopoetic malignancies (68) and influences the radiation sensitivity of early-stage breast cancer (69) . IFIT1B is thought not to be expressed in an IFNdependent manner (11) , but as neither the cell types in which it occurs nor the circumstances that induce its expression are known, speculation about its physiological importance in translational control mechanisms is premature.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:46659..46821:sentences:e058f2e61571c4110caf131f0fa47878	IFIT1|CAP1	IFIT1|cap1	However, it clearly has the potential to act as a more wide-ranging inhibitor of translation than IFIT1, because of its ability to bind to cap1-mRNAs.. DISCUSSION.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:46823..46917:sentences:fb9a1ce365b78e6a48b71ff9e1e0bc09	IFIT1|IFIT1B	IFIT1|IFIT1B	Which mRNAs are potential regulatory targets for the cap0-binding activity of IFIT1 and IFIT1B?
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:46919..47078:sentences:da38c0ad63a836874aaffd516191f624	IFIT1|IFIT1B	IFIT1|IFIT1B	Viruses such as Sindbis virus do not encode a 2 0 -O-methyltransferase, and their cap0-mRNAs are therefore strong candidates for inhibition by IFIT1 and IFIT1B.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:47080..48286:sentences:a63b0180ee5bcc19230013ef35a153e4	IFIT1|IFIT1|IFIT1|CAP1	IFIT1|IFIT1|IFIT1|cap1	Consistently, Sindbis virus replication was impaired by over-expression of IFIT1 and enhanced by its siRNA-mediated silencing (21) . Moreover, the absence of IFIT1 in Ifit / mice and murine embryonic fibroblasts and macrophages enhanced replication of 2 0 -O-methylation-defective mutant forms of human coronavirus 229 E and mouse hepatitis virus (family Coronaviridae), poxvirus (family Poxviridae), West Nile virus and Japanese encephalitis virus (family Flaviviridae), which are normally very sensitive to innate immune responses (22, 35, (70) (71) (72) . For most viruses, the enzymes that catalyze N7-methylation and 2 0 -O-methylation of viral mRNA are part of either a multi-domain protein or a 'cap assembly line', and the reactions are consequently tightly coupled (2) . However, in some instances they may be temporally separated, for example if they are catalyzed by enzymes that function in a defined order (such as the SARS-coronavirus nsp14 guanine-N7-methyltransferase and nsp10/nsp16 nucleoside-2 0 -O-methyltransferase) (73) . In such cases, it would hypothetically be possible for IFIT1 to sequester viral mRNAs after synthesis of cap0 but before completion of cap1 formation.. DISCUSSION.
+SARS:0ce1f213337247a67628f95cf699bdabddc94d9c:fulltext:2b6bca703167b460e4f0de91cf50cb07:48406..48831:sentences:c854309f35db144af28ed47a785a6b44	CAP1|CAP2	cap1|cap2	Formation of cap0 is a co-transcriptional process, and mRNAs that lack the N7-methyl moiety are recognized as being incorrectly capped and are degraded (74) , whereas correctly capped mRNAs are sequentially methylated at the 2 0 -hydroxyl position of the first and second transcribed riboses by nuclear and cytoplasmic cap-specific 2 0 -O nucleoside RNA methytransferases, respectively, yielding cap1 and cap2 structures (e.g.
+SARS:0f880cb0b394ac20be2a2868fecaefd4d8f341b3:abstract:42ce2174f911129c143a9a7ee79c0660:344..713:sentences:302be17cb5cd21fa4580c59713e678d6	MAPK3|CDA|AICDA|AICDA	ERT2|cytidine deaminase|AID|AID	This study takes advantage of the progeny of mice expressing tamoxifen-inducible Cre recombinase (Cre-ERT2) under the Aicda promoter crossed with Rosa26-loxP-tdTomato reporter mice (AID(Cre)-Rosa26(tdTomato)) to monitor B cells having undergone activation-induced cytidine deaminase (AID)-mediated somatic hypermutation (SHM) following neurotropic coronavirus infection.
+SARS:0f880cb0b394ac20be2a2868fecaefd4d8f341b3:abstract:42ce2174f911129c143a9a7ee79c0660:715..851:sentences:5f731782c4787febc61b0e9610602b40	PYCARD|AICDA	ASC|AID	AID detection via tdTomato expression allowed tracking of virus-specific ASC and Bmem in priming and effector sites throughout infection.
+SARS:0fa18c47543c3ce69a3c9e4d77958c4d3691b1ed:abstract:f2b835fec3ab7c2d774c875861ca59f5:432..627:sentences:5083e45168b3edb4663ae49a9b573ecb	GC|DBP|MAF	Vitamin D-binding protein macrophage activating factor|DBP|MAF	Vitamin D-binding protein macrophage activating factor (DBP-MAF) is a multifunctional protein that is characterized by two hydrophobic regions able to bind fatty acids and vitamin D, respectively.
+SARS:0fa18c47543c3ce69a3c9e4d77958c4d3691b1ed:abstract:f2b835fec3ab7c2d774c875861ca59f5:629..769:sentences:886a7803e88974cf881dda8bc9f29cb9	SLC10A1|DBP|MAF	NTCP|DBP|MAF	Here we demonstrate that NTCP and DBP-MAF show significant sequence similarities as far as hydrophobic stretches of aminoacids are concerned.
+SARS:0fa18c47543c3ce69a3c9e4d77958c4d3691b1ed:abstract:f2b835fec3ab7c2d774c875861ca59f5:771..997:sentences:6dc3c0a9752adf210902ab48676b7796	SLC10A1|DBP|MAF	NTCP|DBP|MAF	Alignment of the sequence of seven aminoacids preceding the 157-KGIVISLVL-165 stretch of NTCP shows four aminoacids that are identical to those of the corresponding sequence of DBP-MAF, and two that are conserved substitutions.
+SARS:0fa18c47543c3ce69a3c9e4d77958c4d3691b1ed:abstract:f2b835fec3ab7c2d774c875861ca59f5:999..1347:sentences:bbde61021d21cd31247727e9fbaf4840	DBP|MAF|SLC10A1|SLC10A1	DBP|MAF|NTCP|NTCP	In addition, in the sequence of DBP-MAF that is aligned with the sequence YKGIVISLVL of NTCP, there are two contiguous negatively charged aminoacids (ED) and, in the preceding epta-peptide sequence, there are three negatively charged aminoacids (D-ED), whereas in the corresponding sequence of NTCP there are only two (D--D) that are not contiguous.
+SARS:0fd60c231b28076c5195a8b611873708adc454ad:title:8c6cc3eb225073bce344c7c230d60b2e:0..81:sentences:40d5aaab228bbe2e3eaf052993b9dfcd	ACE2|ACE	ACE2|ACE	ACE2, COVID19 and serum ACE as a possible biomarker to predict severity of disease
+SARS:0fe4c61765775f05ecce8cc192fb3cfff30c8dff:abstract:f40bc4fa6d0e0daf195ebd96e23adddc:248..561:sentences:92e00bcf50b98a53d7c03f838e243a01	FANCB|FANCB|VTN|MYOM2	Fab|Fab|S protein|M protein	Using the phage-displayed peptide library screening method and purified Fab fragments of immunoglobulin G (IgG Fab) from normal human sera and convalescent sera from SARS-CoV-infected patients as targets, 11 B cell epitopes of SARS-CoV spike glycoprotein (S protein) and membrane protein (M protein) were screened.
+SARS:105eabe3e019ae2bb0f93493d7f43d2c1c19e4c5:abstract:98a986ff9a8e7c22edd95c81d41396f7:0..198:sentences:4c1510105f8a000245605b60fe57f65d	CD209|CLEC4D	DC-SIGN|C-type lectin receptor	Dendritic cell-specific ICAM-3 grabbing non-integrin (DC-SIGN) expressed on a variety of DCs, is a C-type lectin receptor that recognizes glycans on a diverse range of pathogens, including parasites.
+SARS:105eabe3e019ae2bb0f93493d7f43d2c1c19e4c5:abstract:98a986ff9a8e7c22edd95c81d41396f7:675..818:sentences:de0aa8337d6a1715eeaf197b34554ab3	CD209|IL10|IL27	DC-SIGN|IL-10|IL-27p28	Furthermore, we demonstrate that F. hepatica glycans induce DC-SIGN triggering leading to a strong production of TLR-induced IL-10 and IL-27p28.
+SARS:104e60eede9e4016c243f20f4541a33852ea3d1c:fulltext:8e7423cb91f3c726bc9f963196b8d15b:13202..13442:sentences:9e385e9456051823cf30c45ac022a4b5	IL8|CCL2	IL-8|monocyte chemoattractant protein-1	Previous studies reported the increased levels of CSF proinflammatory cytokines such as interleukin (IL)-6, IL-8, monocyte chemoattractant protein-1 and macrophage inflammatory protein-1 in patients with encephalopathy who had RSV infection.
+SARS:0fc5801b4cdc21c018c93aa3cbc9b601491fdeb4:fulltext:9fbc5980cd41002d91b58ef63196d366:7434..7673:sentences:c968d43d3ca4afac3b948cd997cbd09d	ACE2|ACE2|ANPEP|ANPEP	angiotensinconverting enzyme 2|hACE2|aminopeptidase N|APN	Similar molecules are also used by other coronaviruses to enter cells, including human angiotensinconverting enzyme 2 (hACE2), which is used by SARS-CoV and HCoV-NL63, and aminopeptidase N (APN), which is used by several alphacoronaviruses.
+SARS:0fc5801b4cdc21c018c93aa3cbc9b601491fdeb4:fulltext:9fbc5980cd41002d91b58ef63196d366:7675..8142:sentences:8325a301266815b38f2acd90a37ee3cf	ACE2|ANPEP|DPP4|ACE2|DPP4|ACE2|DPP4|DPP4	hACE2|APN|DPP4|hACE2|DPP4|hACE2|DPP4|DPP4	The catalytic sites of hACE2, APN, and likely DPP4 are not required for virus entry (10) . Intriguingly, both hACE2 and DPP4 are shed from the cell surface (11, 12) . Loss of hACE2 results in more severe pulmonary disease, while DPP4 is a neutrophil chemorepellent (13) . Changes in DPP4 shedding that occur as a result of infection with MERS-CoV could influence the composition of the immune cell infiltrate, thereby ultimately affecting the outcome of the infection.
+SARS:0fc5801b4cdc21c018c93aa3cbc9b601491fdeb4:fulltext:9fbc5980cd41002d91b58ef63196d366:8398..8806:sentences:f22b43c1131016bba815ed7ec6a0ce00	CEACAM1|DPP4|DPP4	CEACAM-1|DIPEPTIDYL PEPTIDASE 4|DPP4	Curiously, CEACAM-1, the host cell receptor for mouse hepatitis virus (MHV), a murine coronavirus, is also expressed on T cells and is involved in signaling (14), but MHV does not infect T lymphocytes.. THE HOST CELL RECEPTOR FOR MERS-CoV IS DIPEPTIDYL PEPTIDASE 4. Events occurring immediately after MERS-CoV binds its DPP4 Perspective receptor appear to be similar to those reported for other coronaviruses.
+SARS:0fc5801b4cdc21c018c93aa3cbc9b601491fdeb4:fulltext:9fbc5980cd41002d91b58ef63196d366:8971..9179:sentences:7ea4cb75a26dee1dea4b8b4fcf90e8f9	CTSB|IFNA1	cathepsin B|IFN	Several host proteases, including cathepsin B and members of the TMPRSS family, have been implicated in this process (15) .. MERS-CoV DOES NOT INDUCE IFN BUT IS MORE SUSCEPTIBLE THAN SARS-CoV TO IFN TREATMENT.
+SARS:0fc5801b4cdc21c018c93aa3cbc9b601491fdeb4:fulltext:9fbc5980cd41002d91b58ef63196d366:9181..9708:sentences:3c73490412894ba1657bc1bfaac5e33d	IFNA1|IFNA1|DDX58	IFN|IFN|RIG-I	A notable feature of the MERS-CoV infection is that the virus does not appear to induce an interferon (IFN) or proinflammatory innate immune response in primary human airway epithelial cells or in cultured cells (16, 17) . A relative lack of IFN induction is a common feature of all coronavirus infections and may reflect both specific virus-mediated inhibition of cytoplasmic RIG-I-like sensing pathways and general evasion of cytoplasmic sensors via sequestration of viral macromolecular proteins inside membranous structures.
+SARS:10a7ff8413936efe6d169a8b7ec490387ceb6f84:abstract:ba7c65ef966c15f02fe6d067948576d2:119..350:sentences:549298d0595dabce809ac610efa7835a	PTPN6|BEAN1	SHP-1|BeAn	Mice genetically lacking SHP-1 (me/me) display severe inflammatory demyelinating disease following intracranial inoculation with the BeAn strain of Theiler's murine encephalomyelitis virus (TMEV) compared to infected wild-type mice.
+SARS:10a7ff8413936efe6d169a8b7ec490387ceb6f84:abstract:ba7c65ef966c15f02fe6d067948576d2:1349..1629:sentences:fc2155b5d788198502d51e70f787dd00	CCL2|PTPN6|CCL2	MCP-1|SHP-1|MCP-1	In addition, peripheral MCP-1 neutralization attenuated disease severity, decreased macrophage infiltration into the CNS, and decreased monocyte numbers in the blood of SHP-1-deficient mice, implicating MCP-1 as an important mediator of monocyte migration between multiple tissues.
+SARS:10a00127b58146d07b27dedcfe228aa22c392188:abstract:0cbfac9f3721dcd9c1c678cec0b6a270:0..150:sentences:59af3cf873e88768e5ce4c2028762f23	|DCLRE1C	RAG1/2|DCLRE1C	Abstract Defects in DNA Recombination due to mutations in RAG1/2 or DCLRE1C result in combined immunodeficiency (CID) with a range of disease severity.
+SARS:10a00127b58146d07b27dedcfe228aa22c392188:abstract:0cbfac9f3721dcd9c1c678cec0b6a270:152..397:sentences:12019b2a61ab9d6bde29a0d6446313a1	RAG1|RAG2|DCLRE1C	RAG1|RAG2|DCLRE1C	We present the clinical, immunologic and molecular characteristics of 21 patients with defects in RAG1, RAG2 or DCLRE1C, who accounted for 24% of combined immune deficiency cases in the Kuwait National Primary Immunodeficiency Disorders Registry.
+SARS:10a00127b58146d07b27dedcfe228aa22c392188:abstract:0cbfac9f3721dcd9c1c678cec0b6a270:399..523:sentences:b7bed9415c3cbbd7d264b4fb30f0ad93	RAG1|RAG2|DCLRE1C	RAG1|RAG2|DCLRE1C	The distribution of the patients was as follow: 8 with RAG1 deficiency, 6 with RAG2 deficiency and 7 with DCLRE1C deficiency.
+SARS:103228b102f34e60c7057cc68069d00194959837:fulltext:660066f43a3949dd425806b13ef56f13:45..175:sentences:dd8cbbd183c744800b0e26fcc0594ebf	|LAMP1|PAGR1	IFITM2/3|LAMP1|PA1	Cells were stained with anti-IFITM2/3 (Proteintech, 66081-1-Ig), and anti-LAMP1 Antibody (Thermo Fisher, PA1-654A) overnight at 4C.
+SARS:103228b102f34e60c7057cc68069d00194959837:fulltext:660066f43a3949dd425806b13ef56f13:884..1032:sentences:98475cafb62542f896013a625a303097	|LAMP1	IFITM2/3|LAMP-1	Z-stacks were analyzed with Imaris (Bitplane) using the ImarisCell analysis module to quantify number and intensity of IFITM2/3 and LAMP-1+ vesicles.
+SARS:103228b102f34e60c7057cc68069d00194959837:fulltext:660066f43a3949dd425806b13ef56f13:2133..2338:sentences:453fdab7cf217abf0cd21516a039abda	IFITM3|IFITM3|IFITM2|IFITM1	IFITM3|IFITM3|IFITM2|IFITM1	(C) HEK293T cell lines stably expressing FLAGtagged IFITM3, IFITM3 mutants, IFITM2, or IFITM1 were seeded in 24-well plates (50,000/well) overnight and treated with DMSO or rapamycin (30 uM) for four hours.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:357..887:sentences:9f3e0af7dda0e5989fd507c6e05ca605	IRF3|C4BPA	IRF-3|PrP	Interestingly, it has also been reported that infection by some viruses enhances the degradation of IRF-3 and/or inhibits its phosphorylation, resulting in the reduced response of IFN-I production and persistent infection by the virus [2] [3] [4] [5] [6] [7] .. . Prion diseases are neurodegenerative disorders characterized by an aggregation of abnormal prion protein (PrP Sc ) 8 . Since PrP Sc itself seems to be an infectious agent and the protein is host-encoded, acquired immunity against prion disease should not be possible.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:2004..2297:sentences:58984ae073bf5f0d5665f1ac8aca5b38	IRF3|POU2F1|POU2F1|IRF3|POU2F1	IRF-3|octamer-binding transcription factor-1|Oct-1|IRF-3|Oct-1	In this study, we analyzed murine IRF-3 promoter activity in detail and its relationship to prion infection, and have shown that the octamer-binding transcription factor-1 (Oct-1) positively regulates murine IRF-3, and the expression levels of Oct-1 decreased in prion-infected cells.. Results.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:5005..5053:sentences:75dfc928ed0fb9e79408e8f0af5bb64a	POU2F1|IRF3	Oct-1|IRF-3	Oct-1 is responsible for IRF-3 promoter activity.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:5213..5401:sentences:d0ca690f419d4dde686a5742908674d2	RUNX1|RUNX1|PLXNA2	acute myeloid leukemia 1 protein|AML1|Oct	and found that this region contains a potential Oct-1 binding site (59-ATTTGCAT-39, nt -42 to -35) and an acute myeloid leukemia 1 protein (AML1) binding site (59-TGCGGT-39, nt -49 to -44).
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:6126..6392:sentences:918c88f0100e9d1a07366b6caa75624e	SDHC|POU2F1|IRF3	pGL3|Oct-1|IRF-3	We obtained similar results in the second mutated plasmid pGL3 -119/-1 (M2) where activity was also significantly reduced in N2a and 3T3 cells ( Fig. 3e and 3f) . These results indicate that the Oct-1 site might play a crucial role for murine IRF-3 promoter activity.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:6476..6552:sentences:99035a3f3103938912fe7dfbdcef024d	SDHC|E2F1	pGL3|E2F1	The original plasmid pGL3 -119/-1 and the E2F1 site mutated plasmid (M3: Fig.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:6691..6954:sentences:72dd7f3a22b25ced3236b6d4cffb6084	SDHC|E2F1|IRF3	pGL3|E2F1|IRF-3	The activities of pGL3 -119/-1 (M3) were not significantly different compared to the original plasmid promoter activity in N2a and 3T3 cells ( Fig. 3h and 3i) , indicating the E2F1 is not an important determining factor for the regulation of murine IRF-3 promoter.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:7237..7362:sentences:11e9049e250ec37025eb3ffed06c7450	POU2F1|IRF3	Oct-1|IRF-3	To confirm that Oct-1 binds to the endogenous murine IRF-3 promoter, chromatin immunoprecipitation (ChIP) assay was performed.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:7654..7800:sentences:0c332b968078e2de23853f23c50e4fc9	POU2F1|POU2F1|SDHC	Oct-1|Oct-1|pGL3	Furthermore, to investigate whether the promoter activity is affected by Oct-1, pcDNA Oct-1-HA and pGL3 -119/-1 were co-transfected into N2a cells.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:7802..8150:sentences:9f15601a0b4f978c3b3f7f71e44d48c1	POU2F1|SDHC|SDHC|POU2F1|SDHC|SDHC|POU2F1	Oct-1|pGL3|pGL3|Oct-1|pGL3|pGL3|Oct-1	Ectopically Oct-1 overexpression significantly increased the original promoter activities (pGL3 -119/-1 1 mock vs pGL3 -119/-1 1 pcDNA Oct-1-HA), while Oct-1 expression had no effect on the mutated promoter activities [pGL3 -119/-1 (M1) 1 mock vs pGL3 -119/-1 (M1) 1 pcDNA Oct-1-HA], indicating exogenous Oct-1 functions in the promoter region (Fig.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:8866..9009:sentences:328aa6310f01186c28a0cc65cad03d9a	IRF3|POU2F1	IRF-3|Oct-1	These results demonstrate that reduced IRF-3 promoter activity in prion-infected cells is accompanied by decreased levels of Oct-1.. Discussion.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:9201..9427:sentences:13fe62b180738e520f695fc87e37d698	E2F1|IRF3|E2F1|E2F1	E2F1|IRF-3|E2F1|E2F1	It has been shown that E2F1 negatively regulates human IRF-3 gene expression 13 . Although the E2F1 site was also present in the murine promoter, the E2F1 site mutation had little effect on promoter activity ( Fig. 3h and 3i ).
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:9441..9665:sentences:c2dc014c1ce812ceca46da6fe94a98ea	POU2F1|IRF3|IRF3	Oct-1|IRF-3|IRF-3	have shown that Oct-1 also bound to the human IRF-3 promoter 14 . Importantly, the putative transcription factor binding sites in 59 flanking region are very similar between human and murine IRF-3 promoter (Supplementary Fig.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:9673..9765:sentences:dc738b80cfc8e74a455af63f7bc1b3c5	POU2F1|IRF3	Oct-1|IRF-3	However, the contribution of Oct-1 in human IRF-3 promoter remains controversial and elusive.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:9923..10068:sentences:ec5070e1b685988433b1af5cdeac4c90	POU2F1|IRF3|E2F1|RUNX1|IRF3	Oct-1|IRF-3|E2F1|AML1|IRF-3	4b) . In conclusion, Oct-1 positively regulates the IRF-3 promoter activity, while E2F1 and AML1 are not involved in murine IRF-3 gene regulation.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:10502..10877:sentences:1f646f369aa1fd595a102843198a875a	EIF2AK2|EIF2S1	PKR|eIF-2a	It has recently been reported that prion infection could impair the host's ability to synthesize protein by means of inhibition of double-stranded RNA-activated protein kinase (PKR)-dependent eIF-2a phosphorylation 15, 16 . Another study revealed that the global alteration of gene expression has occurred in prion-infected mouse brains by unknown mechanisms 17 .. Discussion.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:10879..11057:sentences:3decd89766145a258dca9a15d379a738	POU2F1|IRF3|IRF3	Oct-1|IRF-3|IRF-3	In summary, our results demonstrated that Oct-1 binds to the murine IRF-3 promoter region and increases the transcription level and IRF-3 expression is reduced by prion infection.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:11581..11722:sentences:eb77a3c2a6c87a5c92bca91ad21e9348	SDHC|SDHC|POU2F1	pGL3|pGL3|Oct-1	(b) N2a cells were co-transfected with either pGL3 -119/-1 or pGL3 -119/-1 (M1) and either pcDNA Oct-1-HA (Oct-1) or the empty plasmid (mock).
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:12795..13320:sentences:8ebe3be66f20e5c85f98354e30f275da	IRF3|SDHC|IRF3|SDHC|SDHC|SDHC|SDHC|SDHC	IRF-3|pGL3|IRF-3|pGL3|pGL3|pGL3|pGL3|pGL3	The information on primers used in this study is summarized in Table 1 . In order to analyze the 59-flanking region of the murine IRF-3 gene for promoter activity, PCR products amplified from mouse genomic DNA were subcloned into pGL3-Basic Vector (Promega) : pGL3 -2000/-1001 (nt 22000 to -1001, where the first nucleotide of IRF-3 exon 1 has been designated 1 1), pGL3 -1000/-524 (nt -1000 to -524), pGL3 -1000/-1 (nt -1000 to -1), pGL3 -523/-1 (nt -523 to -1), pGL3 -340/-1 (nt -340 to -1) and pGL3 -119/-1 (nt -119 to -1).
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:13322..13579:sentences:3d9e66bec9acfdc57f6520d7c756fa7f	POU2F1|SDHC|SDHC|SDHC|SDHC|SDHC|SDHC|SDHC	Oct-1|pGL3|pGL3|pGL3|pGL3|pGL3|pGL3|pGL3	Two different mutations (M1: ATTTGCAT to CGTTGCAT or M2: ATTTGCAT to GGGGAACC) were introduced into the Oct-1 site in the pGL3 -1000/-1, pGL3 -523/-1 and pGL3 -119/-1, generating pGL3 -1000/-1 (M1), pGL3 -523/-1 (M1), pGL3 -119/-1 (M1) and pGL3 -119/-1 (M2).
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:13581..13682:sentences:90d1ac3213f79029f51a0d663a6bfc61	SDHC|E2F1|E2F1	pGL3|E2F transcription factor 1|E2F1	pGL3 -119/-1 (M3: TTTCCCAC to GGGGGGGG) was the E2F transcription factor 1 (E2F1) sitemutated plasmid.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:13684..13814:sentences:787936920b2fc950d804a8b4619724c4	SDHC|RUNX1|RUNX1	pGL3|acute myeloid leukemia 1 protein|AML1	pGL3 -119/-1 (M4: TGCGGT to TGCGCG or M5: TGCGGT to TCGGGT) were the acute myeloid leukemia 1 protein (AML1) site-mutated plasmids.
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:15360..15543:sentences:e25b726079f8c8f6e70cc0f930ead5d4	POU2F1|	Oct-1|MBL	Equal amounts of protein from each treatment were subjected to Western-blot analysis using specific antibodies against Oct-1 (Santa Cruz Biotechnology, sc-232) or b-actin (MBL, PM053).
+SARS:0f8f7f09b42b4b45e128591191176aa358f29b1b:fulltext:df05f059fe8c2a8726c019d9219ceb7d:18129..18272:sentences:48f86cd95aea5d84d28d5fe0295c3cc7	SDHC|PLXNA2	pGL3|Oct	After 3 days from the last treatments, cells were reseeded in 24-well plates without drugs and transfected with pGL3 -119/-1 and pRL-null.. Oct.
+SARS:110a079d80d6985ea3164342d2c26aa5edc57833:abstract:c4d6ac26de9656ac533c54ab5c80e148:461..612:sentences:4be7890c4744aa095d55ed4ec5833a97	TNFRSF9|TNFRSF4	4-1BB|OX40	OX40 and 4-1BB are members of the tumour necrosis factor receptor family and are expressed on the surface of T cells in several inflammatory conditions.
+SARS:10a769cac0a76b41a6a82be148c1a2675e9d4604:abstract:b046a378ad6cdb735bcf8cb4ecc26a16:803..901:sentences:6763e81b18505cc363f91eda38fc08af	AXL|TIMD4|HAVCR1	Axl|TIM4|TIM1	In addition, other PS-binding proteins, such as Axl and TIM4, promoted infection similarly to TIM1.
+SARS:11618b8e0169b98b7c4f0b06f900d3fe4c853ab3:abstract:0b58ad7ba030d932f440dedc6205a145:184..363:sentences:12471cd01744a5f8cf420d003a084834	RTN2|SH2D3C|SPECC1	NSP] 2|NSP3|NSP5	Six bat rotavirus genes (viral protein [VP] 2, VP6, VP7, nonstructural protein [NSP] 2, NSP3, and NSP5) shared ancestry with other mammalian rotaviruses but were distantly related.
+SARS:1163230242bf54779c5e9bd79ab5a1afcfc14810:abstract:7daa2c4dfc0596ff87da82857ef96d34:450..497:sentences:eb202d95c5632ba79e6447f744d922e7	IVNS1ABP|KRAS|RAF1	NS1|NS3|NS5	E, prM, NS1, NS3 and NS5 of JEV were determined.
+SARS:116e55aaa621e0a80dedc594fdd42c12090516c0:abstract:0de5d8386765a38c0eb68a573b387f74:178..398:sentences:ae00100866e77f4a2f71db80993dbaa6	|STAT2|STAT1|IRF9|STAT1	STATs|STAT2|STAT1|IRF9|ISGF3	Among STATs, STAT2 is classically known to dimerize with STAT1 and together with IRF9 forms the ISGF3 transcription factor complex that has long been considered a hallmark of activation by type I and type III interferons.
+SARS:116e55aaa621e0a80dedc594fdd42c12090516c0:abstract:0de5d8386765a38c0eb68a573b387f74:400..623:sentences:2e96161fd13c3071dd9768ed84baee04	STAT2|IRF9|STAT1	STAT2|IRF9|STAT1	However, accumulating evidence reveal distinct facets of STAT2 and IRF9 activity mediated by the segregation in alternative STAT1-independent complexes/pathways that are thought to trigger different transcriptional programs.
+SARS:116e55aaa621e0a80dedc594fdd42c12090516c0:title:a26d36c62b2bee5710b1d3059e2c6b56:0..27:sentences:29ffbe3f7073ae60dc50794828612f72	STAT2|IRF9	STAT2|IRF9	STAT2 and IRF9: Beyond ISGF3
+SARS:11875dfda6cd04d5032611edf0e340582ceb620f:abstract:198958a753e413765fbd4b6aa7bd4737:428..680:sentences:d8c7b3e8725da1fc3066ec3fe07b9ba8	VTN|ACE2	S-protein|ACE2	The surface glycoprotein of 2019-nCoV was coincident with the CTD1 region of the S-protein by comparing the I-TASSER prediction model with the actual SARS model, which suggests that 2019-nCoV may bind to the ACE2 receptor through conformational changes.
+SARS:116c94dd67777e0c9806ef56974157060f5cca4b:fulltext:bdd55d2eaf306322174e6359278cb544:6648..7024:sentences:9edc357b02813f384b5f85d0f0082da8	DPP4|AQP1|AQP1	DPP 4|aquaporin-1|AQP-1	The sections were stained with anti-goat DPP 4 polyclonal antibody (R&D Systems, Minneapolis, MN, USA), mouse anti-mouse aquaporin-1 (AQP-1) antibody (Abcam, Cambridge, UK), and sera from MERS-CoV patients (patient's serum 9 weeks after symptom onset and the serum from a convalescent plasma donor; 1:2,000 dilution) as primary antibodies in a blocking reagent overnight at 4C.
+SARS:116c94dd67777e0c9806ef56974157060f5cca4b:fulltext:bdd55d2eaf306322174e6359278cb544:10587..10656:sentences:e4d4dd47e68fc8099daa10aea82cbf5a	DPP4|AQP1	DPP 4|aquaporin-1	DPP 4 was primarily stained in proximal tubules (aquaporin-1; violet).
+SARS:11217ee4e2bcf58f21011db8ff3d166aad2691ca:fulltext:98e73f126414511f67d13ba02d53068d:3606..3688:sentences:f4d1c57fdacdb53507710c960563d759	MT-ND2|RAG1	ND2|RAG1	(2005) . (d) ML tree derived from PAUP* analysis of ND2 and RAG1 from Murray et al.
+SARS:11217ee4e2bcf58f21011db8ff3d166aad2691ca:fulltext:98e73f126414511f67d13ba02d53068d:41363..41830:sentences:00da5f9bb82a8b53dfafdbdaa4396df7	MT-CO1|MT-CYB	Cox1|Cyt b	The analyses showed that the rate of diversification of Rhinolophus and Hipposideros is very similar for both molecular markers ( fig. 5) . However, although Cox1 and Cyt b support very similar rates of diversification, they are both fragments of the mitochondrial genome, and it is yet to be verified if these diversification rates would remain consistent across a wider diversity of nuclear markers.. Comments on Molecular Clock and Biogeographical Analysis Methods.
+SARS:11217ee4e2bcf58f21011db8ff3d166aad2691ca:fulltext:98e73f126414511f67d13ba02d53068d:48813..49088:sentences:85b9461898ba804e50344e007f281468	ADORA3|APP|ATP7A|BDNF|PNOC|PLCB4|TMEM150C|ABHD11|ROGDI|ACOX2|BGN|STAT5A	ADORA3|APP|ATP7A|BDNF|PNOC|PLCB4|TTN3|ABHD11|ROGDI|ACOX2|BGN|STAT5A	These nuclear gene fragments consisted of 12 exon fragments (ADORA3, APP, ATP7A, BDNF, BUF134, PNOC, PLCB4, TTN3, TTN5, TTN6, TTN7, and RGF2) and seven intron fragment (ABHD11, ROGDI, ACOX2, BGN, THY, STAT5A, and PRKC1) (supplementary table S1, Supplementary Material online).
+SARS:11217ee4e2bcf58f21011db8ff3d166aad2691ca:fulltext:98e73f126414511f67d13ba02d53068d:64274..64492:sentences:903e9b6a88f5dc8eb41a91ddec98f1f1	MT-CYB|MT-CO1	Cyt b|Cox1	To facilitate our comparative analysis of diversification rate in the speciose genera Rhinolophus and Hipposideros, faster evolving mitochondrial markers Cyt b and Cox1 were used to enable species level differentiation.
+SARS:11217ee4e2bcf58f21011db8ff3d166aad2691ca:fulltext:98e73f126414511f67d13ba02d53068d:64494..64682:sentences:ee041c5c71db0fa06a8df3acc4499a81	MT-CYB|MT-CO1	Cyt b|Cox1	To explore if the rate of diversification was marker specific, all available Cyt b and Cox1 sequences for Rhinolophus and Hipposideros species were downloaded from GenBank (April 30, 2013).
+SARS:1052ac76b8c769749a3400eb9479e34a35407eae:fulltext:b8601e374635dd8189d41843a2822b2e:390..637:sentences:eb086d48dca0e5e2e31c5b48d2ec79d3	HSPE1|HSPD1	groES|groEL	pAA007 was co-transformed into One Shot BL21 Star (DE3) chemically competent E. coli cells (Invitrogen), along with the tetracycline-inducible, chloramphenicol-resistant plasmid, pG-Tf2, containing the chaperones groES, groEL, and tig (Takara Bio).
+SARS:1052ac76b8c769749a3400eb9479e34a35407eae:fulltext:b8601e374635dd8189d41843a2822b2e:2613..2956:sentences:809f0fa2a2e69ac2bbb14fe80cc220eb	EIF2S3|EIF2AK3|MST1R	eIF2|PERK|Ron	Phosphorylated eIF2 was expressed and purified as above, but with the following modifications: One Shot BL21 Star (DE3) E. coli were co-transformed with pAA007, pG-Tf2, and a third plasmid expressing the kinase domain of PERK (PERK 4: PERKKD-pGEX4T-1, Addgene plasmid #21817 donated by Dr. David Ron) and a resistance marker towards ampicillin.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:9336..9459:sentences:43c054f7c84f7d508ca712a28599c276	EGR1|KLF13|MYC	EGR1|KLF13|MYC	In addition, several of the DE genes at 12 hpi encoded transcriptional regulators; these genes include EGR1, KLF13, and MYC.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:9461..9667:sentences:1eb5e86efa0f4bfae6525ca028a48f03	CREB3L3|HEXIM1|ZNF660|ZKSCAN4	CREB3L3|HEXIM1|ZNF660|ZKSCAN4	Interestingly, four of the nine genes DE at 12 hpi but not at 24 hpi also encoded transcriptional regulators (CREB3L3, HEXIM1, ZNF660, and ZKSCAN4), indicating regulation specific to early viral replication.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:9669..9932:sentences:c6ff33e85a32af41b4a915c6408fb217	BCL11B|CD1D|EGR1|IKZF1|IRF1|RAG1|SOX4	BCL11B|CD1D|EGR1|IKZF1|IRF1|RAG1|SOX4	Seven genes contributed to the overrepresentation of T cell activation among DE genes at 12 hpi (BCL11B, CD1D, EGR1, IKZF1, IRF1, RAG1, and SOX4), six of which were downregulated, indicating a net suppression of T cell activation (as T cell differentiation in Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:9939..10098:sentences:5f910eaef04927c3537901d07123b41e	BCL11B|EGR1|IRF1|IKZF1|SOX4	BCL11B|EGR1|IRF1|IKZF1|SOX4	Five T cell activation-related DE genes (BCL11B, EGR1, IRF1, IKZF1, and SOX4) encoded transcription factors, some of which had known relevance to HIV infection.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:11125..11538:sentences:9f21c30cbbb1322d38328eccf9e3a7c2	CD1D|S100B|CD1D	CD1D|Nef|CD1D	For example, the CD1D product presents lipid antigens on the surface and is directed by HIV-1 Nef for internalization and degradation (10) . Downregulation of CD1D at the mRNA level would further reduce surface expression and facilitate immune evasion.. Viral mRNA constitutes a large portion of total mRNA of HIVinfected cells.. We complemented functional analysis in DAVID by gene set enrichment analysis (GSEA).
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:11540..12034:sentences:1ddfcb933344156a9b4858cfb0797540	CD2|CD4|CD7|CD28|SIT1	CD2|CD4|CD7|CD28|SIT1	This method does not rely on the prior determination of DE genes (e.g., by applying a P value threshold) but instead uses a ranked gene list as input and is therefore well suited for identifying annotations among genes with small-magnitude changes in expression (11) . GSEA identified additional genes that were downregulated and contributed to the suppression of T cell activation; these genes include the CD2, CD4, CD7, CD28, and SIT1 genes encoding T cell-specific surface molecules (see Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:12070..12285:sentences:de3934ab53ca16cae6f925d15a5c5f5d	ADORA2A|RAG1	ADORA2A|RAG1	Many of the genes associated with T cell activation in DAVID and GSEA also had roles in other pathways, indicating possible pleiotropic effects (e.g., ADORA2A and RAG1 which also contribute to caspase activity [ Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:13759..13915:sentences:047e97eca0986a1cd5c88b8e6407d024	CD3D|CD247|RHOH	CD3D|CD3Q|RHOH	Other T cell activation-related genes DE at 24 hpi included CD3D, CD3Q, and RHOH, all of which encode membrane proteins crucial for T cell receptor function.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:13917..14174:sentences:9c2e084f8490cc0422dfe82933856535	LCK|TP53|TP53	LCK|TP53|p53	A network depicting known interactions among proteins encoded by T cell activation-related DE genes at 24 hpi showed two highly connected nodes: LCK (lymphocytespecific protein kinase) and TP53 (p53), both of which were strongly downregulated at 24 hpi (Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:14481..14540:sentences:7ca49d0ca3663cbc43c72d8dc24edfce	CD1D|CD28|CXCR4|TNFRSF4|TREML2	CD1D|CD28|CXCR4|TNFRSF4|TREML2	These genes included CD1D, CD28, CXCR4, TNFRSF4, and TREML2.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:14542..14774:sentences:4f9ca56a0156755031cda3b74895f383	TOB1|ERBB2|IL2|IL2	TOB1|ERBB2|interleukin 2|IL-2	TOB1 (transducer of ERBB2), a negative regulator of T cell activation, proliferation, and interleukin 2 (IL-2) production, showed increased expression and may contribute to the downregulation observed in other genes (data not shown).
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:15996..16280:sentences:2a10d70e82f8ae8814ae7c86c7f3db56	HNRNPA1|HNRNPA1|HNRNPC	HNRNPA1|HNRNPA1|hnRNP	One of these was HNRNPA1 whose gene product regulates the splicing of eukaryotic and viral mRNA (13) . HNRNPA1 and other hnRNP gene products are known to affect the localization of HIV-1 Gag/Pol mRNA, and their overexpression has previously been shown to reduce HIV-1 replication (Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:16282..16843:sentences:1ae0b75fe62635b3de9190e726fade60	TARDBP|TARDBP|HNRNPA1|TARDBP	TARDBP|TAR DNA-binding protein 43|HNRNPA1|TARDBP	3B) (14) . Other DE genes at 24 hpi related to ribonucleoprotein biogenesis and RNA processing are also known to affect HIV-1 replication directly; these genes include TARDBP (TAR DNA-binding protein 43) whose protein binds the transactivation response (TAR) element of integrated HIV-1 DNA and represses HIV-1 transcription (15) (16) (17) . Downregulation of HNRNPA1, TARDBP, and other related genes may therefore allow more efficient HIV-1 replication in SUP-T1 cells.. Viral mRNA constitutes a large portion of total mRNA of HIVinfected cells.. RNA transport.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:16970..17644:sentences:8c450b968c07f21803f559560fa82812	XPO1|XPO1|NXF1|XPO1|XPO1	Crm1|exportin 1|NXF1|Crm1|XPO1	2B) . Host factors for RNA transport are known to be coopted by HIV-1 to allow the export of unspliced, partially spliced, or fully spliced viral mRNAs out of the nucleus (18) . In particular, the host factors Crm1 (exportin 1) and Ran GTPase are used for the export of unspliced viral mRNA, while the host factor NXF1 (nuclear RNA export factor 1) facilitates the export of fully spliced viral mRNA in a Ran-independent manner (19) . In our data set, we observed no change in the expression of the Crm1-encoding gene XPO1, but several members of the Ran signaling pathway were downregulated, suggesting that the overall export of unspliced viral RNA was suppressed (see Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:17646..17704:sentences:0466a2e6aba625227ca8200c8b8ac735	XPO1|PSMD5	XPO1|S5B	S5B in the supplemental material; data not shown for XPO1).
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:17706..17927:sentences:f64c7747711f95f9cf82c6de2b737b95	NXF1|NXF3	NXF1|NXF3	However, in contrast to other RNA transport-related genes, NXF1 and NXF3 were expressed more highly in infected cells, suggesting that HIV infection may have selectively enhanced the export of fully spliced viral RNA (Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:18833..19276:sentences:991b12aa878941b361999f7b9a02c86e	MAPK8|S100B	Jnk|Nef	S6C) . Consistent with these observations, HIV-1 Nef has been shown to activate Jnk signaling, ultimately activating the caspase cascade and triggering cell death (20) . The triggering of apoptosis at 24 hpi is consistent with our observation that infected cells began to die following the 24-hpi time point.. Viral mRNA constitutes a large portion of total mRNA of HIVinfected cells.. HIV-1 infection does not trigger innate sensing at 12 hpi.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:19548..19686:sentences:f0cfe685fd346041768cb8764c525385	IRF2|IRF3|IRF7|IRF9	IRF2|IRF3|IRF7|IRF9	1) , interferon response factors (IRFs) (IRF2, IRF3, IRF7, and IRF9) showed no significant change in expression at 12 hpi (data not shown).
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:19688..20367:sentences:845646c7a93bd363b9c0e326744388f7	TRIM63|IRF3|IFI35|IFI44|ISG15|ISG20|IRF3|IRF3|IRF3|IRF3|ANXA1|B2M|CD69|CD53|TFRC|IL13|IL16|CD4	IRF|IRF3|IFI35|IFI44|ISG15|ISG20|IRF3|IRF3|IRF3|IRF3|ANXA1|B2M|CD69|CD53|CD71|IL-13|IL-16|CD4	Furthermore, specific IRF targets, including IRF3 target genes IFI35, IFI44, ISG15, and ISG20, were also not differentially expressed at this time point (21, 22) . IRF3 targets were of particular interest, as intact cytoplasmic HIV-1 DNA has been shown to activate IRF3 in CD4  T cells (23) . Our observed lack of IRF3 target gene expression is consistent with previous observations that replicating HIV-1 suppressed IRF3 activity (24) . We also examined the levels of inflammationrelated genes previously observed to be differentially regulated in HIV infection studies (1): ANXA1, B2M, and CD69 (generally upregulated) and CD53, CD71, IL-13, and IL-16 (generally downregulated).
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:20744..20936:sentences:14b070749cc1b146cce9b09022edd30d	IRF1|IRF2|IRF3|IRF7|IRF9|TRIM63	IRF1|IRF2|IRF3|IRF7|IRF9|IRF	IRF1 was more strongly downregulated at 24 hpi than at 12 hpi, but other IRF genes (IRF2, IRF3, IRF7, and IRF9) continued to show no significant change in expression ( Fig. 1 ; data not shown).
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:21063..21261:sentences:70ea8a15a0bf041fbd66d171bf38308c	B2M|IFI16|IFI30|ISG20	B2M|IFI16|IFI30|ISG20	Other interferon (IFN)-inducible genes were differentially expressed at this time point but in different directions, such as B2M and IFI16 (both downregulated) and IFI30 and ISG20 (both upregulated).
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:21544..21715:sentences:865973ffdd335b30ea55ed1672d7a868	CD1D|CD2|CD28|RAG1|TNFRSF4	CD1D|CD2|CD28|RAG1|TNFRSF4	Several of the downregulated genes associated with these gene sets were also associated with T cell activation; these genes include CD1D, CD2, CD28, RAG1, and TNFRSF4 (Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:21717..22135:sentences:316cd91ab45d921ebf84671dd8804de9	IL4|IL7R	IL4|IL7R	S6D) . Additional immune response-specific genes downregulated at 24 hpi included IL4 and IL7R, suggesting that HIV-1 may have impaired the ability of infected cells to signal other cells or respond to extracellular cues.. Regulation of noncoding RNAs by HIV-1 infection.. By mapping sequencing reads to RefSeq transcript annotation, we also observed changes in the expression of several non-protein-coding RNA species.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:22851..23382:sentences:60dd654983eb3b23e0604e7b4ada45db	MIR17HG|MIR142|MIR621|MIR518F	MIR17HG|MIR142|MIR621|MIR518F	4A) . DE pseudogenes often matched their protein-coding counterparts in directionality and degree of regulation, which suggests that regulatory regions were maintained and polyadenylated transcripts were produced (data not shown).. Regulation of noncoding RNAs by HIV-1 infection.. We also observed differential expression of four annotated mi-croRNA host genes in infected cells, three of which were downregulated (MIR17HG, MIR142, and MIR621), while the remaining one was upregulated (MIR518F), all with 2-fold or greater changes.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:23384..23554:sentences:b4bf342514c14a7326ea48f58e6143de	MIR17HG|MIR17HG|	MIR17HG|MIR17HG|miR-17	The downregulation of MIR17HG (by 2.25-fold) was of particular interest, as MIR17HG encodes a cluster of microRNAs, including miR-17, -18A, -19A, -19B, -20A, and -92 (Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:23780..23970:sentences:33b4228b9d61caf939039459cea50b62	|KAT2B	MIR17|PCAF	4B) . We also observed a concurrent upregulation of known targets of MIR17HGencoded microRNAs, including PCAF, a host factor required for Tat-induced HIV-1 gene expression (25) .. DISCUSSION.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:25655..25885:sentences:67f4f566fb79701f516024e710b29967	|KAT2B|KLF3	MIR17|PCAF|KLF3	In addition, MIR17HGencoded microRNAs have hundreds of other candidate targets in the TargetScan database (26) . Several of these candidates were found to be coexpressed with PCAF in our data set, including KLF3 (unpublished data).
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:25887..26195:sentences:4eefc66ca972203f6a1bbca96a72e3b3	KLF3|MIR17HG	KLF3|MIR17HG	KLF3 encodes a zinc finger transcription factor whose precise function is unknown but whose sequence is located proximally to a single-nucleotide polymorphism strongly associated with HIV-1 plasma levels (27) . We also observed differential expression of factors that may have mediated MIR17HG downregulation.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:26227..26280:sentences:b30a65cd1706474c1daf9eeb213e82ab	MYC|MIR17HG	c-Myc|MIR17HG	(28) found that c-Myc regulates expression of MIR17HG.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:26282..26418:sentences:468781020b659cf8c602026a19a21f49	MIR17HG|MYC|MYC	MIR17HG|MYC|MYC	Consistent with that study, we observed that MYC and MIR17HG were concordantly expressed, as MYC was downregulated at 12 and 24 hpi (Fig.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:27036..27581:sentences:aefff1bf1c18426aaec53b16b1c1646e	BCL11B|IRF1|IKZF1|SOX4|EGR1|KLF13|MYC	BCL11B|IRF1|IKZF1|SOX4|EGR1|KLF13|MYC	The host genes that we detected as differentially expressed at 12 hpi showed that T cell activation and differentiation were suppressed in in- fected cells, likely via the downregulation of T cell activationspecific transcription factors (BCL11B, IRF1, IKZF1, and SOX4) . The regulation of these and transcription factors specific for other functions (e.g., EGR1, KLF13, and MYC) may explain how HIV initiated replication with minimal disruption to host gene expression at 12 hpi but elicited larger-scale changes later in infection.. DISCUSSION.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:27583..27877:sentences:62ce162566bbe6a30f3eb9a9c1894ba8	CXCR4|CCR5|CCR5|CCR5	CXCR4|chemokine (C-C motif) receptor 5|CCR5|chemokine 	The suppression of T cell activation that we observed was consistent with previous studies on the response of T cells to infection by chemokine (C-X-C motif) receptor 4 (CXCR4)-tropic versus chemokine (C-C motif) receptor 5 (CCR5)-tropic HIV-1 strains (29) (30) (31) . For example, Sirois et al.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:27879..28067:sentences:012c84ce0f5efafe8069668976ecef67	LCK|CXCR4|CCR5	LCK|CXCR4|CCR5	(31) found that key T cell activation-related genes, including LCK, were downregulated at 24 hpi by a CXCR4-tropic strain, whereas these same genes were upregulated by a CCR5-tropic strain.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:28069..28204:sentences:381551174705b8f60e27957e7d1e48f4	CXCR4|CCR5	CXCR4|CCR5	Our study utilized the CXCR4-tropic strain LAI, and it would be interesting to generate NGS data for a CCR5-tropic virus for comparison.
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:30207..30467:sentences:f0f497f401d911c4f5e5e8ba508ca0f8	CD4|CXCR4|LCK	CD4|CXCR4|LCK	(37) identified sets of human proteins highly connected to host and viral proteins (37) . Several proteins related to T cell activation were identified as highly connected; these proteins included CD4, CXCR4, and LCK (see Table S4 in the supplemental material).
+SARS:102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2:fulltext:4d553692f10349bc3622f9a3ad0b3dd2:36586..36890:sentences:3c7d343ff703180f973300e4cfa2276d	IRF1|TAOK2	IRF1|PSK1	Intracellular viral RNA load was quantified as previously described (45) . Relative change of IRF1 was determined by qPCR using primers PSK1 (forward primer [5= TCTG GCTTTTTCCTCTGAGC 3=] and reverse primer [5= ATGCTTTTCTGG GGTCACTG 3=]).. Cell lines and virus infection.. Differential expression analysis.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:14..430:sentences:bea8c421927e00c1648aa51aaef78385	MPPE1|CDK1	cDC1|cDC2	Dendritic cells (DCs) are specialized antigen-presenting cells that bridge innate and adaptive immune responses (Banchereau and Steinman, 1998) . In both mouse and human, DCs are divided into functionally specialized subpopulations, i.e., plasmacytoid DCs (pDCs) and two subsets of classical DCs (cDCs), cDC1 and cDC2 (Guilliams et al., 2014; Merad et al., 2013) . pDCs are quite distinct from their cDC counterparts.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:432..1318:sentences:951c41daaa288b9c7e0bf05b53ef6388	MPPE1|CDK1	cDC1|cDC2	Ontologically, pDCs differentiate from both myeloid and lymphoid precursors but display lymphoid features regardless of their developmental path (Corcoran et al., 2003; Naik et al., 2007; Onai et al., 2007; Sathe et al., 2013; Shigematsu et al., 2004) . Functionally, while cDC1s and cDC2s are specialized for interaction with T cells, pDCs are well known for their innate capacity to rapidly produce large quantities of type I interferon (IFN and IFN, abbreviated IFN-I) upon viral encounter (Asselin-Paturel et al., 2001; Siegal et al., 1999) . However, aside from their innate role, pDCs can carry out adaptive immune functions upon activation, i.e., antigen presentation, T cell activation, and tolerance (Alculumbre et al., 2019; Leylek and Idoyaga, 2019) . This represents a rare phenomenon in the immune system, in which one cell type is capable of mediating diverse immune tasks.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:4071..4500:sentences:1295d4cbfe0fc0b79c0b5e69406124c5	TCF4|IRF8|IRF4	Tcf4|Irf8|Irf4	In addition to surface markers, this panel incorporated transcription factors (TFs) differentially expressed in DC subsets: Tcf4 (pDCs), Irf8 (pDCs and cDC1s), and Irf4 (cDC2s) (Cisse et al., 2008; Schiavoni et al., 2002; Suzuki et al., 2004) . To allow greater resolution of minor myeloid populations, we enriched mouse splenic DCs and plotted Lin  cells in a t-Distributed Stochastic Neighbor Embedding (tSNE) map ( Figure 1A ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:4502..4617:sentences:3cf8e14ba95da846afe96c02d05cbe87	CCR2|FCGR1A	Ccr2|CD64	We found a minimal number of Ccr2 + monocytes and CD64 + red pulp macrophages (RPMs) after enrichment ( Figure S1 ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:4619..4718:sentences:c0dd3129863ad79fbf4e8c6ce95fc930	MPPE1|CDK1	cDC1|cDC2	Based on their phenotype, we identified formally described DC subsets, i.e., pDCs, cDC1s, and cDC2s.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:4720..4852:sentences:515cca1a9c7527721fdedfd26801c3da	TCF4|IRF8|MPPE1	Tcf4|Irf8|cDC1	As expected, we observed high Tcf4 expression in pDCs, but not in cDCs, and high Irf8 expression in cDC1s and pDCs, but not in cDC2s.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:4961..5211:sentences:5db34ca6f045c1609576f42957d4c879	CDK1|TCF4|IRF8|ITGAX	cDC2|Tcf4|Irf8|CD11c	The phenotype of this bridging population ranged from pDC-to cDC2like, i.e., high to low expression of Tcf4, Irf8, and the pDC marker SiglecH and low to high expression of CD11c.. CyTOF Analysis Reveals a Transitional DC Subpopulation in Mouse Spleen.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:5213..5607:sentences:de3a80242c18e76a66c0aea667fc62cd	AXL|CDK1	AXL|cDC2	The phenotype and tSNE map localization of this bridging population resembled human AXL + DCs, a pDC-like population with cDC2 features described by us and others (Alcntara-Hernndez et al., 2017; See et al., 2017; Villani et al., 2017) . To evaluate DC populations' homology between species, we performed parallel CyTOF analysis of human peripheral blood mononuclear cells (PBMCs) ( Figure 1B ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:5609..5801:sentences:01249f0a0285da736fff4ffdd1074cfb	AXL|CDK1	AXL|cDC2	In line with our previous report, we observed that human AXL + DCs bridge pDCs and cDC2s in a tSNE map, reflecting an intermediate phenotype, which was also true for human spleen ( Figure S2 ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:5803..5978:sentences:6c8038e43fd4d1b513e15dce6ed29f16	TCF4|IRF8|CLEC4C|ITGAX|IL3RA	TCF4|IRF8|BDCA2|CD11c|CD123	Similar to mouse, the human bridging population expressed high to low levels of TCF4, IRF8, and the pDC markers CD123 and BDCA2, while CD11c expression ranged from low to high.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:6820..6902:sentences:42b7c1a5a8197753f6679c8ab1e0291a	CX3CR1|IRF4	CX3CR1|IRF4	In contrast to pDCs, mouse and human tDCs expressed high levels of CX3CR1 and IRF4.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:6904..6963:sentences:fd38c75ec6e1c57eadeb202869a37785	CDK1|ITGAM|CD1C	cDC2|CD11b|BDCA1	Unlike cDC2s, tDCs were CD11b  in mouse and BDCA1  in human.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:6965..7042:sentences:05937826a7f70c2d828b7cc374d8a138	MPPE1|XCR1|CADM1|CLEC9A	cDC1|Xcr1|Cadm1|CLEC9A	Compared with cDC1s, tDCs were Xcr1  and Cadm1  in mouse and CLEC9A  in human.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:7044..7305:sentences:c379e1513fc114edb9e9e395db9e97fa	CDK1|AXL	cDC2|AXL	Altogether, our CyTOF analysis identified a distinct subpopulation of DCs in mouse that displays a transitional phenotype between pDCs and cDC2s and mirrors the phenotype of human blood and spleen AXL + DCs.. Mouse tDC Phenotypes Range from pDC-like to cDC-like.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:7478..7640:sentences:b517d60df7cbf0b96b378f04d82781e5	MPPE1|XCR1|CDK1|ITGAM	cDC1|Xcr1|cDC2|CD11b	Because tDCs did not express the cDC1 marker Xcr1 or the cDC2/monocyte marker CD11b ( Figure  1A ), we used these parameters to eliminate these cells (Figure 2A ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:7792..8231:sentences:2d8b66a9923e5d241cb2a8eaf006ba44	CX3CR1|ITGAX|ITGAX|CDK1	Cx3cr1|CD11c|CD11c|cDC2	Furthermore, as shown by tSNE and UMAP analysis, tDCs, but not pDCs, were Cx3cr1 high (Figures 1D and 2A, upper left) . Finally, we observed that tDCs could be separated into two populations representing different parts of the spectrum: CD11c low Ly6C high tDCs (ii, purple) represent cells that are more similar to pDCs, while CD11c high Ly6C low tDCs (iii, cyan) correspond to cells that are more similarto cDC2s (Figure 2A , lower left).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:8233..8596:sentences:8f29e5513563aab8c01ffba6dd38ab27	AXL|ITGAX	AXL|CD11c	This partition mirrored our previous analysis of human AXL + DCs, which can also be split based on expression of CD11c to facilitate characterization of their heterogeneity (Alcntara-Hernndez et al., 2017) . We validated our observations by flow cytometry and quantified tDCs in lymphoid organs (Figures 2A and 2B ; see Figure S3 for the complete gating strategy).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:9104..9226:sentences:1caf38cedb8b5f99b5ad550faafb48da	ITGAX|PTPRC|ITGAX	CD11c|B220|CD11c	CD11c low tDCs had a phenotype closer to that of pDCs, with higher levels of SiglecH, Pdca1, and B220 than CD11c high tDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:9228..9609:sentences:3634a91a2e0a4fd3aa9c1ac71f5fd76f	ITGAX|ITGAX|CCR9|LY6D|ITGAX|CD9|CD8A|ITGAX|ITGAX|MPPE1|CLEC9A	CD11c|CD11c|Ccr9|Ly6D|CD11c|CD9|CD8|CD11c|CD11c|cDC1|Clec9A	CD11c low and CD11c high tDCs were negative for the pDC markers Ccr9 and Ly6D; however, CD11c high tDCs had intermediate levels of CD9, a marker previously associated with pDC subpopulations (Bjrck et al., 2011) . Although tDCs featured some levels of CD8, both CD11c low and CD11c high tDCs lacked expression of more specific cDC1 markers such as DEC205, Cadml, and surface Clec9A.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:9611..9764:sentences:b5b7bdb6be8ba3816463070fa872bbba	CDK1|ESAM|ITGAX|SIRPA	cDC2|Esam|CD11c|CD172a	We did not detect significant levels of the cDC2 marker Esam, but CD11c high tDCs were CD172a low .. Mouse tDC Phenotypes Range from pDC-like to cDC-like.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:9766..10075:sentences:37b6c1970792651a34cca4b5512fb397	CX3CR1|CD8A	Cx3cr1|CD8	The phenotype of mouse tDCs, particularly their expression of Cx3cr1 and CD8, resembled a previously described population of mouse DCs that has features of both pDCs and cDCs, termed noncanonical DCs ( Bar-On et al., 2010) . We hypothesized that noncanonical DCs could be represented within the tDC population.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:11572..11751:sentences:ad60e92d0f579af846650b97e650694b	CDK1|MPPE1	cDC2|cDC1	PCA using nearly 1,000 differentially expressed genes overlapped mouse and human pDCs, cDC2s, and cDC1s, validating our analysis ( Figure 3A ; see Figure S4A for analysis details).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:11827..12042:sentences:36b29fa5f03c0f0c52205d1b2bd0e1ee	ITM2C|PTPRS|CD33|ITGAX|CX3CR1|CD5	ITM2C|PTPRS|CD33|ITGAX|CX3CR1|CD5	In both species, tDCs shared intermediate expression of several pDC genes (e.g., ITM2C and PTPRS), cDC genes (e.g., CD33 and ITGAX), CX3CR1, and CD5 ( Figure 3B ).. Transcriptome Analysis Aligns Mouse and Human tDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:12165..12686:sentences:f308406bb2f2f4428021525f35b88179	ITGAX|AXL|AXL|CD5|CD81|ITGAX	CD11c|AXL|Axl|CD5|CD81|CD11c	To mirror our mouse tDC analysis and characterize diversity within the population, we divided human tDCs based on their expression of CD11c, as previously described (Alcntara-Hernndez et al., 2017) . Human tDCs display high levels of the receptor tyrosine kinase AXL; however, Axl was undetectable in mouse tDCs using two antibody clones that efficiently labeled macrophages, as shown in Figure  S4B . Human tDCs expressed CD5 and CD81 (Zhang et al., 2017) , which was also true for mouse tDCs, especially CD11c high tDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:12688..12905:sentences:9f43f22045fe26bbbd292d84e07101b5	CD2|SIGLEC1|SIGLEC1	CD2|SIGLEC1|CD169	Lastly, both CD2 and SIGLEC1/CD169, two markers that have been used to define human pDC subpopulations (Matsui et al., 2009; Wilhelm et al., 2016) , were enriched in tDCs compared with other DC subsets in both species.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:12907..13023:sentences:e8480834fa911c4b7e02fd1ce678f575	CD2|SIGLEC1	CD2|Siglec1	However, CD2 was not a unique marker for tDCs, and Siglec1 was only detected in a fraction (~20%-30%) of murine tDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:13549..14050:sentences:ad4886dce6efa5ffc6ba797cc8fee433	TCF4|IRF8|IRF4|MPPE1|CDK1|ZBTB46	TCF4|IRF8|IRF4|cDC1|cDC2|Zbtb46	The TF TCF4 is required for pDC development and function (Cisse et al., 2008; Ghosh et al., 2010) . IRF8 and IRF4 are required for cDC1 and cDC2 development, respectively (Schiavoni et al., 2002; Suzuki et al., 2004) . Zbtb46 is uniquely expressed in cDCs and required for their function, but not their development (Meredith et al., 2012a (Meredith et al., , 2012b Satpathy et al., 2012) . Thus, we evaluated the TF signature of mouse and human tDCs in comparison to other DC subsets ( Figures 4A-4C ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:14052..14190:sentences:241f56303837247cb9d96f4c86e16fd7	TCF4|IRF8|ITGAX|ITGAX	TCF4|IRF8|CD11c|CD11c	At the RNA and protein level, both TCF4 and IRF8 expression ranged from intermediate to low in CD11c low and CD11c high tDCs, respectively.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:14192..14326:sentences:7e266b387cb50c4ab322dcb6f667044c	IRF4|ITGAX|IRF4	IRF4|CD11c|IRF4	We found high levels of IRF4 in tDCs, particularly CD11c high tDCs; however, different from mouse, IRF4 was also present in human pDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:14328..14504:sentences:95cdcaec169e516c98dcf3e210b08aed	ZBTB46|ITGAX|ITGAX	Zbtb46|CD11c|CD11c	Finally, Zbtb46 protein was detected in mouse tDCs, with intermediate to high expression in CD11c low and CD11c high tDCs, respectively.. Mouse and Human tDCs Share TF Profiles.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:14506..14739:sentences:633c247057a57b3640bb971e1a873892	TCF4|ID2|TCF4	TCF4|ID2|TCF4	Next, we analyzed the TF ID2, which promotes cDC development by antagonizing TCF4 (Grajkowska et al., 2017) . We found that ID2 expression inversely correlated with TCF4 expression, as expected ( Figure 4C ; see Table S2 for primers).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:14741..14860:sentences:c848f18de723ff056abd13cda2a669d1	ID2|ITGAX|ITGAX	Id2|CD11c|CD11c	In mouse, Id2 was not detected in pDCs and CD11c low tDCs but was noted in CD11c high tDCs at levels comparable to cDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:14862..14929:sentences:ecf3ce169fe30d1e83929e7bc0f643dd	ID2|ITGAX	ID2|CD11c	Similarly, low ID2 expression was detected in human CD11c high tDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:15375..15506:sentences:bf15fa64a36720320c02322a143913db	TCF4|ITGAX|TCF4|TCF4	Tcf4|CD11c|Tcf4|Tcf4	To test whether tDC development depends on Tcf4 expression, we analyzed CD11c CRE Tcf4 fl/fl (Tcf4 CKO ) mice ( Figures 4D and 4E ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:15508..15770:sentences:82d4e5f90ffc339783eb6bb934906f9b	TCF4|ITGAX|ITGAX|TCF4|MPPE1|CDK1	Tcf4|CD11c|CD11c|Tcf4|cDC1|cDC2	Conditional deletion of Tcf4 in this model results in pDC loss, as expected (Cisse et al., 2008; Ghosh et al., 2010) . The frequencies of both CD11c high and CD11c low tDCs were also significantly decreased in Tcf4 CKO mice, while cDC1s and cDC2s were unaffected.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:15933..16278:sentences:2e34ab70d8f515c52c08213535b84b7c	MPPE1|IRF8|IRF8|ITGAX|IRF4	cDC1|IRF8|Irf8|CD11c|Irf4	However, while cDC1s require IRF8 for development, pDCs require it for their function (Schiavoni et al., 2002; Sichien et al., 2016) . Depletion of Irf8 from pDCs generates a population with some features of cDCs, i.e., lower levels of SiglecH and higher levels of CD11c, Irf4, and MHC class II, which resembles the tDC population described here.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:16280..16366:sentences:194d08f73bc9d17a9ec6c4f560b28ebe	ITGAX|IRF8|IRF8	CD11c|Irf8|Irf8	Therefore, we analyzed pDCs and tDCs in CD11c CRE Irf8 fl/fl (Irf8 CKO ) mice by CyTOF.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:17253..17645:sentences:c57e46000fd1efbf37c8375ba8e63deb	BCL11A|RUNX2|SPIB|ITGAX|ITGAX	Bcl11a|Runx2|SpiB|CD11c|CD11c	Our transcriptome analysis showed that mouse and human tDCs express Bcl11a, Runx2, and SpiB, i.e., TFs associated with pDC development and function ( Figure 4A ; Chopin et al., 2016; Ippolito et al., 2014; Sawai et al., 2013; Schotte et al., 2004; Wu et al., 2013) . We confirmed this analysis by evaluating the expression of these TFs within mouse CD11c low and CD11c high tDCs ( Figure 5A ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:17647..17764:sentences:d7deea72330743e7d7b173c6b8c1de75	BCL11A|RUNX2|SPIB|MPPE1|CDK1	Bcl11a|Runx2|SpiB|cDC1|cDC2	We detected high levels of Bcl11a, Runx2, and SpiB in pDCs and tDCs but little to none of these TFs in cDC1s or cDC2s.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:17766..17884:sentences:d7933ad65e88bc8c23b6f7a07e3f49c5	BCL11A|RUNX2	Bcl11a|Runx2	Bcl11a was expressed similarly by all tDCs and pDCs, whereas Runx2 expression varied from high to low in tDC fractions.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:18098..18411:sentences:11b9c932a89caf84efbb9ddd5ebba9de	|PTCRA	IgH|PTCRA	Distinct from cDCs, pDCs exhibit lymphoid characteristics independent of their myeloid or lymphoid origin, i.e., rearranged immunoglobulin heavy chain (IgH) D-J genes and expression of the pre-T cell receptor  (PTCRA) Shigematsu et al., 2004) . Thus, we asked whether tDCs also bear these lymphoid characteristics.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:18413..18539:sentences:5436cf8e25bf2ff0929688cfeb0b6c6e	|ITGAX|ITGAX|CDK1	IgH D|CD11c|CD11c|cDC2	We detected IgH D-J rearrangement in pDCs, CD11c low tDCs, and CD11c high tDCs, but not in cDC2s or granulocytes ( Figure 5B ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:18909..19136:sentences:538ec3b3d943c4143d05b68326e1d59a	MPPE1|CDK1|PTCRA	cDC1|cDC2|PTCRA	We next took advantage of transgenic mice that allow evaluation of PTCRA-EGFP at the single-cell level ( Figure 5C ; Shigematsu et al., 2004) . As expected, we detected strong PTCRA-EGFP labeling in pDCs, but not cDC1s or cDC2s.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:19273..19415:sentences:b2a280dd3b96c4a22a8c13ebdff4040a	PTCRA|ZBTB46	PTCRA|Zbtb46	Moreover, PTCRA-EGFP was detected in ~50%-90% of tDCs despite their high expression of Zbtb46 ( Figure 4B ), a TF usually associated with cDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:19417..19632:sentences:b5f5d49cce276ead8aedf28343c3cdf9	|PTCRA	IgH D|PTCRA	Thus, comparable to bona fide pDCs, tDCs display several lymphoid characteristics such as a unique TF profile, IgH D-J rearrangements, and PTCRA-EGFP labeling.. tDCs Display Lymphoid Characteristics, Similar to pDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:20242..20532:sentences:d48ae7671b358a4a5f78708cfc09c88a	ITGAX|FLT3|FLT3	CD11c|CD172a  CD135|CD135	Next, we analyzed the relationship between splenic tDCs and splenic pre-DCs, gated as Lin  CD11c high MHC class II  CD172a  CD135 + ( Figure 5D ; Liu et al., 2009) . Unbiased analysis revealed that splenic pre-DCs were heterogeneous and localized to various CD135 high areas of the tSNE map.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:20534..20652:sentences:890594c6f62a8b1d3229bae3f3659e08	MPPE1|CX3CR1	cDC1|Cx3cr1	Most pre-DCs mapped near cDC1s, and only a fraction of pre-DCs mapped with Cx3cr1 + tDCs in the tSNE map ( Figure 5D ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:20811..20945:sentences:35781e2d0880607d13b7155bf13a24df	XCR1|ITGAM	Xcr1|CD11b	Closer phenotypic analysis revealed that ~60% of pre-DCs expressed either Xcr1 or CD11b, markers that tDCs lack ( Figures 1A  and 5G ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:21031..21154:sentences:3461127e8850bde77161029082a758a9	PTPRC|SIRPA	B220|CD172a	Conversely, tDCs expressed variable levels of B220, MHC class II, and CD172a, which are excluded from the pre-DC definition.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:21921..22144:sentences:2271040f240532ff5a030d789003c17e	TLR9|CD69|CD86	TLR9|CD69|CD86	Following in vivo stimulation with the TLR9 agonist CpG-A, mouse pDCs displayed high levels of CD69, an early marker of lymphocyte activation, while MHC class II and CD86 were only slightly upregulated ( Figures 6A and S6 ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:22146..22236:sentences:2bdeb67e29e7b45526de52c4673631bf	CDK1|MPPE1|CD69|CD86	cDC2|cDC1|CD69|CD86	In contrast, both cDC2s and cDC1s strongly upregulated MHC class II and CD86, but not CD69.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:22238..22442:sentences:291c2d607b4da38f65ec85947253c6bb	ITGAX|CD69|ITGAX|CD86	CD11c|CD69|CD11c|CD86	In accordance with their transitional phenotype, the CD11c low tDC fraction upregulated CD69 at comparable levels to pDCs, whereas the CD11c high fraction upregulated MHC class II and CD86 similar to cDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:22815..22928:sentences:631385c30f998c24e68ef0d9dd6a3c37	IRF7|IFNA1	IRF7|IFN	In accordance with their lower expression of IRF7 ( Figure 4C ), tDCs had lower capacity to produce IFN than pDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:22930..23053:sentences:1cede2a0df73aeee4b07fe3f9b16e458	ITGAX|ITGAX|IFNA1	CD11c|CD11c|IFN	Mouse CD11c low tDCs, but not CD11c high tDCs, were able to produce IFN, although to a lower extent than pDCs ( Figure 6C ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:23055..23158:sentences:9063464569f7047a301f6a570dd0c13f	ITGAX|ITGAX|IFNA1	CD11c|CD11c|IFN	Similarly, human CD11c low tDCs, but not CD11c high tDCs, secreted very low levels of IFN ( Figure 6D ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:24964..25132:sentences:320c0485237bfcf7d964f5da211f07f3	TCF4|CX3CR1	Tcf4|Cx3cr1	The few lung and skin tDCs found by CyTOF expressed Tcf4, Pdcal, and Cx3cr1 but showed decreased expression of SiglecH compared with splenic tDCs (Figures S7A and S7B ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:25889..25988:sentences:81f3583dfdbbcafe860db0158c329e68	CDK1|MPPE1	cDC2|cDC1	Before infection, cDC2s and cDC1s were represented in higher numbers than pDCs and tDCs in the lung.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:25990..26186:sentences:3dfa90d3b4d513ee7ca5d4bcbc77eb3d	CDK1|MPPE1	cDC2|cDC1	However, shortly after infection, lung cDC2 and cDC1 numbers decreased dramatically, whereas pDC and tDC numbers increased 2-to 3-fold ( Figures 7C and 7D ; see Figure S7C for the gating strategy).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:26261..26419:sentences:8d946138fc3727e7598e661a3cdfc32f	MPPE1|CDK1	cDC1|cDC2	The loss of cDC1s and cDC2s in the lung corresponded to an increase in migratory cDCs in the lung-draining mediastinal LNs, with a peak at day 4 ( Figure 7D ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:26564..26691:sentences:bc6932895b4d61835097f75a48158d76	CD69|CD86	CD69|CD86	Finally, we observed that both lung tDCs and pDCs upregulated the activation markers CD69, MHC class II, and CD86 ( Figure 7E ).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:28432..28653:sentences:8a8860e3a5b681d8f937739b58d5a41f	CD8A|CD4	CD8|CD4	Consequently, the ratio of Treg cells to CD8 + and CD4 + T cells was significantly higher in pDC-depleted mice, suggesting that lung-recruited pDCs and tDCs may have different roles during influenza infection.. DISCUSSION.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:30843..30938:sentences:891025688c173800182ff2397eec2b41	CD2|CD5|CD81|SIGLEC1	CD2|CD5|CD81|SIGLEC1	We found that mouse and human tDCs did share variable expression of CD2, CD5, CD81, and SIGLEC1.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:32074..32643:sentences:013c24f1a587c8dd984c03c065d5d104	BCL11A|IRF8|SPIB|RUNX2|TCF4|IRF8|MPPE1	BCL11A|IRF8|SPIB|RUNX2|TCF4|IRF8|cDC1	In addition, pDCs and tDCs shared expression of other TFs required for pDC development and function (e.g., BCL11A, IRF8, SPIB, and RUNX2), which are known to be upstream or downstream of the master regulator TCF4 (Ceribelli et al., 2016; Ghosh et al., 2010; Sawai et al., 2013) . Similar to pDCs, tDCs do not require IRF8 for their development, which is in contrast to cDC1s (Schiavoni et al., 2002; Sichien et al., 2016) . Altogether, the shared TF signature of pDCs and tDCs strongly indicates that their development likely progresses along a shared path.. DISCUSSION.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:33598..33994:sentences:452c5b1523e72aa7d9a26f6acdf0a0b5	BCL11A|RAG1|TCF4|ITGAX|ZBTB46	Bcl11a|RAG-1|TCF4|CD11c|Zbtb46	These lymphoid characteristics may result from their shared expression of Bcl11a, which controls RAG-1 expression (Lee et al., 2017) . Alternatively, they may be a consequence of an ectopic lymphoid program activated by TCF4, as previously suggested (Reizis, 2019) . We found that tDCs, especially CD11c high tDCs, simultaneously express PTCRA-EGFP and Zbtb46, a TF generally associated with cDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:36726..37072:sentences:53fb51693204e71ab0f98cae4fb1f68b	CLEC4C|TCF4	CLEC4C|TCF4	It remains to be determined why tDCs are not depleted in the CLEC4C DTR mice given that DTR expression is thought to be modulated by TCF4 in this model (Cisse et al., 2008; Swiecki et al., 2010) . Nevertheless, this finding points to the need to dissect whether tDCs are affected in other mouse models that have been used to evaluate pDC function.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:39188..39566:sentences:020851950b479e3139d4920dba3f293a	PTCRA|ITGAX|IRF8|CLEC4C|IRF8|IRF8|ITGAX	PTCRA|CD11c|Irf8|CLEC4C|Irf8|Irf8|CD11c	Transgenic PTCRA-EGFP mice have been described previously (Shigematsu et al., 2004) . CD11c CRE , Irf8 fl/fl and CLEC4C DTR mice have been described and were obtained from The Jackson Laboratory (Caton et al., 2007; Feng et al., 2011; Swiecki et al., 2010) . CD11c CRE mice were crossed to Irf8 fl/fl in house and screened routinely for the appearance of Irf8 germline deletions.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:41136..41469:sentences:c349ecd512199d016eab7a847013230b	ITGAX|MPPE1|ITGAX|XCR1|CDK1|XCR1|ITGAX|ITGAM	CD11c|cDC1|CD11c|Xcr1|cDC2|Xcr1|CD11c|CD11b	All DC populations were first gated on live cells, singlets, lineage negative (CD3  CD19  CD20  TCR  ), and CD11c + . cDC1s were sorted as CD11c high Xcr1 + . cDC2s were sorted as Xcr1  CD11c high CD11b + . For functional assays, the sorting strategy for pDCs and tDCs avoided the use of antibodies with potential inhibitory capacity.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:41471..41727:sentences:2e4d3324e24e3e11d23ab0ee0b2ce1e9	XCR1|CX3CR1|ITGAX|ITGAX|ITGAM|ITGAM	Xcr1|Cx3cr1|CD11c|CD11c|CD11b|CD11b	pDCs were sorted asXcr1  CD11b  Cx3cr1  B220 + Ly6C + . tDCs were sorted as Xcr1  CD11b  Cx3cr1 + and separated based on CD11c low Ly6C high and CD11c high Ly6C low . For RNA and DNA extraction, SiglecH was included in the sorting strategy.. METHOD DETAILS.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:43138..43472:sentences:77e97a742f4fd5a1149be1d48fe250f3	CD19|CD14|NCR1	CD19|CD14|CD335	To sort pure DC subsets from blood, PBMCs were Fc-blocked with human gamma globulin (Thermo Fisher Scientific), then negatively enriched using mAb against CD3 (OKT3), CD19 (HIB19), CD14 (HCD14), and CD335 (9E2) followed by anti-mouse magnetic beads (Dynabeads, Thermo Fisher Scientific) at a concentration of 2-4 beads per target cell.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:43586..44107:sentences:ae56cd03f4d323234520ed9374dcab3c	CEACAM8|CD14|FCGR3B|MPPE1|THBD|CDK1|THBD|ITGAX|CD1C|IL3RA|CD1C|ITGAX|IL3RA|CD1C|AXL|ITGAX|ITGAX|IL3|IL3RA|IL3RA|IL3RA|NCR1|AXL	CD66b|CD14|CD16|cDC1|BDCA3|cDC2|BDCA3|CD11c|BDCA1|CD123|BDCA1|CD11c|CD123|BDCA1|AXL|CD11c|CD11c|IL-3|CD123|CD123|CD123|CD335|AXL	All DC populations were first gated on live, singlets, lineage negative (CD3  CD19  CD20  CD335  CD66b  ) and monocyte negative (CD14  CD16  ). cDC1s were sorted as HLA-DR + CD123  BDCA3 high . cDC2s were sorted as HLA-DR + CD123  BDCA3-low CD11c + BDCA1 + . pDCs were sorted as HLA-DR + CD123 + BDCA1  AXL  CD11c  . tDCs were gated as HLA-DR + CD123 + BDCA1  AXL + and separated into CD11c  and CD11c + . To allow IL-3 binding in culture, only CD123 clone 6H6 was used for sorting.. Isolation of DCs from Human Blood and.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:44280..44481:sentences:8580ea6cbe86be89ad1f62aa3ad6bac2	CLEC9A|TCF4	Clec9a|TCF4	Anti-Clec9a and anti-TCF4 were labeled using the Alexa 647 Labeling Kit following manufacturer's instructions (Thermo Fisher Scientific) or detected using anti-Rabbit-Alexa 647 (Jackson ImmunoResearch).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:44850..45035:sentences:ef09235161d62b4306f79a4e8c6db366	FCGR3B|FCGR2C	CD16|CD32	Mouse: Cell suspensions from spleen, lung, and skin were incubated with supernatant against CD16/CD32 (clone 2.4G2, produced in house) to block non-specific binding for 15 minutes at 4C.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:45151..45555:sentences:17126f63235adfdf484eb4d074b90976	FOXP3|AK3	FoxP3|Fix	For transcription factor staining, cells were stained with surface Abs and LIVE/DEAD Fixable Blue (Thermo Fisher Scientific) in PBS for 20 minutes at 4C, then fixed with FoxP3 Transcription Factor Fix/Perm Buffer (Thermo Fisher Scientific) for 2 hours to overnight and stained intracellularly for 30 minutes in 1X Permeabilization Buffer (Thermo Fisher Scientific).. Isolation of DCs from Human Blood and.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:45824..46169:sentences:310d3bda5dd1f348c5ea0540ea0f6fd8	FOXP3|AK3	FoxP3|Fix	For transcription factor staining, cells were stained with surface Abs and LIVE/ DEAD Fixable Blue in PBS for 20 minutes at room temperature, then fixed with FoxP3 Transcription Factor Fix/Perm Buffer for 1 hour at 4C and stained intracellularly for 20 minutes in 1X Permeabilization Buffer.. Staining of Cell Suspensions for CyTOF-Metal-labeled.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:46689..46822:sentences:2cb7ff601a0e7a0200c40a53cddb83d1	FOXP3|AK3	FoxP3|Fix	Cells were washed twice with CyFACS then fixed with FoxP3 Transcription Factor Fix/Perm Buffer (Thermo Fisher Scientific) for 2 hours.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:46824..47028:sentences:187fc256a6e7bdb02bbe539021ee8036	FOXP3|CX3CR1|IL3RA|CD33|FLT3|SIRPA|CD163	FoxP3|CX3CR1|CD123|CD33|CD135|CD172a|CD163	Human surface CyTOF Abs that were sensitive to FoxP3 buffer in our hands (i.e., CX3CR1, CD123, CD33, CD135, CD172a and CD163), were instead stained after fixation and permeabilization for 30 minutes at 4C.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:48349..48454:sentences:252f4a2e82f292fa8a20043c66276955	IL12B|ITGAX	IL-12p40|CD11c	For detection of intracellular IL-12p40, mouse DCs were enriched using CD11c Microbeads (Miltenyi Biotec).
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:49857..50052:sentences:b78ad94c496a2004a837450b9dfb6beb	PTPRC|CD4	B220|CD4	CD4 + T cells were obtained by negative selection using a cocktail of Abs containing the following culture supernatants (produced in house): B220 (RA3-6B2), F4/80 (HB-198), MHC-II (TIB 120), NK1.1
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:51478..51628:sentences:006d885eac584875000b1d03b1ad465c	RPL13A|CDK1	Rpl13a|cDC2	Expression represents Cq relative to the internal control gene Rpl13a and cDC2s.. Figure 5. tDCs Display Lymphoid Characteristics Associated with pDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:51715..51856:sentences:032850c4df126b1c376e932786a87597	ACTB|	Actin|IgH	Actin and IgH germline (GL) are also shown (1 representative of 6 exp).. Figure 5. tDCs Display Lymphoid Characteristics Associated with pDCs.
+SARS:0f506a74e190c45a399f382c153919612fa1ef5b:fulltext:0e9dc04a691f47ba32c2fc218a80f6a7:52283..52476:sentences:2a358348d7a4b7ad0a2318466a0c8a5b	ITGAX|FLT3|SIRPA	CD11c|CD135|CD172a	Bottom panels show splenic pre-DCs gated as CD3  CD19  CD335  B220  and CD11c + MHC class II  CD135 + CD172a  as described (Liu et al., 2009) . Pre-DCs were overlaid in the tSNE map (pink dots).
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:abstract:fa93f545ff275e4edc5331e50f663e7b:803..1015:sentences:30c393d2794240c781a556204a6f8981	CASP3|CASP8|BAX	caspase-3|caspase-8|Bax	Expressions of proteins related to caspase-3, including cleaved poly-ADP-ribose polymerase, caspase-8, and Bax, were downregulated evidently after treatment with Se@RBV compared with the untreated infection group.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:abstract:fa93f545ff275e4edc5331e50f663e7b:1017..1130:sentences:c15464edafcbfd01117e15010fe8a874	POLDIP2|MAPK8|TP53	p38|JNK|p53	In addition, phosphorylations of phosphorylated 38 (p38), JNK, and phosphorylated 53 (p53) were inhibited as well.
+SARS:11a6f813fa996f0baa670ecc66875602f971eef1:fulltext:8c94e04a550c21c2d862fb5a6649a127:8489..8719:sentences:9d54d6235fc021ac8387623e6bad637c	IFNA1|IL2|IL2|CD8A|CD4	interferon gam-ma (IFN-)|interleukin 2|IL-2|CD8|CD4	Cell-mediated immunity is the main defense against CMV disease, including CD4 T helper cells and interferon gam-ma (IFN-) and interleukin 2 (IL-2) production, CD8 T cell-mediated cytolytic activity, as well as NK cell cytotoxicity.
+SARS:11f4b8db80c19de17f434e02207ece64b20bc11c:abstract:a1528a8319dcfad84f56111fe9498d3b:465..659:sentences:ea317e2b383aa012619457d680aa623b	CSNK2A1|SH2D1A	CK2|sap	Furthermore, the N protein could be phosphorylated in vitro by Nicotiana benthamiana plant sap and by purified recombinant kinases such as protein kinase CK2 and calcium-dependent protein kinase.
+SARS:11ebffa99e4b093c6304549246b534983012f909:fulltext:4977b3c81a3c3ee34d0e6f5917ca08d9:4058..4327:sentences:de36cc622810a998999d825fd7d78627	CRP|NPPB	CRP|BNP	All patients with KD were examined for inflammatory markers such as total white blood cell count, neutrophil count, neutrophil/ lymphocyte ratio, ESR, CRP, lactate dehydrogenase (LD), and B-type natriuretic peptide (BNP).. Laboratory & clinical characteristics analysis.
+SARS:11ebffa99e4b093c6304549246b534983012f909:fulltext:4977b3c81a3c3ee34d0e6f5917ca08d9:4329..4516:sentences:d0b4ad2d2502034491c86e1e3e407524	ALB|SLC17A5	serum albumin|AST	In addition, other laboratory findings such as hemoglobin, serum sodium, serum albumin, aspartate aminotransferase (AST), alanine aminotransferase (ALT), and urinalysis were also assessed.
+SARS:0f631c3f9ceddcf03d90d552dbc1a7461c3e25db:fulltext:0bb39693534bd114981c2002e89823d1:7395..7685:sentences:beb28fe5223a967971a6f254f047f4b4	IFNA1|STAT1|STAT1|MX1	IFN|Stat1|Stat1|Mx1	To confirm IFN competence and Ruxolitinib efficacy, cells infected and treated as indicated above were analysed by immunoblot with primary antibodies against phospho-Stat1, Stat1 and tubulin as indicated, and against Mx1 and RVFV N at 1:1000 and 1:2000, respectively.. Electronic Supplement.
+SARS:1205092fb7ceab14b45e37c1248f6d70e87805ab:title:c2313fbb1fa10ed5ea21bfac979af023:0..146:sentences:d376bddfba13a9dc867935b8375b299a	HSPA4|LYZ	HSP70|lysozyme	The up-regulation of two identified wound healing specific proteins-HSP70 and lysozyme in regenerated Eisenia fetida through transcriptome analysis
+SARS:11888535f2eb67c15d08783b164def90aa47a3bd:fulltext:e6aa484d86d51102f27db60f320d7968:11519..11989:sentences:367642e008140d8f37acfe4735419024	IFNA1|IL6|CXCL10|TNF|TNF	interferon (IFN)-, IFN-, IFN-, monocyte chemoattractant protein (MCP)-1|IL-6|interferon-induced protein (IP)-10|tumor necrosis factor|TNF	The expression levels of interferon (IFN)-, IFN-, IFN-, monocyte chemoattractant protein (MCP)-1, interleukin (IL)-1, IL-6, IL-12, interferon-induced protein (IP)-10, and tumor necrosis factor (TNF)- were measured using the relative quantification method, and normalized to the results of the control or glucose group using the 2 CT method with -actin (forward primer, 5-GAG ACC TTC AAC ACC CCG C-3; reverse primer, 5-ATG TCA CGC ACG ATT TCC C-3) as an internal standard.
+SARS:11888535f2eb67c15d08783b164def90aa47a3bd:fulltext:e6aa484d86d51102f27db60f320d7968:13018..13219:sentences:6fa4487c48942e8bb3e29fd7827018c3	ITGAX|CD86|CD80|CD40	CD11c|CD86|CD80|CD40	Fluorescent conjugated rat anti-mouse monoclonal antibodies including anti-CD40-PE, anti-CD80-PE, anti-CD86-PE, anti-MHC-II-PE, and anti-CD11c-FITC were purchased from eBiosciences (San Diego, CA, USA).
+SARS:11888535f2eb67c15d08783b164def90aa47a3bd:fulltext:e6aa484d86d51102f27db60f320d7968:21706..21919:sentences:7d77d7025ae141a9213059d5e118beff	CD40|CD80|CD86	CD40|CD80|CD86	During initiation of the immune response, the expression of co-stimulatory markers CD40, CD80, and CD86 at the DC surface is related to their ability to induce or suppress immune responses, as is MHC-II expression.
+SARS:11888535f2eb67c15d08783b164def90aa47a3bd:fulltext:e6aa484d86d51102f27db60f320d7968:21921..22168:sentences:8a970973df24e09abc43d3c8fc197aaa	CD40|ITGAX|CD80|ITGAX|CD86|ITGAX|ITGAX	CD40|CD11c|CD80|CD11c|CD86|CD11c|CD11c	Thus, the proportions of CD40+ CD11c+, CD80+ CD11c+, CD86+ CD11c+, and MHC-II+ CD11c+ cells among mouse T cells on days 1 and 3 after intraperitoneal ZrO 2 administration were determined using fluorescence-activated cell sorting (FACS; Figure 4A ).
+SARS:11888535f2eb67c15d08783b164def90aa47a3bd:fulltext:e6aa484d86d51102f27db60f320d7968:22170..22369:sentences:9577683b767fdb18d39965d1f400d43c	CD40|CD80|CD86	CD40|CD80|CD86	CD40, CD80, CD86, and MHC-II expression levels in the ZrO 2 groups were higher than those of the control group, with a significant difference between the 25 mg/kg ZrO 2 and glucose groups (P < 0.001).
+SARS:11888535f2eb67c15d08783b164def90aa47a3bd:fulltext:e6aa484d86d51102f27db60f320d7968:22502..22697:sentences:83c681cceb68e1194a62c4611819a0b8	CD40|CD80|CD86	CD40|CD80|CD86	These data suggest that 200 nm ZrO 2 can promote CD40, CD80, CD86, and MHC-II expression in T cells of mice and favorably affect the maturation of DCs.. ZrO 2 Enhanced the Innate Immunity of Mice.
+SARS:11888535f2eb67c15d08783b164def90aa47a3bd:fulltext:e6aa484d86d51102f27db60f320d7968:22699..22777:sentences:5a1bb747579a0a0d5faef54041a14c3c	IFNA1|IL1A	IFN-, IFN-,|IL1	IFN-, IFN-, and IL1- are crucial for the innate immune and antiviral responses.
+SARS:11888535f2eb67c15d08783b164def90aa47a3bd:fulltext:e6aa484d86d51102f27db60f320d7968:23761..23948:sentences:61af549749e005faeaa683d8397eac36	CXCL10|CCL2|IL6|TNF|IFNA1	IP-10|MCP-1|IL-6|TNF|IFN-	For mechanistic analysis, we evaluated expression levels of the cytokines IFN-, IP-10, MCP-1, IL-12, IL-6, and TNF- in the lungs of infected mice administered NPs using qPCR ( Figure 5A ).
+SARS:11888535f2eb67c15d08783b164def90aa47a3bd:fulltext:e6aa484d86d51102f27db60f320d7968:27758..27930:sentences:863ca869cd4a2d82655984c4cb4cdc07	IL6|IFNA1|CCL2|TNF	IL-6|IFN-|MCP-1|TNF	High levels of pro-inflammatory cytokines, including IL-6, IFN-, MCP-1, and TNF-, have been detected in humans and mice infected with highly pathogenic H5N1 influenza virus.
+SARS:1224f7c22371c92a787342d6fb1d579f5e02598e:title:bd4071c475da3ddeae8fe7784d4aa184:0..155:sentences:40b54ff2ea9de29d3e521038d73109a2	TMPRSS2|FURIN	TMPRSS2|furin	TMPRSS2 and furin are both essential for proteolytic activation and spread of SARS-CoV-2 in human airway epithelial cells and provide promising drug targets
+SARS:1229bfb6b2481a4afada0a99d545513d3b673c42:abstract:13fc8437a295128669b3cb1b4a7a8c4c:291..471:sentences:161ae862d25ce5bb0a4ba227394073f6	CTSL|CTSL|CTSB|CTSB|SARS	cathepsin L|CTSL|cathepsin B|CTSB|SARS	In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB).
+SARS:123db7e17bb17a0d4ff1e7ef87cb629d6ac78125:abstract:4ee008d4acfafd4ab4b2ad9b582dcd85:283..702:sentences:03e6817c510bde757c72101d57720702	CCK|SFTPA1	CCK|SFTP1	Analyses based on full genomes of BCoV and HCoV-OC43 and on both human and bovine mRNAs sequences of cholecystokinin (CCK) and surfactant protein 1 A (SFTP1-A), representing the enteric and respiratory tract codon usage, respectively, have shown natural selection leading to optimization or deoptimization of viral codon usage to the human enteric and respiratory tracts depending on the virus genes under consideration.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:2296..2500:sentences:a63209851242b25df4882ab48368d747	CAP1|CAP2	cap1|cap2	6 In higher eukaryotes, the 5 0 ends of mRNA and snRNA are modified further by ribose 2 0 -O-methylation on the first and second transcribed nucleosides, yielding cap1 and cap2 modifications, respectively.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:2789..2941:sentences:5eb9353dc3c93be2695b7cc3e187fa40	CAP1|CAP2	Cap1|cap2	9 Cap1 and cap2 methylations in U2 snRNA are required for the formation of spliceosomal E-complex and, as a consequence, for efficient pre-mRNA splicing.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:13316..13374:sentences:59f0ff3673d32bb8fbeeca9c8a440353	CAP1|CMTR1	cap1|CMTr1	In humans, cap1 formation is catalyzed by the CMTr1 enzyme.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:13609..13738:sentences:9e9159910ecca07e8c72523671e52d1c	CMTR1|CAP1	CMTr1|cap1	39 The N-terminal domain of CMTr1 shares a global architecture with the VP39 protein and is sufficient for cap1 activity in vitro.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:15722..15903:sentences:bb55eb0c5321414e96425da58b6d9fd9	CMTR2|CMTR1|CAP1	CMTr2|CMTr1|cap1	Interestingly, while CMTr2 appears to be closely related to its human paralog CMTr1 as well as to TbMTr1, TbMTr2 is more closely related to the vaccinia virus cap1 methyltransferase.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:18191..18456:sentences:cc9604441687efc068131e2845ad5eda	CAP1|CMTR1	cap1|CMTr1	50 It should be noted that the putative cap1 methyltransferase domain of reovirus exhibits a similar cap-binding platform formed by N-and C-terminal extensions, as in VP39 and human CMTr1 enzymes; however, its putative m 7 G-binding site is more open.. Introduction.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:21319..21334:sentences:b34e63d6958ba50566c0fadeee4e9e41	TGS1|LIN9	Tgs1|Tgs2	3) .. Tgs1/Tgs2.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:22041..22322:sentences:3c094ffe4c0fa43612f60fcdc31359f0	TGS1|LIN9	Tgs1|Tgs2	68 Interestingly, in contrast to Tgs1 methyltransferases able to catalyze 2 sequential N2 methylation steps leading to TMG cap formation, Tgs2 activity is apparently limited to a single round of N2 methylation, resulting in the synthesis of a 2,7dimethylguanosine (m 2,7 G) product.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:22945..22954:sentences:f721e0ac85a50c4848acfce9fe4502f6	TGS1|LIN9	Tgs1|Tgs2	Tgs1/Tgs2.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:23352..23673:sentences:2b695d09a3c2f0848eaace507fc03310	METTL3|METTL14|KIAA1429|WTAP|METTL3|METTL14|KIAA1429	METTL3|METTL14|KIAA1429|WTAP|METTL3|METTL14|KIAA1429	72 Recently, Schwartz and coworkers studied the m 6 A mRNA methylome following depletion of multiprotein methyltransferase complex components METTL3, METTL14, KIAA1429, and WTAP, and implicated the involvement of the METTL3, METTL14, and KIAA1429 proteins in m 6 A formation at the internal sites but not at the 5 0 sites.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:23675..23802:sentences:4047e5a8d4ba3bf08cfad8e46d3790f1	TGS1|LIN9	Tgs1|Tgs2	73 The full characterization of the cap-specific m 6 A methyltransferase activity requires further studies in vitro.. Tgs1/Tgs2.
+SARS:0f67baef306ea56d7b574059fb72ff68affb0246:fulltext:aabfa56f524119e04ac315700dcf608a:27779..28030:sentences:99ebf40a8fdc7398ca2401658b0947a8	CAP1|CAP2|SERPINB9|CAP1	cap1|cap2|cap3|cap1	While the cap0 and cap1 methyltransferases in trypanosomes are relatively closely related to their human counterparts, bioinformatics analyses identified cap2 and cap3/4 methyltransferases as close homologs of the vaccinia virus cap1 methyltransferase.
+SARS:1275c64d711b3973f7e25ebc72bbc7c99341dd00:abstract:0434828f30a588cdc0484ad02fb70e55:423..647:sentences:c96315b403579ce1296fc80d21ccb756	CSF3|IL6	G-CSF|IL-6	Using a mouse footpad inoculation model, we found that PRV infection rapidly and simultaneously induces high G-CSF and IL-6 levels in several mouse tissues, including the footpad, PNS and central nervous system (CNS) tissues.
+SARS:1275c64d711b3973f7e25ebc72bbc7c99341dd00:abstract:0434828f30a588cdc0484ad02fb70e55:809..946:sentences:40e9927ec8fed3fd523a1df02790ea2a	CSF3|IL6	G-CSF|IL-6	These high G-CSF and IL-6 levels were not caused by neutrophil infiltration in PRV infected tissues, as we did not detect any neutrophils.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:7470..7739:sentences:5c591e904c1b4d331e84dfb980c77a90	USF2|MAGEC2|SAGE1	FIP|CT10|CT14	5, 6 The diagnosis of dry-to-wet FIP in three cats (CT03, CT10 and CT14) was based on diffuse enlargement of the colon and histories of loose stools, blood and mucus in the stool, straining to defecate and small-caliber stools prior to occurrence of abdominal effusions.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:7820..8003:sentences:8505207948d75d89dbb0ea525fd125c2	USF2|MAGEA2B	FIP|CT12	9 Dry-to-wet FIP was also suspected in cats CT01, CT02 and CT12, owing to a stunting of growth that preceded the appearance of abdominal effusions by many weeks.. Disease confirmation.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:11823..12018:sentences:cb989a7d508b2642a9d24632b4652891	USF2|SPA17	FIP|CT22	The cats were then retreated, the rationale being to progressively extend primary and secondary treatment periods for as long as their FIP remained responsive to GC376 (see CT04, CT22, Figure 2 ).
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:12310..12421:sentences:0987277394aa3ffa58b123529f1d5fd5	MAGEC2|SAGE1	CT10|CT14	The primary and secondary treatment periods were then extended to 9 weeks (CT07, CT09, CT10, CT14) ( Figure 2 ).
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:16046..16235:sentences:bdbb475199c3b2153e0a3f04d4bfb43f	ADAM2|LIPI	CT15|CT17	One long-term survivor was spayed (CT15) and two castrated (CT17, 20) without complications during their disease remissions.. Response to initial treatment and favorable response indicators.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:16537..16706:sentences:65c5a9f7a6fee55f2a0c5697db00e6a0	MAGEA6|USF2	CT16|FIP	Lymphopenia improved with treatment in all the cats with wet FIP except CT16, but it was not helpful in predicting disease relapses that occurred thereafter (Figure 5a ).
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:17864..18045:sentences:f57af8e86e4ff128d4684851b9e2aa4d	ADAM2|MAGEA6|LIPI	CT15|CT16|CT17	Cats CT15, CT16 and CT17 had 955, 1699 and 2937 times higher levels of viral RNA, respectively, than CT02, which had the lowest virus load in effusion prior to treatment (Figure 7 ).
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:18572..18758:sentences:3cae659f8ef331322c93f6675e8d69d3	LIPI|MAGEA8|ADAM2	CT17|CT18|CT15	It is noteworthy that viral RNA levels in ascites cells from cats CT15, CT17 and CT18 decreased the fastest and were also among the five cats that went into a sustained disease remission.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:19819..19998:sentences:9580616c2ad3ae1a497e1b1a4b4ee501	MAGEA3|USF2	CT13|FIP	Three of the cats that succumbed to neurologic disease (CT05, CT08, CT13) presented because of ocular FIP or ocular involvement was detected secondarily on examination ( Table 1 ).
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:20685..21069:sentences:df00ad3f453a1a14dd82a5580667f98e	MAGEC2|SAGE1|MAGEA6|SAGE1|MAGEC2|MAGEC2|SAGE1	CT10|CT14|CT16|CT14|CT10|CT10|CT14	Five cats (CT03, CT07, CT10, CT14 and CT16) had recurrence of typical intra-abdominal lesions in the absence of neurologic signs during or after treatment ( Table 1) . Four of them presented with ileocecal masses (CT03, CT07 and CT14) or an enlarged colonic lymph node (CT10) that decreased in size (CT03, CT10 and CT14) or became no longer palpable (CT07) following primary treatment.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:25435..25608:sentences:e2102fa549a4a16f55c0f14e77844cdf	MAGEA6|MAGEC2|MAGEA2B	CT16|CT10|CT12	The 3CLpro sequences of pretreatment viral RNA obtained 25 days (CT16), 139 days (CT02), 149 days (CT12) and 231 days (CT10) later at the time of necropsy were also compared.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:25665..25764:sentences:86ff55bafc7b32b29d15e60d271e2410	MAGEA6|MAGEA2B	CT16|CT12	Sequences also remained unchanged in CT02, CT16 and CT12 from the times of presentation to necropsy.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:26606..26736:sentences:07964bf143101bb7f4589be8d9a85bbe	LIPI|MAGEA8|||PRSS50|ADAM2	CT17|CT18|CT21|CT23|CT20|CT15	Six of these kittens presented with acute effusive disease of the abdomen (CT15, CT17, CT18, CT21, CT23) or chest (CT20) at 3.3-4.4
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:26738..27043:sentences:bda01c616b2283781740e9483c0308f0	|USF2	CT21|FIP	months of age and were treated continuously for 12 or 17 (cat CT21) weeks (Table 1, Figure 2) . A seventh cat (CT04), a 6.8-year-old random-bred castrated male presenting with dry FIP limited to a mesenteric lymph node, also achieved Section from the greatly thickened wall of resected colon from cat CT03.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:31247..31479:sentences:486cbc234bdd8679ed23f58be7d9c51a	USF2|USF2|MAGEC2|MAGEA3|SAGE1|MAGEA6|SPA17	FIP|FIP|CT10|CT13|CT14|CT16|CT22	Five cats had no gross evidence of active FIP (CT01, CT02, CT05, CT08, C12), three had lesions consistent with noneffusive FIP (CT07, CT10, CT13) and four had effusive peritonitis with multiorgan involvement (CT03, CT14, CT16, CT22).
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:39581..39758:sentences:36cab677c1b4ac9b0c23f94014387b77	SPA17|MAGEC2|MAGEA3	CT22|CT10|CT13	18, 19 Cats that developed neurologic disease did so either while on treatment (CT05, CT08, CT22) or 2 (CT01, CT02, CT09), 3 (CT13) or 6 (CT10) weeks after treatment was stopped.
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:45847..45971:sentences:ea820b90c1d9d7144c2d5aaf01d1dcc7	CYTL1|BBS9|||USF2|PRSS50|PLAC8	C17|C18|CT21|CT23|FIP|CT20|C15	months of age when presented for acute signs of either abdominal (C15, C17, C18, CT21, CT23) or thoracic effusive FIP (CT20).
+SARS:11f3cdbb678b326042e1d0c38887a34a2177ddfe:fulltext:50c25fd1fc889d9a2664112b67eb0722:45973..46176:sentences:f2b2928a9dd11c081ec1c42445c91902	LUZP4|MAGEA6||USF2	CT8|CT16|CT21|FIP	This made them younger than all but three (CT8, CT16, CT21 ) other cats in the trial and more closely resembling the 16-week-old laboratory cats with acute-onset effusive FIP that responded well to GC376.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:11572..11787:sentences:a8559b8f90b283ab0f2bb7ee2566991e	NELFCD|IL6|	Th1|IL-6|IL-10 and transforming growth factor beta	Lung homogenates were analyzed for pig cytokines, Th1 (IFN- and interleukin [IL-12]), proinflammatory (IL-6), and immunosuppressive (IL-10 and transforming growth factor beta [TGF-]) by ELISA as described previously.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:12256..12412:sentences:8ce76ce6cbb3f9fd4c3315f87192f8e1	CD4|CD8A|NCAM1	CD4|CD8|CD56	LMNCs were first immunostained using pig lymphocyte-specific monoclonal antibodies (CD3, CD4, CD8, CD56, and TcR1N4) conjugated with different fluorochromes.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:20412..20875:sentences:0db2ee1bd1bc570edd82bb6c6e5a9836	IFNA1|NELFCD	IFN|Th1	The quantity of IFN- detected in the lung homogenate was significantly higher in Group 6 pigs compared to Group 5 (low dose) and Groups 4 and 5 (high dose) categories ( Figure 4B and H) . Another important Th1 cytokine, IL-12, was not significantly modulated among the tested pig groups in the high vaccine dose category ( Figure 4J ), but in low-dose Groups 4 and 6, significantly higher levels of IL-12 were detected compared to Groups 2, 3, and 5 ( Figure 4D ).
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:20877..21170:sentences:55382890ea1cb7b7eb2e64a3884c6c3d	IL6|NELFCD	IL-6|Th1	One of the important proinflammatory cytokines, IL-6, was significantly reduced in the lungs of all the vaccine trial groups compared to mock-challenged animals ( Figure 4C and I).. Upregulated Th1 and downregulated immunosuppressive cytokines in the lungs of adjuvanted NP-Kag-vaccinated pigs.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:21679..21974:sentences:f5d4a8bd6dc76a00be18d53814283d62	CD4|CD8A	CD4|CD8	Significantly increased PRRSVspecific recall IFN- response was detected both in CD4 + and CD8 + lymphocyte subsets of Group 6 pigs vaccinated with a high dose of vaccine ( Figure 5C and D) . These data suggest that both T-helper and CTLs were potentially primed in the lungs of only Group 6 pigs.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:21976..22459:sentences:6cb98351101dacd79dfd80d9ad3f0e59	CD4|CD8A|CD4|IFNA1|IFNA1|CD8A	CD4|CD8|CD4|IFN-|IFN-|CD8	When PRRSV-specific IFN- secreting lymphocyte subsets in only restimulated cells were compared among different vaccine trial groups, only in Group 6 animals (both vaccines doses) significantly increased CD4 + CD8 -IFN- + cells compared to Group 2 animals ( Figure 5F and N) , while CD4 -CD8 + IFN- + cell frequency was significantly enhanced in Group 6 pigs were present compared to Groups 2, 3, and 5 with low vaccine dose and Groups 2 to 5 with high vaccine dose ( Figure 5G and O).
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:22461..22612:sentences:7dd520d19cc8ece702959408d9d8081a	CD4|	CD4|CD8 + IFN- + and IFN	Similarly, CD4 + CD8 + IFN- + and IFN- +  T cells were significantly higher in Group 6 pigs compared to pigs in Groups 2, 3, and 5 ( Figure 5H -I, P-Q).
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:22614..23450:sentences:c5a7df0b51e28ed9ba7cf1dc21abe031	IFNA1|ITGAX|CD163|NCAM1	IFN|CD11c|CD163|CD56	An increased frequency of activated  T cells was detected in Group 6 pigs compared to other groups (Table 2A and B) . Although there was no significant difference in total natural killer (NK) (CD56 + ) cell frequency ( Figure 5J and R) , an increase in IFN- + NK cell frequency was significant in Group 6 pigs compared to other tested groups ( Figure 5K and S) . In addition, macrophage (CD172 + CD163 + SLAII + ) and dendritic cells (CD172 + CD11c + SLAII + ) rich APC populations were significantly higher in Group 2 and 6 pigs in the high-dose vaccine category compared to Group 5 animals ( Figure 5T and U); in the low-dose category, though a similar trend was detected, the data was not statistically significant ( Figure  5L and M).. Significant clearance of challenged PrrsV load in the lungs of adjuvanted NP-Kag-vaccinated pigs.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:25239..25423:sentences:105f6071578a129081ca407309c27954	|IFNA1	IFN- + (A and B|IFN-	Representative histograms showing stimulated total lymphocytes in LMNCs with intracellular IFN- + (A and B) . The dotted line: isotype control and solid line: IFN- + -specific staining.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:25425..25592:sentences:e3964cfa129768d683b32398c41f9abd	IFNA1|NCAM1|CD4|CD8A	IFN|cD56|cD4|cD8	Unstimulated (clear bars) or stimulated (black bars) LMNCs with killed PRRSV MN184 ags were analyzed for total IFN- + cD4-, cD8-, and cD56-expressing lymphocytes (C-E).
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:25594..25844:sentences:c4dc882bf315aa31372df60dd60d70cb	IFNA1|NCAM1|NCAM1	IFN|cD56|cD56	Only stimulated lMNcs were compared for indicated IFN- + lymphocyte subsets: cD4 + cD8 -IFN- + (F and N) ; cD4 -cD8 + IFN- + (G and O); cD4 + cD8 + IFN- + (H and P);  + IFN- + (I and Q); and total NK (cD56 + ) (J and R); cD56 + IFN- + cells (K and S).
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:25846..26012:sentences:df8dcb64730d3f85ccecd8815c93b50b	ITGAX|CD163|APCS	cD11c|cD163|aPcs	also immunostained for potential aPcs; macrophage-rich (cD172 + cD163 + sla-II + ) (L and T) and dendritic cell-rich (cD172 + cD11c + sla-II + ) (M and U) populations.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:28062..28191:sentences:826b20ff20afadfce0663fd223474744	ITGAX|APCS	CD11c|APCs	CD11c + APCs are richly present in the lungs in both BAL cells and LMNCs, but they differ in their antigen presentation potential.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:31929..32634:sentences:b9d9c797796b3c432f9f32a44b8c15d6	NELFCD|NELFCD|IFNA1|IL10|IFNA1|CD4|CD4|APCS|CD8A|CD8A	Th1|Th1|IL-12 and IFN-)|IL-10|IFN|CD4|CD4|APCs|CD8|CD8	Our results indicated that adjuvanted NP-KAg (Group 6 pigs) did potentiate anti-PRRSV immune response in the lungs, as indicated by the following parameters: 1) increased PRRSV-specific IgG and IgA response with enhanced antibody avidity and VN titers, and balanced Th1 and Th2 immune responses; 2) upregulated secretion of Th1 (IL-12 and IFN-) and downregulated immunosuppressive (TGF- and IL-10) cytokines; 3) enhanced frequency of ISCs and IFN- producing CD4 + , CD8 + , CD4 + CD8 + T cells,  + T cells, and NK cells, and expanded frequency of APCs; and most importantly, 4) complete clearance of detectable replicating challenged heterologous PRRSV and tenfold reduction in viral RNA load in the lungs.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:32772..33134:sentences:bce3c495c34a9059e47c870736797b41	CD4|CD4|CD8A|CD4|IFNA1|IFNA1|IFNA1|CD8A|CD8A	CD4|CD4|CD8|CD4|IFN-|IFN-|IFN-|CD8|CD8	In our previous study, in pigs immunized with the adjuvanted NP-KAg, increased frequency of only CD4 -CD8 + IFN- + cells in restimulated PBMCs was detected, 14 but in stimulated LMNCs, increased populations of both CD4 + CD8 -IFN- + and CD4 -CD8 + IFN- + cells was observed, perhaps indicating the induction of both T-helper and CTL memory responses in the lungs.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:35386..35502:sentences:d438f40371e6b4b90cee94e6bb59f04b	IFNA1|CD4|CD4|NELFCD|CD8A|CD8A	IFN-|CD4|CD4|Th1|CD8|CD8	17 A crucial Th1 cytokine, IFN-, is produced by NK cells,  T cells, CD4 + and CD8 + T cells, and CD4 + CD8 + T cells.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:35504..35745:sentences:e45f15f833b1a1d81cc0139ed720b6b3	IFNA1|IFNA1|CD4|CD8A	IFN|IFN|CD4|CD8	Enhanced secretion of IFN- and the presence of increased frequencies of IFN- + memory CD4 + and CD8 + cells in the lungs of adjuvanted NP-KAg-vaccinated pigs have confirmed the additive effect of PLGA-mediated delivery and adjuvanticity of M.
+SARS:0f34670b6327305bb3d66de79d1aa96a5d8de2b2:fulltext:43e11226b908fd376dbb85f5b898d15a:36105..36379:sentences:11cd81354a8f08e0e2a5dc80c9eec959	IL10|NELFCD	IL-10|Th1	68, 69 In addition, increased levels of another important Th1 cytokine, IL-12, 70 was detected in the lungs of adjuvanted NP-KAg-vaccinated pigs, associated with reduced production of immunosuppressive cytokines, IL-10 and TGF-, which play a vital role in PRRSV pathogenesis.
+SARS:12d35c12218f230c49f4dc892814ba9f1037f251:abstract:abf8e56a3df1164e278e2b0bfd615fcd:823..1115:sentences:a55c2e1393a377c9b7deb931753ee528	TNFRSF4|TNFRSF4|TNFSF4|TNFSF4|CD8A	OX40|CD134|OX40L|CD252|CD8	Impressive results in animal models have shown that the tumor necrosis factor receptor (TNFR) family member OX40 (CD134) and its binding partner OX40L (CD252) are key costimulatory molecules involved in the generation of protective CD8(+) T-cell responses at mucosal surfaces such as the lung.
+SARS:12d35c12218f230c49f4dc892814ba9f1037f251:title:2da8925e0d8044c2154a0d48a2880b50:0..112:sentences:74f087fcec865f418fc7a78ba78e4b41	TNFRSF4|TNFSF4|CD8A	OX40|OX40L|CD8	OX40:OX40L axis: emerging targets for improving poxvirus-based CD8(+) T-cell vaccines against respiratory viruses
+SARS:12ff80fec2dec1a3a9ca17de05baa15dfbfd0398:abstract:88b321b86858cd1a5695ea2fb8f4ede2:367..521:sentences:20f07beb2be4205238cdd40a60a40698	IVNS1ABP|ARFIP2	NS1|POR1	Based on the full-length NS1 protein, the three strains of FBoVs detected in the present study shared high homologies with the genotype 2 FBoV POR1 strain.
+SARS:12fe9b935bd5432139ed3e95f81975e29ee3e649:abstract:ac7ae0890c0fcf02cbc5f3c4a5624988:0..270:sentences:d9c98e2073733c4efcde09ee1538e9ff	LCT|TREH|DPP4	lactase|trehalase|dipeptidyl peptidase IV	Publisher Summary This chapter reviews the expression of intestinal brush-border disaccharidases (maltase-glucoamylase, sucrase-isomaltase, lactase, and trehalase) and peptidases (aminopeptidases A and N and dipeptidyl peptidase IV) during development in growing animals.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:1671..1808:sentences:8b4e9d19b464ade93d1590add541b099	SOCS3|STAT3|MEF2C|TREM2|TYROBP	SOCS3|STAT3|Mef2c|TREM2|TYROBP	Western blot, histology) should be undertaken, especially of the genes mentioned in the discussion (SOCS3, STAT3, Mef2c, TREM2, TYROBP) c.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:6302..6465:sentences:8fadf552ea1f6dbf80979f7a1c4a973a	SOCS3|STAT3	SOCS3|STAT3	How long does it persist?. . In the discussion the authors suggest that changes in SOCS3-STAT3 signalling may control downregulation of microglia homeostatic genes.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:6467..6780:sentences:4389b9c4e5faaf522eb1df0a3dd36ff9	STAT3|CCR2	Stat3|Ccr2	Can the authors include experiments to show whether phosphorylation of Stat3 in microglia is indeed different between steady state and inflammatory microglia?. . In Figure 2 D the authors try to show that there is no monocyte contamination of their sorted microglia population by performing qPCR for Ly6c and Ccr2.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:11025..11106:sentences:39c6cfd35a464b62be5901a850d3f8e9	TMEM119|GPR34	Tmem119|Gpr34	Tmem119 and Gpr34) were decreased, while those of the pro-inflammatory genes (e.g.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:11108..11212:sentences:97281e1c6a0ffd6b7a7935c71b7d4c15	IL1B|TNF	Il1b|Tnf	Il1b and Tnf) were up-regulated by cultured adult microglia treated with LPS compared to untreated cells.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:12110..12245:sentences:cf34aae9d0fc3ffa222282f042123cb7	SOCS3|STAT3|MEF2C|TREM2|TYROBP	SOCS3|STAT3|Mef2c|TREM2|TYROBP	Western blot, histology) should be undertaken, especially of the genes mentioned in the discussion (SOCS3, STAT3, Mef2c, TREM2, TYROBP).
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:12259..12327:sentences:12eb8a3ef80cfc5d3279a97691403d06	TREM2|TYROBP	Trem2|Tyrobp	Gene expression levels of Trem2 and Tyrobp were already shown in Fig.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:12428..12593:sentences:6af0b205def599f08b3b542496e326a7	MEF2C|TREM2|TYROBP	Mef2c|Trem2|Tyrobp	2A . Thus, we displayed the decrease of the expression levels of Mef2c, Trem2 and Tyrobp by microglia isolated from LPSinjected mice compared to saline-injected mice.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:12595..12869:sentences:48b4d5d505180966c1b9ace8b4df529d	SOCS3|STAT3	Socs3|STAT3	As recommended in minor point 3d "In vitro experiments could also be used to validate findings from the sequencing experiments", we took advantage of primary cells to analyse Socs3 at gene expression level by qPCR and investigate STAT3 phosphorylation levels by Western blot.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:12871..13048:sentences:c76bbffa778411c27b33396eb185c2ea	STAT3|SOCS3	STAT3|Socs3	Microglial cells treated with LPS showed increased amounts of STAT3 phosphorylation along with up-regulation of Socs3 expression levels compared to untreated cells (Appendix Fig.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:14688..15002:sentences:ee4eb625765b814bfac88811bf3d5f90	NOTCH4|CD14	NOTCH4|CD14	Although 3-4 markers used simultaneously did not allowed to clearly discriminate the "subset LPS" from the "main LPS" population, changes in the proportion of marker positive cells are in line with the scRNAseq data, as a smaller proportion of NOTCH4 positive cells was detected upon LPS treatment compared to CD14.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:17313..17411:sentences:6e38f9197333090b20cd13ed48f4a8ea	TUBB3|SLC17A7|RBFOX3	Tubb3|Vglut1|NeuN	Specifically, in addition to Tubb3, we included gene expression results for Vglut1 and NeuN in Fig.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:17606..17862:sentences:a1d307cc4df202d3c88e65820211c4bd	ITGAM|PTPRC|ITGAX|CCR2	CD11b|CD45|CD11c|CCR2	The absence of these cells needs to be shown.. Accordingly to the reviewer's suggestion, we further analysed the potential contamination of sorted CD11b + CD45 int microglia by monocytes (Ly6C+ and CCR2+ cells) or macrophages/dendritic cells (CD11c+ cells).
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:17864..17964:sentences:d30df7fb1d3209d61fde90ef859accd6	ITGAM|PTPRC|CCR2|ITGAX	CD11b|CD45|CCR2|CD11c	As expected, CD11b + CD45 int cells did not contain neither Ly6C+ CCR2+ cells, nor CD11c+ cells (Fig.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:18851..19058:sentences:2cfcae5cfe49f1be8e1fa92ac814c344	TMEM119|GPR34|TNF|IL1B	Tmem119|Gpr34|Tnf|Il-1	2A) . For adult and neonatal cultivated microglia in vitro, we maintained Tmem119 and Gpr34 as representative homeostatic genes and we added Il-1 and Tnf as inflammatory genes (these results are shown in Fig.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:20331..20520:sentences:07a0b7a004933be8f5814bbed1af7136	TMEM119|GPR34	Tmem119|Gpr34	Showing that the decrease of Tmem119, Gpr34, etc. is observed in pure populations of cultivated microglia with no contamination by other immune cells which do not express these markers (e.g.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:21455..21485:sentences:7c40b3a01e8f51634173844643ec1775	CCL2|P2RY12	Ccl2|P2ry12	Ccl2 and P2ry12) (Appendix Fig.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:26330..26493:sentences:ed0f9d352b1e23572c0864cc16aa6f86	TMEM119|P2RY12	TMEM119|P2RY12	Thus, as suggested, we performed flow cytometry analysis for TMEM119 and P2RY12 and compared their expression levels between steady state and LPS-induced microglia.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:26495..26652:sentences:720b8d84cabe560bb5fbae042ed813ee	TMEM119|P2RY12	TMEM119|P2RY12	In agreement with the transcriptional results, the protein levels of TMEM119 and P2RY12 were decreased under inflammatory conditions compared to steady state.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:28955..29094:sentences:343fc2a86de8a188189aea63dbed130a	SOCS3|STAT3	SOCS3|STAT3	5 .. In the discussion the authors suggest that changes in SOCS3-STAT3 signalling may control downregulation of microglia homeostatic genes.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:29376..29524:sentences:919c0990b15e222d5dceca59c48d317c	SOCS3|STAT3	Socs3|STAT3	We took advantage of primary cells to analyse Socs3 at gene expression level by qPCR and to investigate STAT3 phosphorylation levels by Western blot.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:29526..29703:sentences:1d0cc6161fee5a371799543381053fb8	STAT3|SOCS3	STAT3|Socs3	Microglial cells treated with LPS showed increased amounts of STAT3 phosphorylation along with up-regulation of Socs3 expression levels compared to untreated cells (Appendix Fig.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:37662..37752:sentences:ec65702fe7d08a3f0e2709848ed276b1	STAT3|STAT3|ACTB	STAT3|STAT3|Actin	STAT3 or p-STAT3 in the upper part pf the gel and Actin in the bottom part).. Minor points.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:41380..41517:sentences:a65462f1bd4ff2577c5bc2428785c8f3	NOTCH4|AIF1	NOTCH4|IBA1	Notably, we were able to show that NOTCH4 positive microglia (IBA1 positive cells) were evenly distributed across different brain regions.
+SARS:12666bbfb4382c1c684087fa6343d5c03cea8584:fulltext:1cfbfd045f2acf1f993ee82e91c2c880:44938..45075:sentences:4780423d160fdc963d87dce93b0dba1d	NOTCH4|AIF1	NOTCH4|IBA1	Notably, we were able to show that NOTCH4 positive microglia (IBA1 positive cells) were evenly distributed across different brain regions.
+SARS:131e6a035170ed5bd2dba6bec02649e9508a0c55:abstract:bc3d491b3bff18eea12da916344b3563:0..87:sentences:d22d69e68e1e72d9851b0f3686639683	PTEN|STAT3	PTEN|STAT3	PTEN is a tyrosine phosphatase with significant function in inhibiting STAT3 activation.
+SARS:131e6a035170ed5bd2dba6bec02649e9508a0c55:abstract:bc3d491b3bff18eea12da916344b3563:196..320:sentences:7d9a904058ffef8d28310757aaa3a5ad	PTEN|TP53	PTEN|p53	The expression of PTEN controlled by p53 regulates autoimmune arthritis through modulating the balance between Th17 and Treg.
+SARS:131e6a035170ed5bd2dba6bec02649e9508a0c55:abstract:bc3d491b3bff18eea12da916344b3563:322..448:sentences:cddee8548ea81169d5c3f8e060115a3a	PTEN|TP53|STAT3	PTEN|p53|STAT3	We hypothesized that PTEN regulated by p53 might reduce CIA severity and inflammatory response via inhibiting STAT3 activation.
+SARS:131e6a035170ed5bd2dba6bec02649e9508a0c55:abstract:bc3d491b3bff18eea12da916344b3563:450..583:sentences:e235faeedbd638a45a51267df12cb02c	PTEN|STAT3	PTEN|STAT3	Our results revealed that PTEN could ameliorate experimental autoimmune arthritis by reducing STAT3 activity and Th17 differentiation.
+SARS:131e6a035170ed5bd2dba6bec02649e9508a0c55:abstract:bc3d491b3bff18eea12da916344b3563:788..884:sentences:b593ff52e970ee60ed3be319d93664ee	PTEN|TP53|STAT3	PTEN|p53|STAT3	We observed that PTEN expression downregulated by p53 deficiency induced the activation of STAT3.
+SARS:131e6a035170ed5bd2dba6bec02649e9508a0c55:abstract:bc3d491b3bff18eea12da916344b3563:981..1112:sentences:3b24b80ce1cb3c823bd71dd923399df8	STAT3|PTEN	STAT3|PTEN	These data suggest that induction of STAT3-modulatory activity of PTEN may be a therapeutic target for rheumatoid arthritis therapy.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:5002..5279:sentences:e9f3ad5275a6e50f0b506e2a90f112c6	PARP1|PARP1|CASP8|TP53|TP53|BAX|POLDIP2|JUN|MAPK8	poly-ADP-ribose polymerase|PARP|caspase-8|p53|p53|Bax|p38|Jun|JNK	Cleaved caspase-3, cleaved poly-ADP-ribose polymerase (PARP), caspase-8, phosphorylated p53 (p-p53), Bax, phosphorylated p38 (p-p38), phosphorylated Jun-amino-terminal kinase (p-JNK), and -actin monoclone antibodies were supplied by Cell Signaling Technology (Danvers, MA, USA).
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:8123..8348:sentences:74ac4f83483aba81b080b7988b3d3464	PARP1|CASP8|TP53|BAX|	PARP|caspase-8|p53|Bax|p-JNK and -actin	Bands on polyvinylidene difluoride membranes were immunoblotted with primary antibodies, including cleaved caspase-3, cleaved PARP, caspase-8, p-p53, Bax, p-p38, p-JNK and -actin monoclone antibodies, and secondary antibodies.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:10556..10731:sentences:3d82aeac39ff796057f2336566691b8f	PARP1|TP53|MAPK8|POLDIP2	PARP|p53|p-JNK|p38	After quenching with 3% H 2 O 2 and blocking, the slices were incubated with cleaved caspase-3, cleaved PARP, p-p53, p-p38, and p-JNK antibodies, respectively, at 4C overnight.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:14283..14387:sentences:9dca5f04b465e0a3a6311331b67875d9	CASP3|PARP1	caspase-3|PARP	Activity of caspase-3 was detected, and expression of cleaved caspase-3 or cleaved PARP was investigated.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:14793..14929:sentences:5dd02d34da35bb2b78056202bace7b6c	CASP8|PARP1	caspase-8|PARP	In addition, expression of caspase-8 protein was decreased and that of cleaved caspase-3 and cleaved PARP increased after H1N1 infection.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:14991..15100:sentences:d4506f0588d9edc37accba7219634ff6	CASP8|CASP3|PARP1	caspase-8|caspase-3|PARP	These results suggested that Se@RBV inhibited apoptosis by regulating caspase-8, caspase-3, and PARP proteins.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:15139..15234:sentences:82d0a5fed30d5e6f3d95e60adee7ba84	CASP8|CASP3|CASP6|CASP7	caspase-8|caspase-3|caspase-6|caspase-7	Activated caspase-8 cleaves apoptosis executioners, such as caspase-3, caspase-6, and caspase-7.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:15433..15607:sentences:f92c324153b63000115b595c4548738d	CASP3|CASP8	caspase-3|caspase-8	43 It could be inferred that Se@RBV restrained the caspase-3-mediated apoptosis pathway by inhibiting the activation of caspase-8.. Inhibition of apoptosis signaling pathways.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:15918..16015:sentences:b3f83a2999483f351009de29fdd2117b	|CASP3	caspase|caspase-3	It enhances membrane permeability and helps the activation of caspase pathways, such as caspase-3.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:16294..16358:sentences:ed93f71b77465b54c04aabff592e424f	TP53|BCL2|BAX	p53|Bcl-2|Bax	Activated p53 affects apoptosis by regulating Bcl-2 and Bax gene.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:16360..16500:sentences:6b179b7537571002936441c92109efb0	BAX|TP53	Bax|p53	As an activator of transcription of Bax, p53 benefits the expression of the protein and promotes the apoptosis process after phosphorylation.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:16502..16625:sentences:4cccf59a6810205c3f90fa9af3eaa560	BAX|TP53	Bax|p53	45 The results suggested that Se@RBV might regulate the expression of Bax through attenuating the expression of p53 protein.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:16627..16826:sentences:30625ea98808a392c567298863683ce7	CASP8|BAX|CASP3	caspase-8|Bax|caspase-3	Meanwhile, Se@RBV restrained Figure 5B that both the regulation of caspase-8 and Bax resisted the activation of caspase-3 and inhibited apoptosis of cells.. Inhibition of apoptosis signaling pathways.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:16828..16888:sentences:7c653afe7bdc32d9efd85c831afca1bf	MAPK8|POLDIP2	JNK|p38	JNK and p38 signalings could be activated by virus infection.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:16890..16945:sentences:061e34865a1ddd55d95d9aad5f7aa5d8	MAPK8|POLDIP2	JNK|p38	46 Phosphorylation of JNK or p38 is a sign of apoptosis.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:17044..17233:sentences:ba1fcf40474ddf50244dfe1eb5e40bd7	MAPK8|POLDIP2	p-JNK|p38	As displayed in Figure 5A , expressions of p-JNK and p-p38 increased in cells infected by H1N1 virus without subsequent treatments, but evidently decreased followed by treatment with Se@RBV.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:17235..17345:sentences:7e95978092f9a8e1a1fb1f9cc1bcab74	POLDIP2|MAPK8	p38|JNK	The result reflected that p38 and JNK signaling pathways took part in the restriction of apoptosis with Se@RBV.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:18779..18917:sentences:66d847817b16b61588c7e06f56c1da0e	PARP1|TP53|MAPK8	PARP|p53|p-JNK	As exhibited in Figure 6C , cleaved caspase-3, cleaved PARP, p-p53, p-JNK, and p-p38 proteins were found positive for H1N1 virus infection.
+SARS:11af78fdd83655124c3b5acce4cfb92f0aafe4f6:fulltext:5338cddc915dd57da96dc5fb642c527d:18987..19172:sentences:2f8f64f95fd503ca7268f682f735da68	CASP3|TP53|MAPK8|POLDIP2	caspase-3|p53|JNK|p38	This result was coincident with the previous in vitro study in which caspase-3, p53, JNK, and p38 participated in the restriction against the H1N1 virus infection of Se@RBV.. Conclusion.
+SARS:131e6a035170ed5bd2dba6bec02649e9508a0c55:title:49714248951d36472e92b8ef39495cb7:0..119:sentences:eff3a68293088f7462be7191751feb1d	PTEN|STAT3	PTEN|STAT3	PTEN ameliorates autoimmune arthritis through down-regulating STAT3 activation with reciprocal balance of Th17 and Tregs
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:7344..8066:sentences:7b1e8ea01915d24369253746652cce3a	MAPK1|MKKS	MAPK|MKKs	The mitogen-activated protein kinase (MAPK) signaling cascade involves a hierarchy of kinases that activate one another through consecutive phosphorylation events in response to extracellular or intracellular signals [15] . Standard methods have only been able to establish a few combinatorial connections from upstream MKK-activating kinases (MKKKs) to downstream MPK-activating kinases (MKKs), MAPKs and their cytoplasmic and nuclear substrates [26, 27] . Constructing this complicated interconnected network necessitates a systematic unbiased high-throughput approach to avoid confounding issues of redundancy and functional pleiotropy [15] . Akin to the protein microarray based kinase assays developed by Ptacek et al.
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:8556..9301:sentences:cce6c6b87e2837f187cd5b3d05dc0144	MKKS|MAPK1	MKKs|MAPK	With this data the authors were able to reconstruct a complex signaling cascade involving nine MKKs, 10 MPKs and 570 substrates [15] . Moreover, the resulting nodes and edges highlighted the specificity conserved within these interactions: 290 (51%) of MPK phosphorylation targets were hit by only one MPK and only 94 (16%) were phosphorylated by two or more MPKs [15] . Gene ontology (GO) analysis of effector substrates showed enrichment in TFs involved in the regulation of development, defense and stress responses [15] . The network that emerged from this study suggests the MAPK signaling cascade regulates transcription through combinatorial enzyme specificity and discrete phosphorylation events.. Ubiquitin E3 ligase substrate discovery.
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:9303..9582:sentences:7748501a20e76aca9b9f21f8c2cc9419	|PTMS	E1, E2 and E3|PTMs	Ubiquitylation is one of the most widespread PTMs and mediates a huge range of cellular events and processes in eukaryotes [28] . Understanding ubiquitin substrate specificity is a complex combinatorial question, as it is conferred by unique permutations of E1, E2 and E3 enzymes.
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:9832..10295:sentences:85dd573937f78115fae405b408fcbc2e	SLA||NEDD4L	Sla1|Rnr2|Rsp5	Deeper in vivo characterization of two substrates, Sla1 and Rnr2, revealed that Rsp5dependent ubiquitylation affects either the posttranslational process of the substrate or subcellular localization [22] . This design offers the ability to dissect the molecular mechanisms of a complex enzymatic cascade and gives the field a tool to understand how the system is organized globally.. Identification of non-histone substrates of protein acetyltransferases in yeast.
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:12650..12782:sentences:3d902c53a1d4b1daa5de5d45bf403c20	GEMIN6|PRKAA2	Sip2|AMPK	investigated the impact of acetylation on another NuA4 substrate, Sip2, a regulatory subunit of the SNF1 kinase complex (yeast AMPK).
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:12784..13169:sentences:ebcf63fc3b341dcbee58b608ce64757e	GEMIN6|AKT1|RPS6KB1	Sip2|Akt|S6K	Based on the MS/MS analysis and site-directed mutagenesis studies, the authors found that Sip2 acetylation enhances its interaction with the catalytic subunit Snf1 and inhibits Snf1's kinase activity [31] . As a result, phosphorylation of one of Snf1's downstream targets, Sch9 (homolog of Akt/ S6K), is decreased, ultimately leading to slower growth but extended replicative life span.
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:13171..13320:sentences:a6bdce3fe6bbeb4c668bec18fb69d5f8	GEMIN6|CRTC1	Sip2|TORC1	Finally, the authors demonstrated that the anti-aging effect of Sip2 acetylation is independent of extrinsic nutrient availability and TORC1 activity.
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:23945..24208:sentences:9e609818df2fcab9eae522806f200484	KAT5|PPP2R4|XPA	TIP60|PP2A|replication protein A (RPA) and XPA	purified FLAG-tagged LANA and probed it against the human TF array, which recovered 61 candidate binding partners [36] . Eight candidates validated by co-immunoprecipitation assays included TIP60, protein phosphatase 2A (PP2A), replication protein A (RPA) and XPA.
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:24411..24684:sentences:9b62e1ed3b6bf8e18723789c7043b3c1	XPA|RPA1|RPA2	XPA|RPA1|RPA2	The binding interactions between LANA, RPA and XPA seem to echo LANA's role in DNA damage, but further characterization of the LANA's ability to bind to additional RPA complex members, RPA1 and RPA2, spawned a new hypothesis that LANA may also regulate host telomere length.
+SARS:12b90b3a09c938535dbf8db6af029cba7994e2cc:fulltext:8f3944b8989b6deccb1fad6959b1fc51:24686..25007:sentences:27011440d1ba38c77e04d149bb9eaa9d	RPA1|RPA2|RPA1|RPA2	RPA1|RPA2|RPA1|RPA2	To test this hypothesis, the authors performed ChIP assays with anti-RPA1 and -RPA2 antibodies using primers specific to the telomere regions and found that the presence of LANA drastically reduced the recruitment of both RPA1 and RPA2 to the host telomeres, while it had no impact on the protein level of the RPA complex.
+SARS:13531a593bf382e8e4f605622db4f7f2c6ef92a9:title:946066281baad6486e6f647ccdac27ff:0..86:sentences:c8da31b51eea24fdf3e2e110901c5222	SMOC1|RNASEL	OAS|RNase L	OAS-RNase L innate immune pathway mediates the cytotoxicity of a DNA-demethylating drug
+SARS:1376468233336bdd6a78aef7025bf0e82a4ecf09:abstract:1834218afbe7738645f331520ab864e7:627..823:sentences:846ef84071b261d8a0f52611d91d0762	STAT3|CDH1	STAT3|E-cadherin	Meanwhile, purified rIL-22 could activate STAT3 signal pathway and have been demonstrated to be safe to IPEC-J2 cells by increasing E-cadherin expression, without proinflammatory cytokines changes.
+SARS:137b25ee1545c4b01332709ab1e24dcf935d6f96:title:114bf9f186a65f2789fca61955c4b99f:0..170:sentences:200ccdf2ea16933003ef619ae7eb0b8c	MAPK14|TNF	p38|Kinase Activation and Tumor Necrosis Factor-Alpha	A Role for Protein Phosphatase 2A in Regulating p38 Mitogen Activated Protein Kinase Activation and Tumor Necrosis Factor-Alpha Expression during Influenza Virus Infection
+SARS:1376526470f18216200ecd6c375d9913942fa362:fulltext:0d8d6f898be6e76f71d04146bff14509:3485..3687:sentences:e417217dc2dee56d7ebeb1def775e368	|BRAF|NRAS	ORF1|NS7|NS6	Downstream of ORF1, PdCV contains six additional ORFs (ORF2 to ORF7) that code for the structural proteins spike (S), envelope (E), membrane (M), nonstructural protein 6 (NS6), nucleocapsid (N), and NS7.
+SARS:13531a593bf382e8e4f605622db4f7f2c6ef92a9:fulltext:2aa8b56b1a0d3215e3aaa489680bf24f:0..265:sentences:93e746247f7b0bcd72e522f4ebd68158	RNASEL|ADAR|ADAR|RNASEL|ADAR|RNASEL|PDE12|AKAP7|PDE12|AKAP7|MAVS	RNase L|ADAR1|ADAR1|RNase L|ADAR1|RNase L|PDE12|AKAP7|PDE12|AKAP7|MAVS	Construction of gene knockout cells.. The A549 RNase L KO, MAVS KO, ADAR1-MAVS DKO, ADAR1-RNase L DKO, and ADAR1-RNase L-MAVS TKO cells were described previously (1) . The PDE12 KO, AKAP7 KO, PDE12-AKAP7 DKO A549 cells were generated by using the CRISPR Cas9 system.
+SARS:13531a593bf382e8e4f605622db4f7f2c6ef92a9:fulltext:2aa8b56b1a0d3215e3aaa489680bf24f:969..1216:sentences:c8c2d2aa08d9e5346e1a3742fa7c1218	AKAP7|PDE12	AKAP7|PDE12	The AKAP7 sgRNA sequences are: sgAKAP7_2 FW CACCG TGAGC GACTG GCCAA AGCAA and sgAKAP7_2 REV AAACT TGCTT TGGCC AGTCG CTCA C. The PDE12 sgRNA sequences are: sgPDE12_10 FW CACCG GGATG CCTGG CAAGA CGGCG and sgPDE12_10 REV AAACC GCCGT CTTGC CAGGC ATCCC.
+SARS:13531a593bf382e8e4f605622db4f7f2c6ef92a9:fulltext:2aa8b56b1a0d3215e3aaa489680bf24f:1261..1425:sentences:db008da6a22931c2fa167ab2eac3a346	PDE12|AKAP7|PDE12|AKAP7	PDE12|AKAP7|PDE12|AKAP7	To obtain PDE12 and AKAP7 DKO cells, a PDE12 knockout A549 cell line was infected with pseudo lentivirus expressing sgRNA for AKAP7, followed by single cell cloning.
+SARS:13531a593bf382e8e4f605622db4f7f2c6ef92a9:fulltext:2aa8b56b1a0d3215e3aaa489680bf24f:1508..1745:sentences:5772648f0af32dfdc7fe6f3d5c1f9af1	OAS1|RNASEL	OAS1|RNase L	Single OAS1,2,3 KO HME cell lines were reported by us previously (1) , and RNase L KO HME cells and HME DKO and TKO cell lines were made by CRISPR Cas9 gene editing as described (1) .. Construction of gene knockout cells.. Immunoblotting.
+SARS:13531a593bf382e8e4f605622db4f7f2c6ef92a9:fulltext:2aa8b56b1a0d3215e3aaa489680bf24f:2406..2677:sentences:a105acb15a659a8def459a6d182fa205	MAVS|ADAR|PARP1	MAVS|ADAR1|PARP1	Antibodies were against MAVS(Cat#3993S) (1:1000 dilution) and ADAR1(Cat#14175) 1:2000 dilution) (from Cell Signaling Technology), cleaved PARP1(Cat#9541S) (1:1000 dilution) (Cell Signaling Technology), Flag M2(1:5000 dilution) and actin(1:50,000 dilution) (Sigma-Aldrich).
+SARS:13531a593bf382e8e4f605622db4f7f2c6ef92a9:fulltext:2aa8b56b1a0d3215e3aaa489680bf24f:2759..2861:sentences:d972c525b515a5bec2a318dfdb928fd9	OAS1|OAS2|OAS3	OAS1|OAS2|OAS3	OAS1 (Cat# sc-374656), OAS2 (Cat#sc-99097) and OAS3 (Cat# sc-49870) were from Santa Cruz Biotechnology.
+SARS:13531a593bf382e8e4f605622db4f7f2c6ef92a9:fulltext:2aa8b56b1a0d3215e3aaa489680bf24f:2863..3084:sentences:25a0f4a1e340c8ce22547f9e8ec3c240	PDE12|AKAP7	PDE12|AKAP7	Anti-PDE12 (Abcam ab87738)(1:1000 dilution) and anti-AKAP7 (Proteintech: Cat# 12591-1-AP)(1:5000 dilution) were used to screen for knockouts of the respective genes.. Construction of gene knockout cells.. Cell death assay.
+SARS:137b25ee1545c4b01332709ab1e24dcf935d6f96:abstract:c9be7f65b21557c7d1d8462962fd31bc:345..479:sentences:c51358faa05a0840546d05f1eb0836ef	MAPK14|TNF	p38MAPK|TNF-alpha	However, the detailed mechanisms of p38MAPK activation and TNF-alpha hyperinduction following influenza virus infections are not known.
+SARS:137b25ee1545c4b01332709ab1e24dcf935d6f96:abstract:c9be7f65b21557c7d1d8462962fd31bc:756..1051:sentences:1b801b5e7caf5c75b51f854464504c48	DUSP1|PPP2R4|MAPK14|TNF|PRB3	MKP-1|PP2A|p38MAPK|TNF-alpha|H9N2/G1	We investigated the roles of protein phosphatases including MAPK phosphatase-1 (MKP-1) and protein phosphatase type 2A (PP2A) in modulating p38MAPK activation and downstream TNF-alpha expressions in primary human monocyte-derived macrophages (PBMac) infected with H9N2/G1 or H1N1 influenza virus.
+SARS:137b25ee1545c4b01332709ab1e24dcf935d6f96:abstract:c9be7f65b21557c7d1d8462962fd31bc:1053..1181:sentences:b2ab2c32dcac7fe6968ed6df7799cf3b	MAPK14|TNF|PRB3	p38MAPK|TNF-alpha|H9N2/G1	We demonstrate that H9N2/G1 virus activated p38MAPK and hyperinduced TNF-alpha production in PBMac when compared with H1N1 virus.
+SARS:137b25ee1545c4b01332709ab1e24dcf935d6f96:abstract:c9be7f65b21557c7d1d8462962fd31bc:1183..1372:sentences:60abb7716eecdc258b46092281cba6c7	PPP2R4|PPP2R4|MAPK14|TNF|PRB3	PP2A|PP2A|p38MAPK|TNF-alpha|H9N2/G1	H9N2/G1 induced PP2A activity in PBMac and, with the treatment of a PP2A inhibitor, p38MAPK phosphorylation and TNF-alpha production were further increased in the virus-infected macrophages.
+SARS:137b25ee1545c4b01332709ab1e24dcf935d6f96:abstract:c9be7f65b21557c7d1d8462962fd31bc:1374..1518:sentences:c5f27ca3a1e8644401a73c378fc3461f	PRB3|PPP2R4|PPP2R4|MAPK14	H9N2/G1|PP2A|PP2A|p38MAPK	However, H9N2/G1 did not induce the expression of PP2A indicating that the activation of PP2A is not mediated by p38MAPK in virus-infected PBMac.
+SARS:137b25ee1545c4b01332709ab1e24dcf935d6f96:abstract:c9be7f65b21557c7d1d8462962fd31bc:1520..1686:sentences:67e98bac8e1fa742425a14607941e1a0	PPP2R4|MAPK14|PPP2R4|PRB3	PP2A|p38MAPK|PP2A|H9N2/G1	On the other hand, PP2A may not be the targets of H9N2/G1 in the upstream of p38MAPK signaling pathways since H1N1 also induced PP2A activation in primary macrophages.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:2195..3308:sentences:bf52bc4ef144e34eca9526c2fafaa0ce	ANK1|MTOR|B2M	ankyrin|FRAP|B2-m	This result raised the question of whether restrictions to lateral diffusion within the plane of the membrane or interdomain fences play a significant role in the maintenance of epithelial surface polarity.. . Recent work has highlighted the role of specific protein-protein interactions in the retention of markers characteristic of the endoplasmic reticulum and Golgi apparatus (39, 53) , raising the possibility that specific retention of membrane proteins at their correct domain may play a significant role in sorting mechanisms (62) . Furthermore, components of the erythroid submembrane cytoskeleton, spectrin and ankyrin, which restrict the lateral mobility of red cell membrane proteins (5, 9) , have been recently described in association with the basolateral surface of kidney tubules and MDCK cells (19, 48) . In this work, we have 1. Abbreviations used in this paper: B2-m, beta-2-microglobulin; EB, extraction buffer; FRAP, fluorescence recovery after photobleaching; PFA, paraformaldehyde; TIE totally immobile fraction (percent of spots with no recovery after photobleaching); TX-100, Triton X-100.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:14076..14179:sentences:a237a64cd4bf40a744365ccb1b30336a	|RBM6	B1 and B2|3G2	The other two react with basolateral proteins ($2/3G2 and $7/5G23) and will be referred to as B1 and B2.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:14960..15210:sentences:3ec29ad7414ef255230d26eedc9a0fe2	NUP62|UBE2B	p62|E2 protein	On the other hand, mutants in the p62/E2 protein, an integral membrane protein of Semliki Forest virus have been shown to be an exception to the high pH criterion (15) .. Plasma Membrane Proteins of MDCK Cells Show Differential Extractions in TX-I O0.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:24582..25023:sentences:b52bee968658294d4946f35bae8cf8ad	|MS4A1|B2M	B1 and B2|B1 and B2|B2-m	Levels of B1 and B2 extractability were 50% in the apical surface and '~16% in the lateral surface (Table II, E) . The other basolateral marker, B2-m, exhibited a similar pattern of extraction; like B2, it showed intermediate levels of extraction from the basal surface; like B1 and B2, the maximum insolubility in TX-100 was observed on the lateral surface.. Plasma Membrane Proteins Are Preferentially Extracted from the "Incorrect" Domain.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:27003..27702:sentences:b21403e89cfd2375db122f46316af706	ANK1|MS4A1	ankyrin|B1 and B2	Recently, Nelson and Veshnock (48, 49) have shown that the development of an insoluble fodrin network on the basolateral membrane correlates with the polarization of the basolateral marker Na+-K + ATPase which forms a stable complex with ankyrin and fodrin (50) . We found that destabilization of this network by 4 mM DTT significantly facilitated extraction of B1, but not A1 (Table HI) . Thus, this result and the detergent extractability of B1 and B2 in cells prevented from forming cell-cell contacts, are compatible with a basolateral fodrin cytoskeleton (4, 73) anchoring B1 but not A1.. Immobile Fractions of Basolateral Antigens Are Larger in the Basolateral Domain than in the Apical Domain.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:27704..28000:sentences:6860987c30d3bf859bf49a3166d62e6b	MTOR|TYRO3	FRAP|TIF	FRAP reports on the diffusion coefficient, D, of a labeled molecule of interest, on the fraction of label in a region of the cell that can diffuse at all, and on the fraction of cells in a population in which no diffusion can be measured (hereafter referred to as totally immobile fraction [TIF]).
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:28002..28099:sentences:9f43e84b9dc9c729886cbedbe3249042	FANCB|ATP6V0A2|MTOR	Fab|A2 and B1|FRAP	We used FRAP to determine all of these parameters for fluorescent Fab fragments of A2 and B1 mAbs.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:28534..28718:sentences:75d9ea4b5e27c752874783a38f9e77ea	FANCB|B2M	Fab|B2-m	Fluorescent Fab fragments or B2-m were added to either the apical or the basal side of the monolayers to study the mobility of the antigen in the apical and in the basolateral membrane.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:33157..33490:sentences:e889d9e5cb98eebe7e844815f6ab019a	FANCB|TYRO3|B2M	Fab|TIF|B1 and B2-m	A2 fluorescence recovered in all cells labeled with Fab (TIF = 0; Table IV) . On the other hand, B1 and B2-m showed 28 and 52% of the cells, respectively, failing to recover any fluorescence at all on the basolateral membrane.. Immobile Fractions of Basolateral Antigens Are Larger in the Basolateral Domain than in the Apical Domain.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:33492..34152:sentences:82783964d5edbb06c17ca8127c987d16	TYRO3|MTOR|TYRO3|B2M	TIF|FRAP|TIF|B2-m	Corresponding TIF values on the apical membrane were significantly lower (0-8%; Table IV) . Therefore, when FRAP is measured with monovalent probes, TIF correlates roughly with the TX-100 insolubility of A2, B1, and B2-m from the basal, lateral, and apical domains (Tables II and  IV) . Altogether, these data are compatible with a model consisting of (a) highly mobile fractions for all the antigens, the size of which does not correlate with the degree of polarity, and (b) domain specific cytoskeleton anchored fractions for B1, B2, B2-m, and A1, but not for A2.. Four MDCK Plasma Membrane Proteins Are Selectively Unextractable in a Domain-specific Fashion.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:36648..37233:sentences:fdfb4479433f827fcc91971bb3cf7d59	ANK1|	ankyrin|B1 and B2	They have also presented evidence for a specific interaction between a basolateral marker of MDCK cells, Na+-K  ATPase, and ankyrin (50), a protein known to form complexes with spectrin in the red cell (5, 9) . In this work, we have shown that the extractability of B1 and B2 is modified by conditions that affect the stability of the fodrin network (Table III) . Thus, in combination with Nelson and Veshnock's results, our data suggest that the polarization of several basolateral markers is linked to the formation of a basolateral fodrin network, with which they appear to interact.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:41385..41473:sentences:5fddb606283abd17884abeb40c39ac96	MTOR|FANCB|FANCB|B2M	FRAP|Fab|Fab|B2-m	We could use only three monovalent probes in FRAP measurements: B1 Fab, B2-m, and A2 Fab.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:41915..42148:sentences:d9ca53bc454299021a5e0fe8f3521701	MTOR|MS4A1	FRAP|B1 and B2	Significant amounts of B1 and B2 are still present in the apical (incorrect) domain 24 h after plating and are amenable for FRAP measurements, while A2 is already polarized and cannot be detected in the basolateral (incorrect) domain.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:43224..43472:sentences:7a32e50598040e364f50b946f42e279c	|TYRO3	B1 and B2|TIF	This basolateral marker of MDCK cells shows similar kinetics of polarization and similar dependence on intercellular contacts as our B1 and B2 markers (48, 74) .. Correlation between TIF and Detergent-unextractable Fractions of Basolateral Antigens.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:44296..44627:sentences:aa552bec61ebe9648c2f518e701f25af	TYRO3|B2M	TIF|B2-m	For example, 48 + 30% of B2-m is extractable from the basal domain of cells plated at confluency for 24 h. With this standard deviation, 16% of cells must have <18 % extractable, and if this correlates with mobility, these cells would certainly be scored in the TIE No cells had TIF for A2, which was completely extracted by TX-100.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:44629..44849:sentences:83e104f60d3ea05266cf1b90e1a6cd13	TYRO3||TYRO3	TIF|B1 and B2-m|TIF	On the other hand, 30-52% of the cells showed TIF for B1 and B2-m in the basolateral membrane (where they are poorly extractable), while only 0-8 % showed TIF on the apical membrane (where their extractability is higher).
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:44851..45178:sentences:c8380c36bb0d43212cdef2353f9b8ded	MTOR|TYRO3	FRAP|TIF	Like the extraction experiments, the FRAP data are consistent with the existence of domain-specific interactions of basolateral antigens with the submembrane cytoskeleton, and mobile fractions present in both apical and basolateral domains.. Correlation between TIF and Detergent-unextractable Fractions of Basolateral Antigens.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:47498..47865:sentences:797769ebac028df7a11c5d2cf3c8dba7	|ANK1|ANK1	Na-K + ATPase|ankyrin|ankyrin	On the other hand, it has been shown that the Na-K + ATPase/ankyrin/spectrin complex can be formed in vitro, with molecules in solution (50) . Therefore, we cannot rule out the possibility that freely diffusive plasma membrane proteins located within the spaces of the fodrin network may bind to ankyrin/spectrin sites during the course of the Triton X-100 extraction.
+SARS:13cc84dcf620af030f92f4240637ba43a84004e9:fulltext:bb0108e77b8e4a0e399343d92af69bdf:48048..48415:sentences:3a83c69575a8969de6172b2723636ea5	MTOR|TYRO3	FRAP|TIF	Even under this model that explains FRAP and detergent extraction together, the data presented in this work indicates that epithelial cells have a specialized submembrane cytoskeleton capable of immobilizing subpopulations of plasma membrane proteins in a domain-specific fashion.. Correlation between TIF and Detergent-unextractable Fractions of Basolateral Antigens.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:abstract:e591bb5dcd0dd057dd0a8a610f7652d9:365..534:sentences:2d3c42193c217111b8f14acc9d83a58c	TNF|IFNG|IL1B|IL1A|IRF6	TNF- alpha|interferon gamma (IFN-gamma|interleukin 1 beta|IL-1 beta|LPS	We have recently demonstrated TNF- alpha expression from astrocytes induced by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), and interleukin 1 beta (IL-1 beta).
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:abstract:e591bb5dcd0dd057dd0a8a610f7652d9:536..665:sentences:c4add0543dba5f3988c552b56c0990c8	TNF|IFNG|TNF|IRF6|IRF6	TNF-alpha|IFN-gamma|TNF-alpha|LPS|LPS	Astrocytes secrete TNF-alpha in response to LPS alone, and can be primed by IFN-gamma to enhance LPS-induced TNF-alpha production.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:abstract:e591bb5dcd0dd057dd0a8a610f7652d9:667..879:sentences:cde1b6232be16ed62b6d012d8c89a03e	IFNG|IL1A|TNF|TNF	IFN- gamma|IL-1 beta|TNF-alpha|TNF-alpha	IFN- gamma and IL-1 beta, cytokines known to be present in the CNS during neurological disease states, do not induce TNF-alpha production alone, but act synergistically to stimulate astrocyte TNF-alpha expression.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:abstract:e591bb5dcd0dd057dd0a8a610f7652d9:1168..1433:sentences:1b90abf850fb46b62bb35618f73330ef	TNF|IFNG|TNF|TNF|IFNG|IL1A|IRF6|IRF6	TNF- alpha|IFN-gamma|TNF-alpha|TNF-alpha|IFN-gamma|IL-1 beta|LPS|LPS	Astrocytes from BN rats express TNF- alpha mRNA and protein in response to LPS alone, yet IFN-gamma does not significantly enhance LPS-induced TNF-alpha expression, nor do they express appreciable TNF-alpha in response to the combined stimuli of IFN-gamma/IL-1 beta.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:abstract:e591bb5dcd0dd057dd0a8a610f7652d9:1435..1648:sentences:11d6b6dfa97f8fabcd3f31b1c061c4ff	TNF|IFNG|TNF|IRF6	TNF-alpha|IFN-gamma|TNF-alpha|LPS	In contrast, astrocytes from Lewis rats express low levels of TNF-alpha mRNA and protein in response to LPS, and are extremely responsive to the priming effect of IFN-gamma for subsequent TNF-alpha gene expression.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:abstract:e591bb5dcd0dd057dd0a8a610f7652d9:1650..1725:sentences:bdc11ee4eea20408ae5b8f64c039cf5b	TNF|IFNG|IL1A	TNF-alpha|IFN-gamma|IL-1 beta	Also, Lewis astrocytes produce TNF-alpha in response to IFN-gamma/IL-1 beta.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:abstract:e591bb5dcd0dd057dd0a8a610f7652d9:1963..2100:sentences:30c238b911c98e636427aaf71c13cf8e	IL6|IFNG|IL1A|IRF6	IL-6|IFN-gamma|IL-1 beta|LPS	Furthermore, Lewis and BN astrocytes produce another cytokine, IL-6, in response to LPS, IFN-gamma, and IL-1 beta in a comparable fashion.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:abstract:e591bb5dcd0dd057dd0a8a610f7652d9:2102..2354:sentences:830d7c790e6d739bfd39a683961db3a7	IFNG|TNF|TNF|IRF6	IFN-gamma|TNF- alpha|TNF-alpha|LPS	Peritoneal macrophages and neonatal microglia from Lewis and BN rats are responsive to both LPS and IFN-gamma priming signals for subsequent TNF- alpha production, suggesting that differential TNF-alpha expression by the astrocyte is cell type specific.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:abstract:e591bb5dcd0dd057dd0a8a610f7652d9:2356..2586:sentences:de9f7eed3cb50468e8b51642d53d1669	TNF|IFNG|IRF6	TNF-alpha|IFN-gamma|LPS	Taken together, these results suggest that differential TNF-alpha gene expression in response to LPS and IFN-gamma is strain and cell specific, and reflects both transcriptional and post-transcriptional control mechanisms.(ABSTRACT
+SARS:131af5ab50551638e3ce9a8c615b9b4364f2f34e:fulltext:b4ef0829edde31e6f93c026d62b24cae:2093..2389:sentences:eb2792c3cfb4c93af7a7f1d57def903a	ASZ1|FPR2	ORF3|RFP	In this study, we generated the first infectious cDNA clone of a virulent North American PEDV strain, PC22A (25) . Parental genomic and ORF3 deletion recombinant viruses were generated using the infectious cDNA clone system; the latter was also engineered to express red fluorescent protein (RFP).
+SARS:131af5ab50551638e3ce9a8c615b9b4364f2f34e:fulltext:b4ef0829edde31e6f93c026d62b24cae:4283..4900:sentences:a44423d63d22c0c880ed764d73991253	ASZ1|ASZ1|FPR2	ORF3|ORF3|RFP	The PEDV A fragment contains a T7 start site, whereas the F fragment terminates in 22 A residues, allowing for in vitro transcription and capping of a polyadenylated full-length transcript.. Design of an infectious PEDV clone.. PEDV-ORF3 is an accessory ORF encoding a putative ion channel protein that is oftentimes deleted from some natural isolates or following in vitro passage, suggesting that it encodes nonessential functions in vitro and/or in vivo (24) . To generate a fluorescently marked PEDV genome mutant, ORF3 in the PEDV F fragment was replaced with red fluorescent protein (RFP), named tomato-red (Fig.
+SARS:131af5ab50551638e3ce9a8c615b9b4364f2f34e:fulltext:b4ef0829edde31e6f93c026d62b24cae:6688..6854:sentences:9b52174fc2f5b8a6d4d911d25eff5820	ASZ1|FPR2	ORF3|RFP	At 48 and 72 h postelectroporation with icPEDV-ORF3-RFP, fluorescent red cells were seen in cell culture, both within individual cells and within larger syncytia (Fig.
+SARS:131af5ab50551638e3ce9a8c615b9b4364f2f34e:fulltext:b4ef0829edde31e6f93c026d62b24cae:9811..10207:sentences:02fbbadd859c5db0c7b6603ab37e9648	ASZ1|FPR2	ORF3|RFP	The pathogenesis of icPEDV in Gn pigs also replicated the pathogenic phenotype of PEDV strain PC21A, which had been collected from the same swine farm on the same day as PC22A (4) .. Design of an infectious PEDV clone.. Histopathological examination showed severe villous atrophy in PEDV PC22A-and icPEDV-inoculated pigs and moderate-tosevere villous atrophy in icPEDV-ORF3-RFP-infected pigs (Fig.
+SARS:131af5ab50551638e3ce9a8c615b9b4364f2f34e:fulltext:b4ef0829edde31e6f93c026d62b24cae:21412..21582:sentences:67e359fee955d5672408ba9e507650d7	ASZ1|FPR2	ORF3|RFP	All animals succumbed to illness or were euthanized due to illness at their final time points (PEDV, 1 dpi; icPEDV, 4 dpi; icPEDV-ORF3-RFP, 7 dpi; contact control, 4 dpi).
+SARS:131af5ab50551638e3ce9a8c615b9b4364f2f34e:fulltext:b4ef0829edde31e6f93c026d62b24cae:22131..22427:sentences:7eccfa3c3c45018bec6412decb4c9a2b	ASZ1|FPR2	ORF3|RFP	icPEDV  2  5  0  3  3  1  3  4  2  3  3  1  4  5  1  3  2  2  5  5  1  3  2  1  icPEDV-ORF3-RFP 6  2  0  1  1  0  7  7  1  2  3  0  8  3  0  2 2 0 a The IHC signal of PEDV antigen was scored as 0 to 3 according to the percentage of villous enterocytes within the section showing a positive signal.
+SARS:131af5ab50551638e3ce9a8c615b9b4364f2f34e:fulltext:b4ef0829edde31e6f93c026d62b24cae:25446..25778:sentences:478a68e0cfa07c51808efbbd23a8e782	SP6|ASZ1|FPR2	SP6|ORF3|RFP	In addition, SP6 PEDV-N gene transcripts were generated from the PCR-purified PEDV-N gene sample using a 4:1 ratio of cap to GTP (Ambion).. Viruses and cells.. To generate the ORF3 deletion RFP construct, the tdTomato gene was amplified by PCR with flanking PEDV sequence and then inserted using native restriction sites into PEDV-F.
+SARS:131af5ab50551638e3ce9a8c615b9b4364f2f34e:fulltext:b4ef0829edde31e6f93c026d62b24cae:25780..25915:sentences:442b75e5e4fb5388a3ec52b141ca34b5	ASZ1|FPR2|ASZ1|FPR2|ASZ1	ORF3|RFP|ORF3|RFP|ORF3	PEDV-F-ORF3-RFP was cultured and sequenced to ensure seamless replacement of ORF3 with RFP containing the ORF3 TRS.. Viruses and cells..
+SARS:131af5ab50551638e3ce9a8c615b9b4364f2f34e:fulltext:b4ef0829edde31e6f93c026d62b24cae:28745..29241:sentences:ea35f25e1d6c68109e54bfd69beec637	ASZ1|FPR2|FPR2	ORF3|RFP|RFP	Four groups of 2-to 3-week-old gnotobiotic (Gn) pigs were used to examine the replication and pathogenesis of icPEDVand icPEDV-ORF3-RFP-derived viruses in vivo and compared with PC22A-and mock-infected positive and negative controls, respectively (Table 1) . Piglets were orally inoculated with 2 ml of icPEDV or icPEDV-ORF3-RFP culture supernatants after transfection (P0) (1.0  10 2 PFU/ml) or with the tissue culture-adapted PC22A strain at passage level 3 (P3) at a dose of 5.8 log 10 PFU/pig.
+SARS:13f055e666f5a05c1f18856409f9b8f4ac4ae4ce:fulltext:c67ca8c70ae8a615f426e49c9d4c0d91:2117..2254:sentences:ec2bba68d3ad6ced5b9a1c925402e742	CLEC4G|CD44	LSECtin|CD44	2008) . Studies in mice indicate that mouse LSECtin is able to bind T cells through glycans on the CD44 T-cell surface marker (Tang et al.
+SARS:13f055e666f5a05c1f18856409f9b8f4ac4ae4ce:fulltext:c67ca8c70ae8a615f426e49c9d4c0d91:9889..10412:sentences:8f90d6130f782815e3487b4af3b129fd	CLEC4G|MCOLN1|MCOLN1|CLEC4G	LSECtin|mL 1|mL 1|LSECtin	2008) . A direct binding assay confirmed that human and mouse LSECtin interact with the Ebola glycoprotein-Fc fusion protein with very similar affinities of 0.52 g mL 1 for the mouse protein and 0.48 g mL 1 for the human protein ( Figure 5 ). This result provides important evidence that the mouse protein is a potentially useful model for human Ebola virus interaction with human sinusoidal endothelial cells.. Human and mouse LSECtin binding to Ebola virus glycoprotein and characterization of simple sugars as inhibitors.
+SARS:13f055e666f5a05c1f18856409f9b8f4ac4ae4ce:fulltext:c67ca8c70ae8a615f426e49c9d4c0d91:12111..12303:sentences:fe67a51543be8e58ab094847b17c024f	CD44|CLEC4G	CD44|LSECtin	2008) . In this scenario, the binding of endogenous ligands, such as CD44 on T cells, would be the primary function of LSECtin, which has been hijacked by certain pathogens such as Ebola virus.
+SARS:13f055e666f5a05c1f18856409f9b8f4ac4ae4ce:fulltext:c67ca8c70ae8a615f426e49c9d4c0d91:15757..15891:sentences:fddea9f771bfa329fd6365bd8db9aff8	CLEC4G|MCOLN1	LSECtin|mL 1	The CRD of LSECtin was expressed in Escherichia coli strain BL21(DE3) grown in the Luria-Bertani broth containing 50 g mL 1 ampicillin.
+SARS:13f055e666f5a05c1f18856409f9b8f4ac4ae4ce:fulltext:c67ca8c70ae8a615f426e49c9d4c0d91:18905..19139:sentences:8fba5f7b826fb5b8adeac21ef6b50700	CLEC4G|MCOLN1	LSECtin|mL 1	For competition binding assays and pH-dependence assays, polystyrene wells coated with CRD from LSECtin at a concentration of 50 g mL 1 were probed with 125 I-labeled mannose-BSA or Ebola glycoprotein-Fc fusion protein (Mitchell et al.
+SARS:13bf9fe0df944c0ee0debb0d445527ad4418cc19:abstract:98849cad02bb0b7133a4edaedd1014c1:881..1043:sentences:155f015b46c465c4a38416347d90665c	CASD1|CASD1|SIAE|SIAE	O-acetyltransferase|CasD1|sialate O-acetylesterase|SIAE	We knocked out and over-expressed the sialate O-acetyltransferase gene (CasD1), and knocked out the sialate O-acetylesterase gene (SIAE) using CRISPR/Cas9 editing.
+SARS:13bf9fe0df944c0ee0debb0d445527ad4418cc19:abstract:98849cad02bb0b7133a4edaedd1014c1:1139..1357:sentences:213206ab4e12da578700f595dd1f8d54	CASD1|SIAE	CasD1|SIAE	However, over-expression of CasD1 and knockout of SIAE gave only modest increases in 9-O-acetyl levels in cells and no change in 7,9-O-acetyl levels, indicating that there are complex regulations of these modifications.
+SARS:14df48701b672ec768ed4fe436e82b69370520a2:abstract:432c425436c2057f74ce373ba40d47d5:1654..1831:sentences:b78e051e5e359e5058892ece14b6166f	FGL2|CD8A|CD4	FGL2|CD8|CD4	FGL2 was positively correlated with the infiltration of immune cells, including dendritic cells, CD8(+) T cells, macrophages, B cells, and CD4(+) T cells, in lung adenocarcinoma.
+SARS:14df48701b672ec768ed4fe436e82b69370520a2:abstract:432c425436c2057f74ce373ba40d47d5:1833..2007:sentences:df8c0acbd761ae5a208776f580ec9fb5	FGL2|CD8A	FGL2|CD8	Functional enrichment analyses also showed that a high expression level of FGL2 was positively correlated with enhanced T cell activities, especially CD8(+) T cell activation.
+SARS:148a0ab3b9bb851a56bbe926abed11c0d71fc61c:fulltext:8531a17067c2d7080cabba7d5b2f85b2:21573..21879:sentences:45c54b39dd8246bfe37a303dd4a48838	GHRL|LEP	ghrelin|leptin	49, 51 The effect of natural milk may depend on several factors such as hormones (eg, ghrelin, leptin), cytokines and other immunostimulants and growth factors (eg, epidermal growth factor, granulocyte colonystimulating factor), which all contribute to the development of the gastrointestinal immune system.
+SARS:14f66845d5028f06204e3bc528e14e7dddd5b341:fulltext:405e5e0826c356191fed016d7778aea2:2684..2921:sentences:169bfc9a861b4a9cc9bde07f3d45f872	IVNS1ABP|RAF1|KRAS	NS1|NS5|NS3	The polyprotein is processed co-and post-translationally into three structural proteins: capsid (C), premembrane (prM)/ membrane (M), and envelope (E), and also seven nonstructural (NS) proteins: NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5.
+SARS:150ea625d9915430b5562742d16fd2f0c934353b:abstract:07b6113034ff2f0bc508ba8a0d8ced40:1467..1714:sentences:da0ebd66d55c7f511e3e152705eea29d	STXBP1|HSPA8|HSPA8	Munc18-1|Hsc70|Hsc70	We have characterized the ubiquitination of two identified proteins, Munc18-1 and Hsc70, and their interaction with Hrs UIM and provided functional evidence supporting a role for Hsc70 in regulation of Hrs-mediated endosome-to-lysosome trafficking.
+SARS:1516a62bffb7478ad5cbec0bde15290baf5384a3:abstract:7ff9725b187cc76735269fa39a3f4247:179..362:sentences:ce087493c27defaa93130b6043563834	HMGB1|HMGB1|GAL	HMGB1|HMGB1|GalN	In the present study, we explored inflammation-promoting activity of HMGB1 and blockade of extracellular release of HMGB1 by glycyrrhizin (GL) in LPS/GalN-triggered mouse liver injury.
+SARS:1516a62bffb7478ad5cbec0bde15290baf5384a3:abstract:7ff9725b187cc76735269fa39a3f4247:364..511:sentences:a5398d85e8e35869293f5635f813589f	GAL|HMGB1	GalN|HMGB1	At 1 to 10 h after LPS/GalN-treatment, mice were anesthetized to collect blood from heart puncture, and serum transaminase and HMGB1 were evaluated.
+SARS:1516a62bffb7478ad5cbec0bde15290baf5384a3:abstract:7ff9725b187cc76735269fa39a3f4247:513..630:sentences:cea714942148b8a9678341d07e4f7615	GAL|HMGB1	GalN|HMGB1	Administration of LPS/GalN precipitated tissue injury associated with time-dependent alteration in HMGB1 serum levels.
+SARS:1516a62bffb7478ad5cbec0bde15290baf5384a3:abstract:7ff9725b187cc76735269fa39a3f4247:777..990:sentences:8b07824ea4de4521cdb8d6901711d6d9	SLC17A5|HMGB1|HMGB1	AST|HMGB1|HMGB1	The treatment with GL significantly down-regulated the serum levels of ALT, AST, and HMGB1 in addition to the strong inhibition of tissue injury and extracellular immunoreactivity to HMGB1 and to acetylated-lysine.
+SARS:1516a62bffb7478ad5cbec0bde15290baf5384a3:abstract:7ff9725b187cc76735269fa39a3f4247:1235..1399:sentences:e4557b0bfe977b4f6bccc4e2796d0e22	HMGB1|GSTO1|GAL|HMGB1	HMGB1|Gsto1|GalN|HMGB1	The ChIP-assay revealed the binding of HMGB1 protein to Gsto1 promoter sequence in LPS/GalN-treated mice and the remarkable decrease in combined HMGB1 protein by GL.
+SARS:1516a62bffb7478ad5cbec0bde15290baf5384a3:abstract:7ff9725b187cc76735269fa39a3f4247:1401..1746:sentences:1464157a87636632b8ac2b654bbccfb8	GAL|HMGB1|GSTO1|GAL|HMGB1|GSTO1	GalN|HMGB1|Gsto1|GalN|HMGB1|Gsto1	The current findings claim that a single injection of LPS/GalN might stimulate apoptosis of hepatocytes through the binding of HMGB1 protein to Gsto1 promoter region and that GL-treatment might prevent the apoptosis and inflammatory infiltrates caused with LPS/GalN-injection by disturbing the binding of HMGB1 protein to Gsto1 promoter sequence.
+SARS:151b29e4b482ad11ee11e83cec4f3faebb8124c5:abstract:483c90cc586fbb121c4c91adc61ab44f:100..438:sentences:4fa08216d8d820aa47ca4184682ab2dc	TFRC|TFRC|TF|TF	transferrin receptor|TfR|transferrin|transferrin	To better understand the cellular and molecular mechanisms by which receptor cross-linking affects the intracellular trafficking of both ligand and receptor, we studied the intracellular trafficking of the transferrin receptor (TfR) bound to multivalent-transferrin (Tf10) which was prepared by chemical cross- linking of transferrin (Tf).
+SARS:14c9ca5bf096d03bde8e8ffe88c7419ef5b79b13:fulltext:d4e627c29a631093321cdb2486728678:16940..17042:sentences:459382e7bc054dfd3836e70448bd7ffd	IL5|NRG1	EDF|NDF	Three filters (LEF, EDF and NDF) discard further slippery sites based on the candidates' energy values.
+SARS:13bcbfda70f3fae9fc63e5a041e4f3dba700b95c:fulltext:d169276120f7b157b64dd96e4151f5de:3121..3488:sentences:ed49468fe770a90f5a36e99f384e7c64	RHO|CDC42|RHO	Rho|Cdc42|Rho	How has Monitoring Editor Doug Kellogg University of California, Santa Cruz inhibit phagocytosis by producing virulence factors that disable Rho, Rac, and/or Cdc42, highlighting the generality of this pathogenic strategy (Lemichez and Aktories, 2013) . Bacterial toxins continue to be important tools for revealing the functions of Rho GTPases in cells.. INTRODUCTION.
+SARS:13bcbfda70f3fae9fc63e5a041e4f3dba700b95c:fulltext:d169276120f7b157b64dd96e4151f5de:3843..4740:sentences:ac5990b09cb7c2ad5fd0ba767ac0730b	ACTR2|ACTB|ACTB|ACTB|ACTB	Arp2|actin|actin|actin|actin	These microbes undergo actin-based motility either within or on the surface of cells, which enables cellto-cell spread during infection (Welch and Way, 2013) . Through biochemical reconstitution of L. monocytogenes and/or S. flexneri motility, the host Arp2/3 complex and its activators (the WASP family proteins) were revealed as key actin-nucleating factors for bacterial pathogens and host cells (Welch et al., 1997 (Welch et al., , 1998 , and a minimal set of proteins that is sufficient to drive actinbased motility was defined (Loisel et al., 1999) . Moreover, the study of enteropathogenic/enterohemorrhagic E. coli and vaccinia virus, which induce actin assembly from outside the cell through the plasma membrane, revealed important roles for tyrosine kinase signaling and protein clustering in regulating actin assembly (Frischknecht et al., 1999; Campellone et al., 2008) .. INTRODUCTION.
+SARS:13bcbfda70f3fae9fc63e5a041e4f3dba700b95c:fulltext:d169276120f7b157b64dd96e4151f5de:5160..5663:sentences:c75e89a909c9fe12e46ad70a091224f1	|SNAP25|	SNARE|SNAP-25|SNARE	These toxins specifically cleave SNARE protein components of the vesicle fusion machinery, including VAMP, SNAP-25, and syntaxin (Link et al., 1992; Schiavo et al., 1992; Blasi et al., 1993a,b) . Microinjection of nerve cells with these toxins showed that SNARE molecules are critical for neurotransmitter release via vesicle fusion with the plasma membrane (Schiavo et al., 1992; Blasi et al., 1993b) . Preventing neurotransmitter release results in the paralysis caused by botulinum and tetanus toxins.
+SARS:13bcbfda70f3fae9fc63e5a041e4f3dba700b95c:fulltext:d169276120f7b157b64dd96e4151f5de:9424..9797:sentences:0b99db4f0bffcf6c5a0ad0baf5d3a27d	SRC|ABL1	src|v-Abl	The capacity of RSV to transform normal cells into tumor cells was found to be associated with the viral src gene and its product v-Src (Brugge and Erikson, 1977; Weiss et al., 1977) . The v-Src protein and the v-Abl protein from A-MuLV were subsequently shown to be tyrosine kinases (Hunter and Sefton, 1980; Witte et al., 1980) , the first discovery of this protein class.
+SARS:13bcbfda70f3fae9fc63e5a041e4f3dba700b95c:fulltext:d169276120f7b157b64dd96e4151f5de:9799..10025:sentences:9af1b52482d8638b83dbe54f0f3b5a17	SRC|ABL1	c-Src|c-Abl	Cellular homologues of these proteins, c-Src and c-Abl, were soon identified (Stehelin et al., 1976; Shalloway et al., 1981; Heisterkamp et al., 1982) , demonstrating that viral oncogenes are derived from cellular counterparts.
+SARS:13bcbfda70f3fae9fc63e5a041e4f3dba700b95c:fulltext:d169276120f7b157b64dd96e4151f5de:19072..19969:sentences:f91a44046e89e755cb776e5584b9e408	LGALS8|LGALS8|CALCOCO2|NUP62|MAP1LC3A	galectin-8|galectin-8|NDP52|p62|LC3	These include marking bacteria in the cytosol with ubiquitin (Thurston et al., 2009) and marking those in damaged SCVs with the lectin galectin-8, which recognizes glycans on damaged vacuoles (Thurston et al., 2012) . Both galectin-8 and ubiquitin are then recognized by adapter proteins (including NDP52, p62, and optineurin), which recruit LC3 and initiate autophagosome formation (Thurston et al., 2009 (Thurston et al., , 2012 Zheng et al., 2009; Wild et al., 2011) . In addition to their roles in infection, these same pathways may be involved in targeting damaged organelles in uninfected cells (Huang and Brumell, 2014; Sorbara and Girardin, 2015) and in removing protein aggregates, for example, those associated with neurodegenerative diseases (Rubinsztein et al., 2015) .. HOW HAS IDENTIFYING CELLULAR TARGETS OF PATHOGENS LED TO THE DEVELOPMENT OF THERAPEUTIC AGENTS TO TREAT INFECTION?.
+SARS:13bcbfda70f3fae9fc63e5a041e4f3dba700b95c:fulltext:d169276120f7b157b64dd96e4151f5de:25534..26288:sentences:070f4141b06eb5f87fb044779d68ba1f	TP53|BCL2|TP53|BCL2	p53|Bcl-2|p53|Bcl-2	During infection of host hepatocytes, Plasmodium suppresses the expression of the cell cycle regulator and proapoptotic protein p53 and increases the expression of the antiapoptotic protein Bcl-2, thus preventing host cell apoptosis (Kaushansky et al., 2013) . It was recently found that counteracting the parasite's anti-apoptotic program by treatment with the small molecule p53 activator Nutlin-3 and/or the Bcl-2 inhibitors Obatoclax or ABT-737, all of which are under study as anticancer therapeutics, delayed or prevented onset of disease caused by P. falciparum (Douglass et al., 2015) . This reveals the potential therapeutic value of drugs that target host cell death molecules for treating infectious disease.. CONCLUSIONS AND FUTURE DIRECTIONS.
+SARS:153c3a86e8939de3ca0331ea95b68f8bb4a3e395:title:837aedb5187cda00b1025142f79f9b22:0..111:sentences:0ff1fd95b565cb4bebe36e1e5194f9b5	RAB1A|CA2	Rab1|Ca2	Rab1 and Ca2+ are required for the fusion of carrier vesicles mediating endoplasmic reticulum to Golgi transport
+SARS:152b03c60f3b3ac7f290628d528a92b88a9a837a:abstract:a9794b4eced05c850ec32631a61b09ae:491..717:sentences:79d58e60e19b63b2af7aa5daf8d20178	ACTN4|CDC42|RAC1	alpha-actinin 4|Cdc42|Rac1	Our results show that the actin-binding proteins alpha-actinin 4 and Diaph, as well as the Rho-family small GTPase Cdc42 are necessary for an efficient virus entry, while GTPase Rac1 is required for maximal viral RNA synthesis.
+SARS:153c3a86e8939de3ca0331ea95b68f8bb4a3e395:abstract:67aeaa98cfdd48a8856be25c8430e2ba:175..533:sentences:0be1ea81260c6b3355c2145db0c531ec	RAB1A|RAB1A|RAB1A|COPB1	rab1a|rab1a|rab1|beta-COP	Using immunoelectron microscopy, we demonstrate that a dominant negative rab1a mutant, rab1a(N124I), defective for guanine nucleotide binding in vitro, leads to the accumulation of vesicular stomatitis virus glycoprotein (VSV-G) in numerous pre-cis-Golgi vesicles and vesicular-tubular clusters containing rab1 and beta-COP, a subunit of the coatomer complex.
+SARS:15640dc97f36ae7b410f731003235ee8a3cae495:title:6f34b0a6f765d9ab654a06d1356f5ea7:0..75:sentences:28dc74c68c7461125d593e008c92261f	IGF1|DPP4|DPP4	IGF-1|Dipeptidyl Peptidase IV|DPP-IV	Downregulation of Signaling-active IGF-1 by Dipeptidyl Peptidase IV (DPP-IV)
+SARS:15323d4aeaed14fe20110797538397a66d89a8ba:abstract:825bcd6b44942af624621926b38c015e:414..543:sentences:b6273d6d7d7ae0d0d0131090195545d1	ACE2|ACE	ACE2|ACE1	We found that a soluble form of ACE2, but not of the related enzyme ACE1, blocked association of the S1 domain with Vero E6 cells.
+SARS:15323d4aeaed14fe20110797538397a66d89a8ba:abstract:825bcd6b44942af624621926b38c015e:818..906:sentences:a2dd3593fb9fc2b009b17ced2e42526b	ACE2|ACE	ACE2|ACE1	Finally, anti-ACE2 but not anti-ACE1 antibody blocked viral replication on Vero E6 cells.
+SARS:15a29eca657f8adea9fab32ac036fb1fd8d4bddf:abstract:493fd6725ef59ca61f4dafaab09a7af2:84..674:sentences:41bd930118adafd93cbdd6f2f03ac92c	HAMP|APC2|ACTB|KLHL2|GAS2|C4BPA	HAMP|APC2|ACTIN|Kelch|GAS2|PRP	Out of the thousands of domains discovered so far across all living forms, some of the predominant clinically-relevant domains include IENR1, HNHc, HELICc, Pro-kuma_activ, Tryp_SPc, Lactamase_B, PbH1, ChtBD3, CBM49, acidPPc, G3P_acyltransf, RPOL8c, KbaA, HAMP, HisKA, Hr1, Dak2, APC2, Citrate_ly_lig, DALR, VKc, YARHG, WR1, PWI, ZnF_BED, TUDOR, MHC_II_beta, Integrin_B_tail, Excalibur, DISIN, Cadherin, ACTIN, PROF, Robl_LC7, MIT, Kelch, GAS2, B41, Cyclin_C, Connexin_CCC, OmpH, Bac_rhodopsin, AAA, Knot1, NH, Galanin, IB, Elicitin, ACTH, Cache_2, CHASE, AgrB, PRP, IGR, and Antimicrobial21.
+SARS:15a5a243bb623a17ee4f0c18c4e3bea8c065ed11:title:7136e34dd3bc33e173e2a4065de54ea2:0..107:sentences:bb9f1637fd1a9ba985694d080ad3d5c7	SLC5A1|SLC2A2	SGLT1|GLUT2	Transmissible Gastroenteritis Virus Infection Enhances SGLT1 and GLUT2 Expression to Increase Glucose Uptake
+SARS:153c3a86e8939de3ca0331ea95b68f8bb4a3e395:fulltext:65ca5a1de12cf285d3e5f7cc668b2457:21657..21824:sentences:b21b70ebdc8babb9472cbffef82a8543	MAN2A1|	Man II|p58	6, E [VSV-G] and F [p58]), a marker for pre-Golgi intermediates (Saraste et al., 1987; Saraste and Svensson, 1991) and to the Golgi compartments containing Man II (Fig.
+SARS:153c3a86e8939de3ca0331ea95b68f8bb4a3e395:fulltext:65ca5a1de12cf285d3e5f7cc668b2457:27779..28002:sentences:e85994a40ec2747f20fed937d278af7d	|CARD16	p58|COP	8, E-H) . The combined results establish that the p58-containing vesicular carriers mediating ER to Golgi traffic in vitro contain both rabl and B-COP.. VSV-G Accumulates in Carrier Vesicles and VTCs in the Absence of Ca z+.
+SARS:153c3a86e8939de3ca0331ea95b68f8bb4a3e395:fulltext:65ca5a1de12cf285d3e5f7cc668b2457:34566..35006:sentences:b8b7b3c8282ea1ef5d5907831d36fc81	|TP53|	p58|p53|p58	Carrier vesicles budding from the ER of NRK cells rapidly (within 5-10 rain) organize into VTCs in vitro , which are similar in structure to putative pre-Golgi elements containing p58 in intact cells (Saraste and Svensson, 1991) . A characteristic of both p53-and p58-containing pre-Golgi intermediates in vivo (Schweizer et al., 1991; Saraste and Svensson, 1991) , or those observed here in vitro, is the presence of short tubular elements.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:title:5ecf927a76a226a7d7cc35238b4bb682:0..95:sentences:15342e363c1adfb9b97343ac8d12cc24	DPP4|INS	DPP4|insulin	Elevated hepatic DPP4 activity promotes insulin resistance and non-alcoholic fatty liver disease
+SARS:15ca0457de2d05a3796f024899edc9c55c86e4ba:title:54608d0edf719a889f17897385227006:0..148:sentences:181a026a82413d80421f9cf7b1b44e26	IL10|CD274|CD163|MSR1	interleukin-10|PD-L1|CD163|CD204	CD163(+)CD204(+) tumor-associated macrophages contribute to T cell regulation via interleukin-10 and PD-L1 production in oral squamous cell carcinoma
+SARS:15a5a243bb623a17ee4f0c18c4e3bea8c065ed11:abstract:c907ffbeaa6a7f661ad92a3c48127bd5:228..502:sentences:61b6a0bc1971a934dd858f42bf37a59b	SLC5A1|SLC2A2	SGLT1|GLUT2	In vivo, TGEV primarily targets and infects intestinal epithelial cells, which play an important role in glucose absorption via the apical and basolateral transporters Na(+)-dependent glucose transporter 1 (SGLT1) and facilitative glucose transporter 2 (GLUT2), respectively.
+SARS:15a5a243bb623a17ee4f0c18c4e3bea8c065ed11:abstract:c907ffbeaa6a7f661ad92a3c48127bd5:504..629:sentences:85aa1f89a2b52a896d0837e186fe6c6e	SLC5A1|SLC2A2	SGLT1|GLUT2	In this study, we therefore sought to evaluate the effects of TGEV infection on glucose uptake and SGLT1 and GLUT2 expression.
+SARS:15a5a243bb623a17ee4f0c18c4e3bea8c065ed11:abstract:c907ffbeaa6a7f661ad92a3c48127bd5:631..763:sentences:d46c3754f7b75c985de7f2f00c929ef7	EGFR|SLC5A1|SLC2A2	EGFR|SGLT1|GLUT2	Our data demonstrate that infection with TGEV resulted in increased glucose uptake and augmented expression of EGFR, SGLT1 and GLUT2.
+SARS:15ad534bb2ec7bc4b0ee83ddac11a1b837d743c6:abstract:dca23d1a338cb1c6fc6b58ed3d179360:853..1171:sentences:8def4d64bca53cb942ac067e99e8d7eb	IL6|IL6|IL10|CD8A|CD4	IL-6|IL-6|IL-10|CD8|CD4	of the mild group, mild group has a significantly lower proportion of patients with IL-6 higher than normal than severe group; There was no significant linear correlation between the lymphocyte subsets and cytokines, while significant differences were noticed between the two groups in CD4 + T, CD8 + T, IL-6 and IL-10.
+SARS:15ad534bb2ec7bc4b0ee83ddac11a1b837d743c6:abstract:dca23d1a338cb1c6fc6b58ed3d179360:1173..1240:sentences:3344b861c81a0657c06aaadb5c65f3cc	CD8A|CD4	CD8|CD4	Conclusions: Low levels of CD4+T and CD8+T are common in severe NCP.
+SARS:15ad534bb2ec7bc4b0ee83ddac11a1b837d743c6:abstract:dca23d1a338cb1c6fc6b58ed3d179360:1242..1294:sentences:3e3ed0d032e88c647f615bfe31e2c511	IL6|IL10	IL-6|IL-10	IL-6 and IL-10 levels were higher in severe patients.
+SARS:15ad534bb2ec7bc4b0ee83ddac11a1b837d743c6:abstract:dca23d1a338cb1c6fc6b58ed3d179360:1408..1514:sentences:b7653c1c46b065ae37caf936c64cf947	IL6|IL10|CD4|CD8A	IL-6|IL-10|CD4|CD8	Large number of samples are still needed to confirm the "warning value" of CD4 + T, CD8 + T IL-6 and IL-10.
+SARS:15e4d9aee09dd7342cee30b855b012e738c0d45d:title:f1707f3001cf384e4a0185534ab3a043:0..141:sentences:6b218b73b4b15cdf3f16178bf3812749	IL8|MAPK1	interleukin-8|extracellular signal-regulated kinase	Induction of interleukin-8 by Naegleria fowleri lysates requires activation of extracellular signal-regulated kinase in human astroglial cells
+SARS:15f32645ef27787af4120e37cc67c24ed6c8f305:title:5bb8c8bedc1ab8e37d1e016d5c5f811c:0..103:sentences:812538768224621d6ee74a7ccd701b1f	ACE2|ACE2|SARS	angiotensin converting enzyme 2|ACE2|SARS	Predicting the angiotensin converting enzyme 2 (ACE2) utilizing capability as the receptor of SARS-CoV-2
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:abstract:8ade6db446dc85411873757e3a769d26:555..745:sentences:91e71fd836a9862bbbf21f42b7684ba4	CRP|CRP|UROD	C-reactive protein|CRP|PCT	The peripheral blood white blood cell (WBC) counts, serum C-reactive protein (CRP), procalcitonin (PCT), and clinical symptoms were compared among patients with different types of infections.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:abstract:8ade6db446dc85411873757e3a769d26:1160..1275:sentences:47f3aca615286ad36240555a3a2e9b7f	CRP|UROD	CRP|PCT	The WBC, CRP, and PCT levels of the bacteria-positive and bacteria-negative groups were not statistically different.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:abstract:8ade6db446dc85411873757e3a769d26:1479..1625:sentences:5d02a55fb7672e4a3ff5118cd381307e	UROD|CRP	PCT|CRP	CONCLUSION: WBC, CRP, or PCT could not differentiate between bacterial and viral infections in patients with COPD exacerbation requiring ED visits.
+SARS:15e4d9aee09dd7342cee30b855b012e738c0d45d:abstract:06e23ef6ff36cfe6201b9ad1aa31d856:323..529:sentences:b18bf5fdf63c15a93d40af8f7f6453bb	IL8|IL8|MAPK1|MAPK1	interleukin-8|IL-8|extracellular signal-regulated kinase|ERK	We demonstrated that N. fowleri are potent inducers for the expression of interleukin-8 (IL-8) genes in human astroglial cells which was preceded by activation of extracellular signal-regulated kinase (ERK).
+SARS:15e4d9aee09dd7342cee30b855b012e738c0d45d:abstract:06e23ef6ff36cfe6201b9ad1aa31d856:531..679:sentences:b66891d10c27f7b4f60977d38c362d88	JUND|IL8	activator protein-1|IL-8	In addition, N. fowleri lysates induces the DNA binding activity of activator protein-1 (AP-1), an important transcription factor for IL-8 induction.
+SARS:15e4d9aee09dd7342cee30b855b012e738c0d45d:abstract:06e23ef6ff36cfe6201b9ad1aa31d856:681..828:sentences:c37ebf4bf788430e8f26e344c4a3609d	MAPK1|IL8	ERK|IL-8	The specific mitogen-activated protein kinase kinase/ERK inhibitor, U0126, blocks N. fowleri-mediated AP-1 activation and subsequent IL-8 induction.
+SARS:15e4d9aee09dd7342cee30b855b012e738c0d45d:abstract:06e23ef6ff36cfe6201b9ad1aa31d856:830..917:sentences:a2c07d4b99e414b6cbfecb7501fa49fa	IL8|MAPK1	IL-8|ERK	N. fowleri-induced IL-8 expression requires activation of ERK in human astroglial cells.
+SARS:15e4d9aee09dd7342cee30b855b012e738c0d45d:abstract:06e23ef6ff36cfe6201b9ad1aa31d856:919..1101:sentences:4556629e0c83dea38885af98a6cec58e	IL8|MAPK1	IL-8|ERK	These findings indicate that treatment of N. fowleri on human astroglial cells leads to the activation of AP-1 and subsequent expression of IL-8 which are dependent on ERK activation.
+SARS:15ebc5b2e06803c4c06775cd751eff6ae2632e9a:title:e4dda8536b886142410e60caacc8dbf0:0..79:sentences:38682b4520be6112eb570deee6be5b77	PKLR|IL10	PKR|IL-10	PKR mediated regulation of inflammation and IL-10 during viral encephalomyelitis
+SARS:161bef059af06fae635b68b4f14ba98a08760783:title:e5a6021f7fef92df984273a80021f1dc:0..130:sentences:a8971e7489de4378cde55fd07e31863c	IL10|CD8A	IL-10|CD8	Type I interferon signaling facilitates the development of IL-10-producing effector CD8(+) T cells during influenza virus infection
+SARS:1622e5febd59e8a8fef0afd6a256324fb3473a1a:abstract:3b6923f6af2be4a1ddfa6673add7d4d7:0..139:sentences:4912d1ace9432236762160daf01a1fcc	LTB|CTBS	LTB|CTB	Abstract The B subunits of enterotoxigenic Escherichia coli (LTB) and cholera toxin of Vibrio cholerae (CTB) are candidate vaccine antigens.
+SARS:1622e5febd59e8a8fef0afd6a256324fb3473a1a:abstract:3b6923f6af2be4a1ddfa6673add7d4d7:141..457:sentences:a8923750bb0234ab5800ef6e67b61493	LTB|CTBS	LTB|CTB	Integration of an unmodified CTB-coding sequence into chloroplast genomes (up to 10,000 copies per cell), resulted in the accumulation of up to 4.1% of total soluble tobacco leaf protein as functional oligomers (410-fold higher expression levels than that of the unmodified LTB gene expressed via the nuclear genome).
+SARS:15edc032af91b8816dba3ea640dcb5a92b74f7c6:abstract:62bb095de5419a0f65fad53f37156df0:456..654:sentences:76bbf0c432c61363e49106ba75a5fb2d	TLR3|MTOR	TLR 3|mTOR	Thus, TLR 3, 4, 7 and 9 associate endosomal recognition of PAMPs to type I IFN responses, a mechanism that has been shown in plasmacytoid dendritic cells to be dependent on the PI3K/mTOR/S6K pathway.
+SARS:15edc032af91b8816dba3ea640dcb5a92b74f7c6:abstract:62bb095de5419a0f65fad53f37156df0:979..1184:sentences:fc9506e80262f02556ad50b2f181f109	CISH|TYRO3|AXL|MERTK	SOCS|TYRO3|AXL|MER	SOCS in turn is under tight regulation of the TAM receptors (protein tyrosine kinase receptors TYRO3, AXL and MER), and activation of which thereby protects the host from the threats of autoimmune diseases.
+SARS:161bef059af06fae635b68b4f14ba98a08760783:abstract:cfc068a890ddc6659e0c99db78089f5e:0..164:sentences:de484cd55ce98f9c789154efa3573cb8	IL10|CD8A	IL-10|CD8	Recent evidence has suggested that IL-10-producing effector CD8(+) T cells play an important role in regulating excessive inflammation during acute viral infections.
+SARS:161bef059af06fae635b68b4f14ba98a08760783:abstract:cfc068a890ddc6659e0c99db78089f5e:166..303:sentences:2b0938abcc199f06617d7e4951acf5ac	IL10|CD8A	IL-10|CD8	However, the cellular and molecular cues regulating the development of IL-10-producing effector CD8(+) T cells are not completely defined.
+SARS:161bef059af06fae635b68b4f14ba98a08760783:abstract:cfc068a890ddc6659e0c99db78089f5e:305..457:sentences:8c470c02f2965b5a6bea3e4c3372fd0d	IL10|CD8A	IL-10|CD8	Here we show that type I interferons (IFNs) are required for the development of IL-10-producing effector CD8(+) T cells during influenza virus infection.
+SARS:161bef059af06fae635b68b4f14ba98a08760783:abstract:cfc068a890ddc6659e0c99db78089f5e:459..652:sentences:5cd0dea6958be296b4e94dd6d798767b	IL27|IL10|CD8A|CD8A	IL-27|IL-10|CD8|CD8	We find that type I IFNs can enhance IL-27 production by lung antigen presenting cells, thereby facilitating IL-10-producing CD8(+) T cell development through a CD8(+) T cell non-autonomous way.
+SARS:161bef059af06fae635b68b4f14ba98a08760783:abstract:cfc068a890ddc6659e0c99db78089f5e:654..811:sentences:f6dfd690d25be6b8900b684d63be78de	IL10|CD8A|CD8A	IL-10|CD8|CD8	Surprisingly, we also demonstrate that direct type I IFN signaling in CD8(+) T cells is required for the maximal generation of IL-10-producing CD8(+) T cells.
+SARS:161bef059af06fae635b68b4f14ba98a08760783:abstract:cfc068a890ddc6659e0c99db78089f5e:813..1046:sentences:c2ecd68f34c544b7b6064d7e6efc5e7a	CD8A|IL27|IL2|IRF4|PRDM1|IL10|CD8A	CD8|IL-27|IL-2|IRF4|Blimp-1|IL-10|CD8	Type I IFN signaling in CD8(+) T cells, in cooperation with IL-27 and IL-2 signaling, promotes and sustains the expression of IRF4 and Blimp-1, two transcription factors required for the production of IL-10 by effector CD8(+) T cells.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:1646..1897:sentences:ebf47506170e43af969f06f5a5e2cb3c	CRP|UROD	CRP|PCT	This study was conducted to clarify peripheral blood white blood cell (WBC) counts, PCT, and CRP levels, and their relationships with viral or bacterial pathogens, in COPD patients requiring ED visits for exacerbations.. Materials and methods subjects.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:3027..3438:sentences:04afa2c08871491a1217ffc5aae320df	CRP|UROD	CRP|PCT	Medical records were reviewed and analyzed for the following data: age, sex, body mass index (BMI), medications used prior to the ED admission, clinical symptoms (worsened dyspnea, increased sputum volume and purulence, fever, cough, sore throat, and wheeze), family cluster of common cold symptoms, peripheral blood WBC count, serum CRP and PCT levels, spirometry, and hospital days of the current exacerbation.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:5046..5282:sentences:07c5179ea888697f354d136b41d18985	CRP|UROD	CrP|PCT	PCT and CrP in COPD exacerbation statistical analysis All statistical analyses were performed using the SPSS (SPSS 18 for Windows, SPSS Inc., Chicago, IL, USA) statistical package and Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA).
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:6125..6426:sentences:3600a5ef404657eecf1283b9a45d5f00	CRP|UROD	CRP|PCT	The baseline characteristics of the 72 COPD patients, including age, sex, BMI, FEV 1 % predicted, FVC% predicted, GOLD stage, pack-years of tobacco use, previous inhaled or oral medications, peripheral blood WBC counts, and serum CRP and PCT levels are shown in Table 1 . A total of 52 patients (72.2%)
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:7746..7862:sentences:d4d63c720dd4d3a5ab9462e03374417f	CRP|UROD	CRP|PCT	WBC counts, CRP, and PCT levels were not significantly different between the virus-positive and virus-negative group.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:9056..9244:sentences:123f60ee3ee3a7a6ed313f4b93b40716	CRP|UROD|UROD	CRP|PCT|PCT	WBC, CRP, and PCT levels were not significantly different between the bacteria-positive and bacteria-negative groups (Figure 2) . Among the seven patients with PCT .0.5 ng/mL, three (42.9%)
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:10544..10749:sentences:799cdd639e409f3e5d8e70747eaf5e4a	CRP|UROD	CRP|PCT	When the outcomes were analyzed specifically by PCT and CRP levels, the percentage of patients free from readmission to the EDs also showed no statistically significant differences (Figure 4 ).. Discussion.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:11593..11783:sentences:a89b183b3f83f7317375ff1d43407c05	CRP|UROD	CRP|PCT	However, the commonly used biomarkers for infection, such as serum CRP or PCT levels, did not aid in differentiating between bacterial or viral infections in patients with COPD exacerbations.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:14803..15000:sentences:2f4a5a57f4fb8a0fcec0a9ba5e96df8e	CRP|UROD	CRP|PCT	We compared WBC, CRP, and PCT levels between the bacteria-positive and bacteria-negative patients, and these biomarkers did not show statistically significant between-group differences in our study.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:15002..15152:sentences:ea58b1868ab3389f3ce50c32b9c375ca	UROD|CRP	PCT|CRP	Similarly, for the WBC, CRP, and PCT levels, the differences between the virus-positive and virus-negative patients were not statistically significant.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:15399..15621:sentences:ffb5240849930c4f912a01af0878a3bb	CRP|UROD|UROD|UROD	CRP|PCT|PCT|PCT	13 Daniels et al compared CRP and PCT as markers of clinical outcome in COPD exacerbations and found that PCT was not a good biomarker in COPD exacerbations because patients with low PCT values did benefit from antibiotics.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:16960..17110:sentences:698b594ca266fafee615b1a08df8aae2	CRP|UROD	CrP|PCT	PCT and CrP in COPD exacerbation A total of 52% of our patients had recurrent exacerbations during the subsequent 1-year period after the exacerbation.
+SARS:15f57ae58cbfdd0616c570508ce0471bc4dacebe:fulltext:0a71a4caf401817880a86f5f65650652:19014..19109:sentences:724719618c763011c17b84e9861eeeb3	CRP|UROD	CRP|PCT	WBC, PCT, and CRP levels are not good indicators for bacterial infections in COPD exacerbations.
+SARS:151b29e4b482ad11ee11e83cec4f3faebb8124c5:fulltext:fd2baa89fd459bbc65d6f56086d13b2d:56..393:sentences:cd80766b9e70d0a22022b305585e0ce4	TFRC|TFRC|TF|TF	transferrin receptor|TfR|transferrin|transferrin	To better understand the cellular and molecular mechanisms by which receptor cross-linking affects the intracellular trafficking of both ligand and receptor, we studied the intracellular trafficking of the transferrin receptor (TfR) bound to multivalent-transferrin (Tfl0) which was prepared by chemical cross-linking of transferrin (Tf).
+SARS:151b29e4b482ad11ee11e83cec4f3faebb8124c5:fulltext:fd2baa89fd459bbc65d6f56086d13b2d:1779..2776:sentences:5c0dbe39888718a3560e05b969cf29be	SLC2A4|INS|INS	Glut-4|insulin|insulin	Machamer and colleagues have demonstrated that oligomerization of the M glycoprotein of avian coronavirus correlates with its c/s-Golgi localization (Weisz et al., 1993) . Glut-4, an insulin sensitive glucose transporter, is retained within the endocytic system in the absence of insulin by a mechanism that may involve the oligomeric state of the transporter (Bell et al., 1993; James and Piper, 1993) . The sorting of soluble regulated secretory proteins can occur by self-aggregation in the trans-Golgi network (Kelly, 1991) . Furthermore, the delivery of HLA class II molecules to a specialized antigen processing compartment (Qiu et al., 1994; Amigorena et al., 1994; Tulp et al., 1994; West et al., 1994 ) may be controlled by the formation of a multimeric complex (et, [3, Ii) 3 (Marks et al., 1990; Roche et al., 1991) .. . The ability of a multivalent ligand to cross-link several receptor molecules results in the oligomerization of recep-Please address all correspondence to Frederick R.
+SARS:151b29e4b482ad11ee11e83cec4f3faebb8124c5:fulltext:fd2baa89fd459bbc65d6f56086d13b2d:31418..31593:sentences:c48323679212849ff07f2e86cd732b41	TFRC|TF	TfR|Transferrin	each particle of Tfl0 must be displacing several 125I-Tf particles and by inference binding several TfR.. Multivalent-Transferrin Is Retained by TR Vb-1 Cells but Not Degraded.
+SARS:151b29e4b482ad11ee11e83cec4f3faebb8124c5:fulltext:fd2baa89fd459bbc65d6f56086d13b2d:48016..48721:sentences:fead1aa726af3c38081a3ad9a6398d19	TFRC|TFRC|TF|TF	TfR|TfR|Transferrin|Transferrin	To determine if the cytoplasmic domain of the TfR contributed to the retention of Tfl0 in the recycling compartment, we employed TRVbA3-59 cells which express an altered form of TfR that contains only four of the 61 amino acids that comprise the cytoplasmic domain of the receptor (Johnson et al., 1993a) . Although these cells internalize Tf slowly, they externalize Tf at a rate comparable to that of the TRVb-1 cells (Johnson et al., 1993a) . If the cytoplasmic domain were required for the retention of Tfl0, it would be expected that the TRVbA3-59 cells would efflux Tfl0 at the same rate as Tf.. The Cytoplasmic Domain of the Transferrin Receptor Is Not Involved in Multivalent Transferrin Retention.
+SARS:151b29e4b482ad11ee11e83cec4f3faebb8124c5:fulltext:fd2baa89fd459bbc65d6f56086d13b2d:56005..56506:sentences:b9ae5b46119111bd17661e102ef323f8	TFRC|SLC2A4|INS|SLC2A4|INS|INS	TfR|GLUT-4|insulin|GLUT-4|insulin|insulin	Recently, it has been shown in polarized MDCK cells that transcytosed IgA is sorted from TfR, which recycles to the basolateral membrane, in a common apical recycling compartment (Apodaca et al., 1994) . The insulin-dependent glucose transporter GLUT-4, in the absence of insulin, is sequestrated in a transferrinaccessible compartment, possibly as a result of oligomerization (Bell et al., 1993; James and Piper, 1993) . Addition of insulin results in the redistribution of GLUT-4 to the cell surface.
+SARS:164b06dfaee2407cfa4fb66b7d895f31fe059a76:abstract:1b86a56e49d59c3ea12772c5e9be89ec:376..718:sentences:66326b87945fa1db732ccd3be1db7c15	CD4|CD8A|IL2RA|CD14|CD74	CD4|CD8|CD25|CD14|CD74	Objectives The aim of this study was to immunohistochemically evaluate the expression of the cell surface antigens CD4, CD8, CD25, CD14 and CD74, in pneumonic infiltrates in the alveolar septa using paraffin-embedded lung samples from autopsies of immunocompetent children who died of lethal, non-pandemic, severe acute respiratory infections.
+SARS:164b06dfaee2407cfa4fb66b7d895f31fe059a76:abstract:1b86a56e49d59c3ea12772c5e9be89ec:880..1115:sentences:613a17e4007a0d82cbcfc0e84694a82c	CD53|CD4|CD8A|CD14|IL2RA|CD74	cell surface antigen|CD4|CD8|CD14|CD25|CD74	To identify subpopulations of inflammatory cells in the alveolar septa, cell surface antigen expression was assessed by immunohistochemistry using the following primary antibodies: anti-CD4, anti-CD8, anti-CD14, anti-CD25 and anti-CD74.
+SARS:164b06dfaee2407cfa4fb66b7d895f31fe059a76:abstract:1b86a56e49d59c3ea12772c5e9be89ec:1301..1504:sentences:2b81e6442fbda0891cdae819d060fa99	CD14|CD74	CD14|CD74	There were fewer CD14+ cells in cases of AdV (adenovirus) infection (p =0.002), and there was a predominance of CD74+ cells in the histopathological pattern defined as interstitial pneumonitis (p =0.037).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:14..545:sentences:f216504c5dad1b4d4df23bea9829dfd4	FOXP3|FOXP3|IL2RA|IL2RA|CD4	FOXP3|FOXP3|CD25|IL2 receptor alpha|CD4	FOXP3 + regulatory T cells (Tregs), a subset of CD4 + T cells, maintain immune homeostasis and prevent autoimmunity by suppressing auto-reactivity and regulating immune responses to foreign and self-antigens [1] . A hallmark of Tregs is their expression of the transcription factor, FOXP3, and the high level of CD25, the IL2 receptor alpha chain [2] . Due to their role in maintaining immune homeostasis and tolerance, Tregs have been considered as potentially immunotherapy to prevent a variety of immunological diseases in human.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:1242..1342:sentences:e89373677fb2f6c1432bc38ef40753df	FOXP3|CD4	FOXP3|CD4	In the peripheral blood of healthy adults, there are ~5-10% FOXP3 + Tregs within total CD4 + T cells.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:1344..1541:sentences:fb238c3e3c500a9e21918b1beb78c8e4	FOXP3|IL2RA|FOXP3|CD4	FOXP3|CD25|FOXP3|CD4	Since FOXP3 is an intracellular transcription factor, only the CD4 + T cells with low CD127 and high CD25 expression, i.e., no more than 2-4% can be sorted to functionally isolate >90% FOXP3 purity.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:1835..2112:sentences:c12249698347a70546d49a14112be8af	IL2|FOXP3|CD4	IL2|FOXP3|CD4	Moreover, nave CD4 + T cells can be induced in vitro with TCR stimulation in the presence of TGF1 and IL2 to express FOXP3 (iTregs) [11] . The functional patterns for these different subgroups of Tregs are widely varying during the expansion of Tregs over a [3] [4] week period.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:2114..2308:sentences:c2949dfcec78a5c5ed49980e0d600e2d	CD4|FOXP3	CD4|FOXP3	In addition, the purity and composition of Tregs frequencies with respect to tTregs, iTregs, pTregs and CD4 + FOXP3  nonTregs are also varying, resulting in an impure Treg product.. Introduction.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:2842..3263:sentences:3d85cf6162c0eb9c7aa537f812c63c3d	TGFB1||FOXP3	latency-associated peptide|LAP|FOXP3	By targeting the selective expression of latency-associated peptide (LAP), this novel method allows for expansion and consistent re-purification of sufficient quantity of highly purified, bona fide Tregs (>90% FOXP3), even from an initial limited blood volume of 5-10 ml [15] . Without this technique, it has been difficult to analyze and assess definitively the function of Tregs due to variable contaminants of nonTregs.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:3481..3646:sentences:e2d2c8a1c751f6cf16555a21f618bef2	||FOXP3|FOXP3	LAP|LAP|FOXP3|FOXP3	Using the LAP marker, we can selectively isolate LAP + Tregs from any time point during expansion that are typically contaminated by >25% FOXP3 + and FOXP3 -nonTregs.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:3952..4095:sentences:a50abbee13d12ae61f18b02232779118	CD86|FCGR1A||IL2RA	CD86|CD64|LAP|CD25	These CD25 + cells are expanded with OKT3-loaded KT64/86 artificial APC (aAPC) expressing CD86 and CD64 and re-purified based on LAP expression.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:4097..4268:sentences:e8b41c2608555bc6637d7eadccd3101b	IL2RA||	CD25|LAP|LAP	We perform an analysis of the TCR repertoire, function, and phenotype within CD25 + cells and the subsets of LAP + Tregs and LAP  nonTregs isolated from expansion cultures.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:4452..4650:sentences:6f1388042f264cc6a2c9039037ba9aca	IL2RA|	CD25|LAP	In contrast, the LAP  nonTregs possess no suppressive function, while the CD25 + parent population had variable functionality depending on the level of expanded, contaminated nonTregs.. Introduction.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:4652..4816:sentences:e25df6c767080d4f9d58667a9dfbc0bc	IL2RA||FOXP3	CD25|LAP|FOXP3	Our study demonstrates a simple single-step CD25 + isolation, robust expansion on aAPCs, and LAP + repurification to obtain highly purified, bona fide FOXP3 + Tregs.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:5265..5432:sentences:a0074feee34315e1290a34060674787f	CD4|CD8A|FCGR3B|CD19|IL2RA||LRRC32	CD4|CD8|CD16|CD19|CD25|LAP|GARP	Various fluorescent conjugated antibodies to human CD4 (RPA-T4), CD8 (RPA-T8), CD16 (3G8), CD19 (HIB19), CD25 (BC96), LAP (TW4-2F8) and GARP (7B11) were from BioLegend.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:5434..5639:sentences:315949380feea3ea4eb3749fffd8fd78	FOXP3|IKZF2	FOXP3|HELIOS	Cells were surface stained first using appropriate combinations of mAbs, and either used directly for flow cytometric analyses or further processed for intracellular staining of cytokines, FOXP3 and HELIOS.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:5641..5809:sentences:9ca028e34b81de7cc1915342a8bc18b3	FOXP3|IKZF2	FOXP3|HELIOS	The cells were fixed and permeabilized with a Fixation/ Permeabilization kit (eBioscience) and stained with anti-FOXP3 (259D) and/or anti-HELIOS (22F6) mAbs (BioLegend).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:5953..6045:sentences:c0fb0378fa039d49f0cc21e3d9fb228c	CD4|IL2RA|CD14	CD4|CD25|CD14	Anti-CD4, anti-biotin, anti-CD25 and anti-CD14 magnetic microbeads were from Miltenyi Biotec.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:6676..6886:sentences:7143dae130b4a9c87277b3a428d05898	CD4|CD86|FCGR1A|IL2RA	CD4|CD86|CD64|CD25	Bead-purified CD4 + CD25 high cells (~5-1010 6 ) were stimulated with OKT3-loaded KT64/86 artificial APC (aAPC) expressing CD86 and CD64 at 1:1 ratio (kindly provided by Dr. Carl H. June and Dr. James L. Riley).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:6951..7098:sentences:cd81c0fe86965c1b3b9588310fa24eef	CD4|IL2RA|IL2	CD4|CD25|IL2	CD4 + CD25 high cells were cultured in complete media supplemented with 100 U/mL IL2 (PeproTech) in the presence of 25 nM rapamycin (Sigma-Aldrich).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:7997..8104:sentences:de630785ec9f5ceeb106d8cd802e2816	|IL2RA	LAP|CD25	LAP + Tregs were purified from expanded CD25 + cells by positive selection with AutoMACS (Posseld2 program).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:8106..8283:sentences:3484e863b3e6cbb2d5f17d7ae4489117	IL2RA|||IL2|IL2	CD25|LAP|LAP|IL2|IL2	The CD25 + , LAP + and LAP  populations were cultured in fresh IL2 media and maintained at cell concentration of 10 6 /mL, splitting every 3 days with additional fresh IL2 media.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:8413..8547:sentences:d53530567c5a4e6ea6d3fdd91be0a0c2	CD4|IL2RA|CD14	CD4|CD25|CD14	CD4 + CD25  and CD14 + cells were isolated from PBMC of healthy donor buffy coats using the AutoMACS and related Miltenyi Biotecs kits.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:8549..8809:sentences:303db5bfbb4c22f0fc2f583eeb472ea2	CD4|CD14|IL2RA|||IL2RA	CD4|CD14|CD25|LAP|LAP|CD25	Fresh CD4 + CD25  T cells (50,000) were labeled with 2 M CFSE (Invitrogen) and stimulated with non-irradiated CD14 + APC (12,500) loaded with 0.25 g/mL OKT3 alone or with 2:1, 4:1, 8:1 and 16:1 responder to suppressor cells (CD25 + , LAP + Tregs or LAP  cells).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:9126..9395:sentences:83bf31170cb068b372582dd9064840be	FOXP3|FOXP3|IL2|IL4|IL10|IL13|IL17A|IFNA1	FOXP3|FOXP3|IL2|IL4|IL10|IL13|IL17A|IFN	Afterward, the cells were fixed and permeabilized with eBioscience FOXP3 kit and stained with mAbs against FOXP3 (259D), IL2 (MQ1-17H12), IL4 (8D4-8), IL10 (JES3-9D7), IL13 (JES10-5A2), IL17A (BL168) and IFN (4S.B3) (BioLegend) for FACS analysis.. Xenogeneic GVHD model.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:9397..9600:sentences:4a1d7903c81ff848a43947b9a0ff4b00	PRKDC|IL2RG	Prkdc|Il2rg	NOD.Cg-Prkdc scid Il2rg tm1Wjl/SzJ (NSG) mice were obtained from Jackson Laboratory and maintained in specific pathogen free conditions at the CLAMC (University of Texas Health Science Center at Houston).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:9650..9783:sentences:e24a42bc157823d27009fe66081a4d3c	IL2RA|IL2RA||	CD25|CD25|LAP|LAP	On day 0, mice were injected with human CD25  PBMC (3010 6 ) with or without expanded CD25 + , LAP + Tregs and LAP nonTregs (3010 6 ).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:10596..10739:sentences:e33990072a015dd825eeca62ee83ea19	FOXP3|IL2RA||	Foxp3|CD25|LAP|LAP	To determine the methylation status of the Foxp3 gene, DNA was purified from frozen aliquots of expanded CD25 + , LAP + Tregs and LAP -nonTregs.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:11868..12172:sentences:a3d4b26d491d1ab1db965bd6d16722c1	CD28|IL2RA	CD28|CD25	Previously, we have demonstrated that it is feasible and economical to use an initial one-step method with anti-CD25 bead to purify and expand Tregs with anti-CD3/CD28 beads [15] . This time we use aAPCs, because they are more cost-effective at large scale production and do not require a removal process.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:12507..12711:sentences:d1c82102f66dff455abd570a5f3349a0	IL2RA|FOXP3|FOXP3|||CD4	CD25|FOXP3|FOXP3|LAP|LAP|CD4	With this method, the CD25 + population contains an average of 72% FOXP3 + cells within CD4 + cells (range, 60%-84%), while the percentages of FOXP3 purity post LAP purification (LAP + ) are typically 90%.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:12766..12963:sentences:acfb9274434589f0c1a52abd59456476	|||LRRC32	LAP|LAP|LAP|GARP	Furthermore, the LAP + cells are mainly GARP + cells ( Figure 1B) . Starting with 4-2510 6 LAP + Tregs at day 12, we are able to achieve >1 billion LAP + Tregs by day 30 of expansion ( Figure  2A ).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:12965..13123:sentences:e28961dd1a2d09a6ece8cc6d9071e0e3	IL2RA|CD4|FOXP3|CD19|FCGR3B|CD8A	CD25|CD4|FOXP3|CD19|CD16|CD8	The starting CD25 + population at day 0 contains mainly CD4 + FOXP3 + Tregs with the remainder being CD8 + T, CD19 + B and CD16 + NK cells ( Figure 2B and S1).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:13316..13926:sentences:9659971dec2de646555fd3c97e22ffdc	FOXP3|IL2RA||CD4|FOXP3|FOXP3|IKZF2|||	FOXP3|CD25|LAP|CD4|FOXP3|FOXP3|HELIOS|LAP|LAP|LAP	There is a progressive reduction of FOXP3 purity in CD25 + population during the expansion from an average of 60% (range, 36%-74%) at the starting point to a mean of 73% (range, 46%-88%) on day 10 and 52% (range, 21%-87%) on day 30. After LAP repurification, the means of CD4 + FOXP3 + T cells maintain higher than 90% in LAP + Tregs and lower than 40% in LAPpopulation during expansion ( Figure 2C and D) . The mean percentages of FOXP3 + HELIOS + T cells maintain higher than 80% in LAP + Tregs and lower than 40% in LAPpopulation during expansion ( Figure 2C and E).. TCR V diversity in expanded LAP + Tregs.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:13928..14112:sentences:03692e5d912244235a40f65e28b0a193	CD4|FOXP3	CD4|FOXP3	In order to investigate the changes in TCR V repertoire during expansion, we next examine TCR repertoire usage of the Tregs (CD4 + FOXP3 + ) before (day 0) and after (day 30) expansion.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:14528..14655:sentences:10394b5b95e4ae23344c229e8e27377d	IL2RA||	CD25|LAP|LAP	The CD25 + , LAP + Tregs and LAP -nonTregs are stimulated to measure the levels of cytokine production at day 30 end of culture.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:14657..14922:sentences:4317d92ca8df104d1113941f0d295067	|IL17A|IL4|IL13|IL10|CD4||	IL2 + , IFN +|IL17A|IL4|IL13|IL10|CD4|LAP|LAP	There are substantially lower percentages of IL2 + , IFN + , IL17A + , IL4 + , IL13 + and IL10 + producing cells out of CD4 + cells detected in the LAP + Tregs as compared to the other two populations (Figure 4 and S2) .. LAP + Tregs are highly demethylated in TSDR.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:15448..15681:sentences:34c9e3bce50ddbabdbdf0ba6b8c278c5	|IL2RA	LAP|CD25	In this study, we demonstrate that after 30 days expansion the purified LAP + Tregs are highly demethylated with an average of 95% demethylation in the TSDR region, while the CD25 + cells with mean of 45% demethylation ( Figure  5A ).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:15683..15849:sentences:e6c5a96a2c88bde8b360dc1a76cc533c	|FOXP3|IKZF2	LAP|FOXP3|HELIOS	The LAP -nonTregs are highly methylated, with less than 20% demethylation even when the population contains close to 60% FOXP3 + and HELIOS + cells ( Figure 5B and C).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:15851..16072:sentences:5a1937801ab6082703f56bd3914ab557	||IKZF2	LAP|LAP|HELIOS	It should be noted that the LAPpopulations still contain LAP + cells ranging from 10-50% which represent most of the demethylated TSDR and HELIOS signals (Figure 1 and 2).. LAP + Tregs are anergic and suppressive in vitro.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:16074..16216:sentences:bc6d832b1b1c6af696718d72d74ad82f	|CD28	LAP|CD28	Previously we have demonstrated that LAP + Tregs isolated from CD3/CD28 Dynabead stimulated expansion cultures maintained suppressive function.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:16351..16484:sentences:2b9f5b61c0e79b0a9a089d34b28b4da8	|CD4	LAP|CD4	We evaluate the capacity of purified LAP + Tregs to suppress the proliferative responses of CD4 + 25  T cells in CFSE dilution assays.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:16664..17036:sentences:de97deed855c2496c1e0b60b0fe6e7a7	IL2RA||IL2RA||	CD25|LAP|CD25|LAP|LAP	To determine whether expanded LAP + Tregs are effective in suppressing human CD25-depleted PBMC-induced xenogeneic GVHD, we used a xenogeneic model of GVHD in which Tregs are co-transferred at a 1:1 ratio with allogeneic CD25-depleted PBMC (30  10 6 each) into NSG recipients to compare the potency and safety of in vitro-expanded LAP + Tregs and LAP  cells ( Figure  6C ).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:17109..17244:sentences:8b32591606f1da53ac311ceabf972db1	|IL2RA|	LAP|CD25|LAP	The co-transfer of LAP parent (CD25 + ) or LAP + Tregs increased median survival to 39 (p < 0.05) and 47 days (p < 0.001), respectively.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:17404..17488:sentences:c1ac14fc3c47522f06844e3d6c17abac	IL2RA|	CD25|LAP	Compared with CD25 + group, LAP + Tregs increased median survival from 39 to 47 days.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:17490..17804:sentences:5ed5c2a9f73854bce62656ebbb807209	IL2RA|FOXP3	CD25|FOXP3	However, no statistic different was found, since some of the CD25 + parent populations have less contaminating nonTregs and therefore higher level of FOXP3 + Tregs ( Figure 2D, 5B) . Average body weight (% of initial weight) for mice surviving on given day for different groups was shown in Figure S3 .. Discussion.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:18130..18366:sentences:f316153b3de04a46b13f1a391902c27e	|FOXP3|FOXP3|FOXP3|	LAP|FOXP3|FOXP3|FOXP3|LAP	In this study, we use LAP as a unique cell surface marker that distinguishes bona fide Tregs from activated FOXP3 + and FOXP3  nonTregs and show that it is feasible to sort expanded FOXP3 + Tregs from nonTregs based on expression of LAP.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:18632..19345:sentences:6914d33b1af15d9f65ed4030d9e989bc	FOXP3|IL2RA	FOXP3|CD25	Similar data has been detected in expanded cord blood (CB) Tregs: the process of ex vivo expansion did not skew the CB Tregs TCR V repertoire [26] . Although it is possible to obtain a highly purified FOXP3 + population after re-stimulation of the expanded CD25 hi cells, it has also been shown that the effector T cells can transiently possess this feature, particularly after repeated in vitro stimulation [27] . Moreover, several studies have pointed out the potential plasticity of Tregs and caution that this instability could result in the generation of pathogenic memory T cells in vivo [28] . In our study, a quantitative assay to assess the anergic state of Tregs is used to detect the cytokine secretion.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:19347..19491:sentences:7b97d4338558164939a05bb65b2f8bc5	IL2|IFNA1|IL17A|IL4|IL13|IL10||IL2RA|	IL2|IFN|IL17|IL4|IL13|IL10|LAP|CD25|LAP	Only minimal percentages of IL2, IFN, IL17, IL4, IL13 and IL10 are detected in the purified LAP + Tregs as compared to CD25 + and LAP population.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:19493..19817:sentences:02eeed3d9b02d4ce545f91288e85000f	IL4|FOXP3||IL10|FOXP3	IL4|FOXP3|LAP|IL-10|FOXP3	This method offers the opportunity to reduce most of the cytokine secreting cells in our culture compared with rapamycin culture system, which still has >50% of cells secreting IL4 (both FOXP3 + and FOXP3  cells) after the fourth re-stimulation [4] . In this study, only minimal percentages of LAP + Treg cells secrete IL-10.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:19819..19937:sentences:ff48adb460999eb6955f3ddb8571aa72	|LRRC32|||LRRC32	LAP|GARP|LAP|LAP|GARP	While the LAP + cells are mainly GARP + cells, the immunosuppressive role of LAP + might be through GARP/LAP complexes.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:19939..20364:sentences:1a5f4478243d53c7b3a99cb5d08fe90f	LRRC32|LRRC32|LRRC32|LRRC32|LRRC32|LRRC32||LRRC32	Glycoprotein A repetitions predominant|GARP|leucine rich repeat containing 32|LRRC32|GARP|GARP|LAP|GARP	Glycoprotein A repetitions predominant (GARP), also known as leucine rich repeat containing 32 (LRRC32), plays important role in immunosuppressive function of Tregs by inhibiting T effector cell activity [29] . Targeting GARP by siRNA or monoclonal antibodies specific for GARP inhibit immunosuppressive activity of Treg in vitro and in vivo [30, 31] . However, the role of LAP/GARP on Tregs remains unclear and controversial.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:20462..20676:sentences:3f3cd6f3a06f995804e80b57ec0a1449	|LRRC32	LAP|garp	They found the suppressive function of Tregs was not affected by knockout of garp in Tregs [32] . Further studies are needed to reveal the mechanisms responsible for suppressive function of LAP + Tregs.. Discussion.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:21125..21372:sentences:0e33a16af321af2edb66dfc08ef14693	FOXP3||FOXP3|	FOXP3|LAP|FOXP3|LAP	This epigenetic marker is highly specific for Tregs and can discriminate them from activated FOXP3 + conventional T cells [34, 35] . When compared with LAP + Tregs, significant levels of FOXP3 TSDR methylation are demonstrated in the LAP  nonTregs.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:21473..21645:sentences:cf16043db23f23cc0ec5a612f20aa04f	|FOXP3|FOXP3	LAP|FOXP3|FOXP3	Some of the LAP  populations contain over 40% FOXP3 + cells, yet they have <20% TSDR demethylation, supporting that these FOXP3 + cells are not bona fide Tregs.. Discussion.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:21810..22048:sentences:0728a4db6462a8f1298a6d209ffeb7cc	LRRC32|LRRC32|	GARP|GARP|LAP	Dr. Lucas group found that the administration of antibody blocking GARP or GARP/TGF-1 abrogate the protection of Tregs in xGVHD [31] . While we are able to demonstrate the suppressive function of LAP + Tregs, these assays have limitations.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:23070..23356:sentences:05eebd9b2ca8006fe82931eab6e0d3ae	IL2RA|FOXP3	CD25|FOXP3	To address this issue, other protocols have implemented rapamycin which has improved the percentage of Tregs, but variability still exists [15, 36] . Consistent with other studies, some of our expanded CD25 + populations maintained >75% FOXP3 + and >60% TSDR demethylation ( Figure 5B ).
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:23358..23665:sentences:d0363fbed4accd13a17f3a56f71ef385	|IL2RA||IL2RA|IL2RA	LAP|CD25|LAP|CD25|CD25	These CD25 + populations did possess sufficient suppressive function similar to the repurified LAP + Tregs ( Figure 6A, C) . We were unable to demonstrate a statistical difference between CD25 + populations and LAP + Tregs due to the high variability in Treg percentage within some of the CD25 + populations.
+SARS:13b16688b86661a6165f9c688c4f45893b7e47c5:fulltext:6b4c23058a1ecbc827796c6861cf33a7:24316..24480:sentences:283e320dc465ae8e58e3ad4e23e1f874	|LRRC32	LAP|GARP	With the application of LAP or GARP repurification, a highly purified, TSDR demethylated Treg population can be achieved which maintains diversity and functionality.
+SARS:166142fd39f6000cf789299a7df7fedc36b300cb:abstract:6d779d7055267438f66d300d49016da0:258..485:sentences:24c6b304ec089570caa5b2c739bf9859	MYD88|	MyD88|Toll-Like Receptors 7 and 9	This response requires pDC-intrinsic MyD88-dependent signaling by Toll-Like Receptors 7 and 9. Provided that they express appropriate recognition receptors such as Ly49H, NK cells can directly sense and kill MCMV-infected cells.
+SARS:166142fd39f6000cf789299a7df7fedc36b300cb:abstract:6d779d7055267438f66d300d49016da0:1306..1473:sentences:71dbce2958f109c63d5c93eb79bfa9a4	MYD88|TLR9	MyD88|TLR9	We show that selective depletion of pDC or genetic deficiencies for MyD88 or TLR9 drastically decreased production of IFN-I, but not the protective antiviral responses.
+SARS:166142fd39f6000cf789299a7df7fedc36b300cb:abstract:6d779d7055267438f66d300d49016da0:1974..2078:sentences:193b43a975ede4ac5aa5c4723884dd89	MYD88|IRAK4	MyD88|IRAK4	Similar mechanisms likely contribute to protect MyD88- or IRAK4-deficient patients from viral infections.
+SARS:1430ebabc4bb953366b635cd4a8adf9956c2f86b:fulltext:8b67b4fe98e4fc895bd2a04105cb1d68:23090..23290:sentences:cc2f9d4f9129b3ea1e993158f53d4ede	GNLY|LAG3|LAG3|GNLY	lag 2|lag 3|lag 3|lag 2	This same model was used for 4 countries-Japan (lag 2), Hong Kong (lag 3), Taiwan (lag 3) and Singapore (lag 2)-and for 3 meteorological parameters-temperature, absolute humidity and relative humidity.
+SARS:140e6d0298bfcd1e825a4b81dcabc50d1658357a:fulltext:9b3b009d5735c6df87cffa5d5bc8986c:2270..2561:sentences:bb3ebdcbddf25cf3253715dc61e52aed	ACE2|DPP4|DPP4|SARS	angiotensin converting enzyme 2|dipeptidyl peptidase 4|DPP4|SARS	10 While SARS-CoV infects type 2 pneumocytes and ciliated bronchial epithelial cells utilizing angiotensin converting enzyme 2 as a receptor, MERS-CoV exploits dipeptidyl peptidase 4 (DPP4), a transmembrane glycoprotein, to infect type 2 pneumocytes and unciliated bronchial epithelial cells.
+SARS:140e6d0298bfcd1e825a4b81dcabc50d1658357a:fulltext:9b3b009d5735c6df87cffa5d5bc8986c:3191..3324:sentences:84388a5bb8544c2cfa660a30ff8bfdd5	ACE2|SARS	angiotensin converting enzyme 2|SARS	16, 17 It has also been hypothesized that the novel virus might use angiotensin converting enzyme 2 as a receptor similar to SARS-CoV.
+SARS:140e6d0298bfcd1e825a4b81dcabc50d1658357a:fulltext:9b3b009d5735c6df87cffa5d5bc8986c:7813..8040:sentences:e3bfd630d3c988b3644311db0f0e123d	GPT|SARS	aspartate aminotransferase (AST) or alanine aminotransferase|SARS	Among these 140 cases, 61 (44%) had lymphopenia; 58 (41%) had an elevation of either aspartate aminotransferase (AST) or alanine aminotransferase (ALT) above the upper limit of the reference range 29, 30 (also seen in SARS-CoV).
+SARS:140e6d0298bfcd1e825a4b81dcabc50d1658357a:fulltext:9b3b009d5735c6df87cffa5d5bc8986c:8553..8704:sentences:eb3fe28481b69075d803b80ed8bfb536	IL10|SARS	interleukin 10|SARS	30, 32 However, increased levels of interleukin 10, which is an anti-inflammatory cytokine, suggest a pattern different from that of SARS-CoV infection.
+SARS:16d4d6332fb5f17df0c487e2c9202716d01889be:fulltext:15a3916fc9a2fcbdf26f3a203303f27a:8695..9045:sentences:a841fed5f5ce7de77d1d593bdf94e18a	CD4|CD8A	CD4|CD8	T lymphocyte subsets showed a decrease in both CD4  and CD8  T cell subsets, and neutrophil-to-lymphocyte ratio is an early and reliable indicator for the development of severe COVID-19, suggesting that SARS-CoV-2 can consume lymphocytes, which may also be an important reason for the virus to proliferate and spread in the early stage of the disease.
+SARS:16a0ebcd5eb1e82163124385f047fa2a4eda49f8:abstract:a302db886f845fbb675f46e98b0613e1:0..168:sentences:be80cf56c6f3d4040b1b5b32cfb63f43	PPP1CA||GORASP1||TEP1	pp1a|p28|p65|p50|p240	Proteolytic processing of the mouse hepatitis virus strain A59 (MHV-A59) replicase gene product, pp1a, results in polypeptides p28, p65, p50, and p240 in infected cells.
+SARS:16a0ebcd5eb1e82163124385f047fa2a4eda49f8:abstract:a302db886f845fbb675f46e98b0613e1:170..300:sentences:189a851b1099ba232aba31d197c50787	|GORASP1|	p28|p65|p50	Based on previously identified p28 and p65 cleavage sites, a p50 cleavage site was proposed to occur between Ala-1262 and Ala-1263.
+SARS:16a0ebcd5eb1e82163124385f047fa2a4eda49f8:abstract:a302db886f845fbb675f46e98b0613e1:302..472:sentences:c7e3319abf276f90bc579ed85b34563b	PLP1||	PLP-1|p50|p28	Results of mutagenesis and in vitro cleavage assays show that PLP-1 was able to cleave in trans when the proposed p50 cleavage sequence replaced the p28 cleavage sequence.
+SARS:16a0ebcd5eb1e82163124385f047fa2a4eda49f8:abstract:a302db886f845fbb675f46e98b0613e1:474..692:sentences:6e73630e4f0d15b05a9a0d79b09f75b1	GORASP1|DDX17	p65|p72	Mutagenesis was also used to investigate cleavage between Gly-904 and Val-905, a cleavage site predicted to produce a precursor of p65, p72, that was detected in cells infected with MHV strain JHM, but not with MHV-A59.
+SARS:16a0ebcd5eb1e82163124385f047fa2a4eda49f8:abstract:a302db886f845fbb675f46e98b0613e1:694..810:sentences:cc0d91cb5a21e00ee2d4188b9391946d	DDX17|GORASP1	p72|p65	No cleavage could be detected using substrate that carried both the p65 site and the predicted p72 cleavage sequence.
+SARS:16a0ebcd5eb1e82163124385f047fa2a4eda49f8:abstract:a302db886f845fbb675f46e98b0613e1:812..948:sentences:334f8dcd605650aff68e8d278d32b2eb	PLP1||DDX17	PLP-1|p50|p72	Thus, it appeared that PLP-1 could recognize the proposed p50 sequence but not the predicted p72 site under the in vitro conditions used.
+SARS:15f99a27eec125edd5f2c431344f01883ff72129:fulltext:c2b0aab2e13a79451c33f5f29e3c591c:25093..25432:sentences:aa66b4ae4d92d77b0dd4b94fbc46ea33	IFNA1|STAT1|STAT2|STAT2|RAF1	downregulate type 1 interferon (IFN)|STAT1|STAT2|STAT2|NS5	Zika has been demonstrated to downregulate type 1 interferon (IFN) response of dendritic cells through impairment of phosphorylation of STAT1 and STAT2 117 with others finding that the Zika virus non-structural 5 (NS5) protein results in proteasomal degradation of STAT2 in 293T cells 118 -the latter phenomenon also seen with dengue virus.
+SARS:15f99a27eec125edd5f2c431344f01883ff72129:fulltext:c2b0aab2e13a79451c33f5f29e3c591c:25434..25612:sentences:6dbf14ee98fa92a777c10af944da4dc8	RAF1|STAT2	NS5|STAT2	118 In contrast to humans, the Zika NS5 does not affect murine STAT2 function, such that Rag I / mice, lacking mature T and B cell cells, remain resistant to Zika virus infection.
+SARS:15f99a27eec125edd5f2c431344f01883ff72129:fulltext:c2b0aab2e13a79451c33f5f29e3c591c:30283..30547:sentences:130c734c6e13a2804a0d83452877f0ea	IVNS1ABP|IFNA1	NS1|IFN	Finally, an ideal vaccine would also induce cellular immunity, especially CD8C T-cell responses as these may serve to prevent CNS and testicular damage despite dysregulation of the type I IFN pathways caused by the Zika NS1 protein.. Zika virus vaccine development.
+SARS:16a4b3acbf0f8aeecd2156786377cbe85bd648aa:abstract:05746ce2b4d02cd7e4c042d34c8cff6d:852..964:sentences:f83c70c69686acce6d2935aad7d256b3	AGO2|AGO2|MEF2D|EVL|PI3|DEFA4|S100A12	EIF2C2|Ago 2|MEF2D|EVL|PI3|DEFA4|S100A12	The differential expression of 6 genes, EIF2C2 (Ago 2), MEF2D, EVL, PI3, S100A12 and DEFA4 was confirmed by QPCR.
+SARS:17413f651645c2b9c92555e9ce1404b9290eccab:abstract:5cab2635b4963fa0c104e17eddf20a9e:825..1047:sentences:a60f098d0f31ede6a09aaf78f2f61d75	TMPRSS2|TMPRSS4|TMPRSS2	TMPRSS2|TMPRSS4|TMPRSS2	We found that all NHP orthologues of human TMPRSS2, TMPRSS4 and HAT cleave and activate HA upon directed expression and provide evidence that endogenous TMPRSS2 is expressed in the respiratory epithelium of rhesus macaques.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:4091..4711:sentences:7aefbb479ad95f833ca3791f63a9b78d	IFNA1|RNASEL	IFN|RNase L	Altogether, our findings indicate that in our system RNA silencing is not active against Sindbis virus (SINV) and might open the way to a better understanding of the antiviral response mediated by a novel class of small RNAs.. One key factor involved in IFN type I-mediated host defense is RNase L, a latent cytoplasmic endoribonuclease that is activated by 2=,5=-oligoadenylates in response to double-stranded RNA (dsRNA) sensing and that cleaves both viral and cellular RNAs (6) .. IMPORTANCE In a continuous arms race, viruses have to deal with host antiviral responses in order to successfully establish an infection.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:5870..6629:sentences:e5f425c2354ea683467089e04b0e1726	DROSHA|DROSHA|DICER1|SCPEP1	RNase III|Drosha|Dicer|RISC	miRNAs are evolutionarily conserved small RNAs derived from large primary transcripts, which are sequentially processed by the respective nuclear and cytoplasmic RNase III enzymes, Drosha and Dicer, to generate mature single-stranded~21-or 22-nucleotide (nt) RNAs (8, 9) . Similar to siRNAs, they are incorporated into an effector Ago-containing RNA-induced silencing complex (RISC), whereby they mediate posttranscriptional regulation of target mRNAs via partially complementary sites (10) . On one hand, miRNAs of cellular origin can directly or indirectly regulate viral infections (11, 12) . On the other hand, some viruses have evolved the capacity to encode their own miRNAs, which represent an ideal tool to stealthily modulate the cellular environment.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:10618..10959:sentences:bace43c7b270911eeb6918c2b7072f07	IFNA1|RNASEL	IFN|RNase L	We set out to identify the factors involved in their biogenesis and show that they do not depend on the RNA silencing machinery, but rather, that they are downstream products of the cytoplasmic IFN-induced endoribonuclease RNase L. Finally, we also present experimental evidence that these viral small RNAs are modified at their 3= extremity.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:15834..15976:sentences:a31bd2c5e1ca87aeab7beebba3eabd25	DROSHA|DICER1|AGO2	Drosha|Dicer|Ago2	Hence, we transfected siRNAs against Drosha, Dicer, or Ago2 followed by an infection with SINV and an analysis of viral small RNA accumulation.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:15978..16235:sentences:03bee122430751257a4bf47883917bef	DICER1|AGO2|DROSHA|DROSHA	Dicer|Ago2|Drosha|Drosha	Although Drosha is known to be mostly nuclear, we also took it into consideration because it was recently shown to relocalize to the cytoplasm upon SINV infection (21) . Although we were able to downregulate very efficiently Drosha, Dicer, and Ago2 (see Fig.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:16755..16930:sentences:7dd20d63f4cf9232dad366d87a902afb	DICER1|DROSHA	Dicer|Drosha	It has been reported that small RNAs, which are not generated by Dicer or Drosha cleavage, could nevertheless be assembled into Argonaute proteins (e.g., tRNA fragments [27] ).
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:17076..17202:sentences:48c2b82f6cea026fcb3d46de344e544b	GDE1|AGO2	miR-16|Ago2	However, although we could detect the accumulation of the cellular miRNA miR-16, using both an antibody specific for Ago2 (Fig.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:17284..17483:sentences:7c87975eb9dbb0c41fa69876702ff0aa	SCPEP1|RNASEL	RISC|RNase L	S4H , right panel), we were unable to detect SvsRNAs within immunoprecipitated RISC.. SINV-derived small RNAs accumulate in infected mammalian cells.. RNase L is involved in the production of SvsRNAs.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:18850..19071:sentences:c966ec1474440ee05cbae3b33dbe4fb6	RNASEL|PSMD5	RNase L|S5B	S5B and C).. SINV-derived small RNAs accumulate in infected mammalian cells.. Given the cleavage properties of RNase L (see next section), it was unlikely that the identified small RNAs were direct products of this enzyme.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:19586..19784:sentences:0980e5579b471032721cceb805498b69	RNASEL|DICER1|RNASEL|DICER1	RNase L|Dicer|RNase L|Dicer	We found that the double knockdown of both RNase L and Dicer did not affect the accumulation of SvsRNA-1 compared to the single RNase L knockdown, which confirms that Dicer does not play a role (Fig.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:19786..19941:sentences:0e3e547d1212ad11922d06c7c73ee1ce	RNASEL|XRN1|RNASEL	RNase L|Xrn1|RNase L	S6A) . On the contrary, the accumulation of SvsRNA-1 upon double knockdown of both RNase L and Xrn1 increased compared to the single RNase L knockdown (Fig.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:19950..20107:sentences:7c772104d3ee79a0f59a876c3e63b175	RNASEL|XRN1	RNase L|Xrn1	This finding suggests that both RNase L and Xrn1 can act upon viral RNAs and have opposite activities in terms of generation and stabilization of the SvsRNAs.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:20109..20302:sentences:5ce30951b63f05bfd08fbf82638ba814	XRN1|RNASEL|RNASEL|RNASEL	Xrn1|RNase L|RNase L|RNase L	Xrn1 might act upstream of RNase L in degrading, for example, uncapped viral RNAs that would otherwise be a substrate for RNase L; alternatively, it could directly act upon the RNase L products.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:20304..20451:sentences:a68d4b0ee8a7e9e8032cc027ceb3616d	XRN1|RNASEL	Xrn1|RNase L	The former hypothesis is more likely though because Xrn1 has a preference for 5= phosphorylated RNAs, whereas RNase L leaves a 5= OH after cleavage.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:20846..21148:sentences:7a4d747db60dd785fd83c256546d8926	DIS3L|DIS3L2|EXOSC3|EXOSC3	DIS3L|DIS3L2|Rrp40|EXOSC3	S6B) .. SINV-derived small RNAs accumulate in infected mammalian cells.. We also tested several cytoplasmic 3=-5= exoribonucleases, including DIS3L, DIS3L2, and Rrp40 (also known as EXOSC3, a core subunit of the exosome); knockdown of these factors had no effect on SvsRNA accumulation (data not shown).
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:22985..23126:sentences:6d5ebed9793427f2b807cc1d60b7c507	RNASEL|XRN1	RNase L|Xrn1	The presence of hydroxyl groups in positions 2= and (B and E) SINV genomic RNA was quantified by RT-qPCR, before and after RNase L or Xrn1 KD.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:23259..23367:sentences:9da51fa924e29352f48da7e74a9e832d	RNASEL|XRN1	RNase L|Xrn1	(C and F) Northern blot analysis on total RNA from infected HEK293 cells before and after RNase L or Xrn1 KD.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:25339..26343:sentences:e018f92fe987576bbee220a600e03d43	PIWIL1|RNASEL	Piwi|RNase L	3C, lane 16) .. SINV-derived small RNAs accumulate in infected mammalian cells.. Taken together, these results show that SvsRNA-1 is modified at its 3= extremity but that the modification is not due to a monophosphate group caused by a direct RNase L cut.. SINV-derived small RNAs accumulate in infected mammalian cells.. Viral genomic RNA is modified on A 8333 . The presence of posttranscriptional modifications, such as 2=-O-methylation, is a characteristic of several cellular RNAs in mammals, such as rRNAs (32) , snRNAs (33) , and Piwi-interacting RNAs (piRNAs) (34, 35) .. SINV-derived small RNAs accumulate in infected mammalian cells.. Recently, it has also been reported for several viruses that their genomic RNA can be 2=-O-methylated at specific positions (36, 37) . We hypothesized that the modification on the small RNA could be derived from a modification at the level of the genomic RNA, which is reasonable given the fact that SvsRNA-1 precursor RNAs also appear to be modified (see Fig.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:35092..35235:sentences:83c44e9c029e4c17d255826f03976727	DICER1|AGO2|DROSHA	Dicer|Ago2|Drosha	Nonetheless, we tested whether the miRNA machinery was required for the production of viral small RNAs by knocking down Drosha, Dicer, and Ago2.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:36217..36545:sentences:4ebc613fec01b2486617f055c67b2a88	RNASEL|XRN1	RNase L|Xrn1	RNase L is known to play an antiviral role against viruses such as West Nile virus (49), hepatitis C virus (50) , and SINV (51) . We also looked at the involvement of exoribonucleases in the production of SvsRNAs and found that, indeed, the accumulation of these small RNAs is counteracted by the cellular 5=-3= exonuclease Xrn1.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:40438..40790:sentences:7eac5cd696f1a4476eee482727e1e729	RNASEL|DICER1	RNase L|Dicer	An alternate hypothesis could also be that SINV encodes an RNA silencing suppressor that blocks Dicer activity but has no effect on RNase L. Finally, it is also possible that the antiviral RNAi response might be detected only in specific subtypes of cells in mammals, which would be different from the differentiated somatic cells we used for our study.
+SARS:1685a03eac1fe5f949aa6b7889e02dadf9d3f90f:fulltext:635d4d941d3840a7bb07b5b1e4a4bda6:41964..42297:sentences:1f751086dbdfb1bd258203f1037e007e	RNASEL|XRN1|DROSHA|DICER1|AGO2	RNase L|Xrn1|Drosha|Dicer|Ago2	Transfections were carried out for 72 h using 20 nM ON-TARGET plus Smart Pool siRNAs (Dharmacon) for one-step depletion (human RNase L and Xrn1) or 100 nM ON-TARGET plus Smart Pool siRNAs (Dharmacon) for two-step depletion (human Drosha, Dicer, and Ago2) with Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions.
+SARS:17b86179a0fc5d8a3c1bff7bab39674a196946e1:abstract:8bdb016f01efc2bb5ad1e06ad499e9a9:798..1030:sentences:c11778ad573a4e1ee9b0eefb55eb4ae1	IL6|IL10	IL-6|IL-10	Increased amounts of plasma IL-6 and IL-10 were found in both groups on the admission day, the progressive decrease of which occurred in NIV cases rather than IMV cases, and the levels were higher in IMV cases during hospitalization.
+SARS:17b86179a0fc5d8a3c1bff7bab39674a196946e1:abstract:8bdb016f01efc2bb5ad1e06ad499e9a9:1032..1265:sentences:176d20752a3f84ac48894fa359736e90	IL6|IL10	IL-6|IL-10	Conclusions: Lymphocytopenia, neutrophilia, and increase of IL-6 and IL-10 occurred in SARS-CoV-2 infected patients in ICU, however, the dynamics of those were significantly different in IMV cases and NIV cases during hospitalization.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:3394..4101:sentences:fe579fc6a88607c4db9fcb2b6a8dd82c	CSF2|IL1A|IL18|IL25|IL33|TNF|TSLP	GM-CSF|IL-1a|IL-18|IL-25|IL-33|TNF-a|TSLP	Though keratinocytes are unlikely to have the potential for priming nave T cells in a steady state, they might be able to stimulate antigen-experienced T cells under certain inflammatory conditions [14] . Activated keratinocytes are involved in the generation of adaptive immune responses via the release of chemokines and cytokines, including GM-CSF, IL-1a/b, IL-18, IL-25, IL-33, TNF-a and thymic stromal lymphopoietin (TSLP), all of which have been shown to influence differentiation, migration and/or polarizing capacities of DCs [15] . In addition to keratinocytes, which account for 80% of all epidermal cells, melanocytes, Merkel cells and Langerhans cells (LCs) populate the epidermis.. Introduction.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:6137..6296:sentences:766d60df2b692bc0b48ef3cc418b84a0	CD207|ITGAM	Langerin|CD11b	About 80% of dDCs is made up by Langerin -dDCs, which themselves can be divided into at least two subsets, based on the presence or absence of CD11b expression.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:13333..13903:sentences:7e545a698bf14004946552a89de8022f	TNF|CSF2|IL1B	TNF-a|GM-CSF|IL-1b	(2013) 10 (6) different pattern recognition receptors of the innate immune system, including toll-like receptors (TLRs) and nucleotide oligomerization domain receptors, they are able to recognize pathogen-associated molecular patterns (PAMPs), such as lipopolysaccharides, peptidoglycans, flagellin, CpG motifs from DNA and single-stranded as well as double-stranded RNA [15] . Production of cytokines, such as TNF-a, GM-CSF and IL-1b, by keratinocytes provides maturation and migration signals for LCs and DCs, which act as a bridge between innate and adaptive immunity.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:14325..14597:sentences:fe4e1b18bad41c0fa128d7807aa6b275	IL25|IL33|TSLP	IL-25|IL-33|TSLP	Application of antigen to barrier-disrupted skin is being discussed as a prerequisite for allergic sensitization [37] . Candidate molecules for initiating such TH2-dominated responses following epithelial trauma include IL-25, IL-33 and TSLP released from epithelial cells.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:14599..15042:sentences:e7a1203f2a33bb109661a37d1a521f6d	RAE1|MICA|KLRK1	Rae-1|MICA|NKG2D	In a recent work it has been shown that in response to barrier disruption, keratinocytes upregulate MHC-like ligands, such as Rae-1 (in mice) or MICA (in humans), which bind to the activating receptor natural killer cell lectin-like receptor 2D (NKG2D) on intraepithelial gd T cells, eventually inducing TH2-driven responses against concomitantly acquired antigen ( Figure 1B ) [38] .. Tailoring immune responses by transcutaneous immunization.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:15295..15750:sentences:1239614048da1304ec4808e1cc4fb291	TSLP|IL25|IL33|NELFCD|IL1A|TNF	TSLP|IL-25|IL-33|TH1|IL-1a|TNF	According to this model, relatively mild epithelial stress, such as by abrasion, results in a dominant expression of TSLP, IL-25 and IL-33, preferentially triggering TH2/Treg responses, whereas in the case of deep epithelial trauma, TH1/TH17 T cells are induced by type I IFN, IL-1a and TNF ( Figure 1C ) [39] . Targeting different skin layers by transcutaneous immunization may therefore induce appropriate immune response types for specific requirements.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:24030..24523:sentences:e9deeb61fc2a1d2f32b2baca429fe73d	CD207|ITGAM|CD207|ITGAM|CD4	CD207|CD11b|CD207|CD11b|CD4	However, whereas subcutaneous delivery of antigen led to predominant uptake by CD207 -CD11b -DCs, laserporation also induced uptake by CD207 -CD11b + DCs, a DC subset known for effective induction of CD4 T-cell activation and humoral immunity [69] . Compared to subcutaneous injection, laserporation induced a significantly higher T-cell proliferation of adoptively transferred OVA-specific T cells at equal doses, although certainly not 100% of the applied antigen was taken up via micropores.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:24628..24850:sentences:a7c57a20f561ce0b9b3f1156e7378984	CD207|CD4|CD207	Langerin|CD4|Langerin	Selective ablation of Langerin + cells showed that activation of CD4 + OVA transgenic T cells was partly dependent on the presence of Langerin + cells [58] .. Immune responses after antigen application to laserporated skin.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:25020..25109:sentences:6fd675de0c6c04ba1d7ea7289736d2e7	IL17A|CSF2	IL-17|GM-CSF	Notably, IL-17 and GM-CSF, both involved in TH17 cell Reproduced with permission from Ref.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:25722..25955:sentences:a2f82ca35968445f14bda2ccb5a982e9	IFNG|IL4	IFN-g|IL-4	In these experiments, a clear TH2 response with high IgG1 to IgG2a ratio, induction of IgE, lack of IFN-g and induction of IL-4 could be measured, irrespective of pulse number, antigen (OVA, b-galactosidase or Phl p5) or antigen dose.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:26579..26975:sentences:88ddff82f7c129fb57ef9b1f83b3e261	NELFCD|AHR	TH1|AHR	Of the tested agonists, CpG-ODN proved to be most potent with regard to induction of TH1 cellular responses and suppression of IgE [58] and were subsequently used to evaluate a protective transcutaneous vaccination approach against allergic sensitization and airway hyperresponsiveness (AHR) with the grass pollen allergen Phl p 5.. Immune responses after antigen application to laserporated skin.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:28042..28237:sentences:7914bc8925769d8b228552bff6d1e364	AHR|NELFCD	AHR|TH1	Interestingly, TCIT without any TH1-promoting adjuvant proved to be as effective as the adjuvanted approach; it successfully alleviated AHR and reduced the numbers of lung-infiltrating leukocytes.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:32003..32516:sentences:f9ed19fff1786625aae2c6e24c6d0630	IL4|IFNG	IL-4|IFN-g	This also resulted in increased immunogenicity of an intradermally injected DNA vaccine, inducing higher antibody titers, secretion of IL-4 and IFN-g, and increased antitumor activity compared to the same vaccine without laser treatment [80] . These results demonstrate that laserfacilitated immunization of needle-injected DNA vaccines is also a feasible approach when tissue damage and the concomitant release of nucleases into intercellular spaces can be avoided.. Laser-assisted vaccination with gene vaccines.
+SARS:17114faf3bbc2a82ef49762ce4f3f922cb213f4e:fulltext:23b9ba5d5896e24b6b007cb378ed6d20:34544..34894:sentences:eba51732713a4066c94870cd3b57515b	IL17A|CSF2|NELFCD	IL-17|GM-CSF|TH1	However, delivering antigen to the dermal compartment via deep pores induced IL-17 and GM-CSF, both involved in TH17 cell differentiation [58] . These findings match the widely accepted hypothesis that superficial epithelial damage favors TH2/Treg induction, while deep (epi)dermal trauma results in induction of TH1/TH17 response [39] .. Conclusions.
+SARS:17d5ae159dfe162ac57318232144b103e79e0f1c:title:a5c4115cf6159b3727911eddcb3b8be8:0..161:sentences:1088fce257569e6e86143b6fb9168656	LY75-CD302|MPPE1|CDK1	DEC205|cDC1|cDC2	Characterization and expression of DEC205 in the cDC1 and cDC2 subsets of porcine dendritic cells from spleen, tonsil, and submaxillary and mesenteric lymph nodes
+SARS:17ee0d9709a4a7ed089ec7358e9cdeb33776a333:title:16ba7640cea323108053d3006c3d3cf8:0..79:sentences:4dc12e6561182c8c3efadc44f8dc0478	ACE|AGT	Ace|AngII	Rat Ace allele variation determines susceptibility to AngII induced renal damage
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:27..721:sentences:eb78a769aa3455a4a5a5deb17900ecd1	FOXP3|CD4	Foxp3|CD4	Regulatory CD4 T cells (T reg cells), which are characterized by expression of Foxp3, are major contributors to the antiinflammatory response in the settings of autoimmune disease, cancer, and infections (Vignali et al., 2008) . In infectious settings, they help to resolve the proinflammatory response, thereby minimizing bystander damage but also potentially delaying or preventing pathogen clearance (Belkaid, 2007) . T reg cells may also be required for efficient immune cell entry into sites of infection (Lund et al., 2008) . Pathogen-specific T reg cells have been detected in a few studies using whole pathogen preparations as targets, without identification of specific target epitopes.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:1701..2159:sentences:f28b00ed67306032c77051a1bc511a86	FOXP3|CD4	Foxp3|CD4	Thus, adoptive transfer of T reg cells from naive spleens (natural T reg cells) into infected mice decreased weight loss, clinical scores, and demyelination (Trandem et al., 2010) . However, whether any of these T reg cells are virus specific and whether virus-specific T reg cells are immunosuppressive in a cognate epitope-dependent manner are not known.. Foxp3 + CD4 regulatory T cells (T reg cells) are important in limiting immunopathology in infections.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:3052..3296:sentences:bfc63b8f48e2aa670de3061cbeea326f	IL10|IL17A	IL-10|IL-17	topes by cytokine production is also applicable in autoimmune disease because myelin oligodendrocyte glycoprotein-specific Foxp3 + T reg cells express IL-10 and IL-17 at the peak of disease in mice with experimental autoimmune encephalomyelitis.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:3298..3524:sentences:6fa079605d6dad3043ec78853d8ab305	FOXP3|FOXP3|CD4	Foxp3|Foxp3|CD4	These results show that pathogen epitope-specific Foxp3 + T reg cells can be identified on the basis of cytokine production.. Foxp3 + CD4 regulatory T cells (T reg cells) are important in limiting immunopathology in infections.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:4634..5080:sentences:f5c0b476b8482506de6048d164a62936	IFNA1|IFNA1|IFNA1|CD4	IFN-|IFN|IFN|CD4	In addition, after stimulation with anti-CD3 mAb, the fraction of T reg cells expressing IFN- increased two-to fourfold, suggesting that M133 + S358-specific T reg cells accounted for only a fraction of all IFN- + T reg cells in the CNS (Fig. 2, B-D) . Notably, the mean fluorescence intensity of IFN- expression was lower in M133 + S358-specific T reg cells compared with effector CD4 T cells, indicating less expression on a per-cell basis (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:5209..5420:sentences:4baa2265d0d9cc717f2498a7b0f51fe0	FOXP3|IFNA1|IFNA1|CD4	Foxp3|IFN|IFN-|CD4	2 E; Liu and Whitton, 2005) . In the absence of BFA, some Foxp3  CD4 T cells were IFN- + , consistent with results showing that cells in the infected brain express IFN- in the absence of ex vivo stimulation (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:5422..5609:sentences:53de34038ced87d40bf5021301d8c87a	FOXP3|FOXP3|IFNA1	Foxp3|Foxp3|IFN-	2 A) . The frequency of Foxp3  and Foxp3 + cells expressing IFN- increased twofold and In this paper, we identify two epitopes (M133 and S358) targeted by T reg cells in the rJ2.2-infected
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:5962..6369:sentences:f3be82fb81bf31db328d8fd8278ca101	FOXP3|CD4|	Foxp3|CD4|TCR	Virus-specific T reg cells appear to arise, at least in part, from natural T reg cell pools because they are detected in naive Foxp3 gfp mice and mice retrogenic (Rg) for an M133-specific T cell receptor (TCR) and express the transcription factor helios.. RESULTS AND DISCUSSION Virus-specific effector CD4 T cells and T reg cells are detected at the same time after infection in the brains of rJ2.2-infected
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:6471..6645:sentences:683acfb92ec50e6ec1fea1e02b67f3a9	FOXP3|CD4	Foxp3|CD4	The frequency of Foxp3 + T reg cells was 20-30% at 3 and 5 d after infection, decreasing to <10% of total CD4 T cells in the brain and spinal cord by 7 d after infection (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:7135..7510:sentences:49f2c8c265655c827ab2aab402fff610	CD4|CD4|CD8A	CD4|CD4|CD8	We previously showed that virus-specific effector CD4 and CD8 T cells were detected in the infected brain at 6-7 d after infection (Haring et al., 2001) . MHC class II/peptide tetramers are available for detecting epitope M133-specific CD4 T cells, and using these tetramers, we also detected M133-specific T reg cells in the brain and spinal cord at 7 d after infection (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:8015..8050:sentences:dd8c5cab634835db1898198bf496b7e9	IFNG|IL10	IFN-g|IL-10	T reg cells express IFN-g and IL-10.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:8908..9110:sentences:d9814be0a6a4292ace62fd258de2a73d	IFNA1|CD4	IFN|CD4	Consistent with the in vitro peptide stimulation analyses, the mean fluorescence intensity of IFN- expression was lower in T reg cells compared with effector CD4 T cells after in vivo BFA treatment (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:9135..9170:sentences:2fb892d25119ec6022bcc6bd033e249a	IFNG|IL10	IFN-g|IL-10	T reg cells express IFN-g and IL-10.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:9172..9278:sentences:5ada89a59aff907b52fe31cb60083042	TNF|IL2|IFNA1	TNF|IL-2|IFN-	A majority of these virus-specific IFN- + T reg cells expressed TNF but virtually none expressed IL-2 (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:9401..9460:sentences:caa7da4af73a8be51f3a800dc36d7cf8	IFNA1|IL10	IFN|IL-10	3 (C and D), 50% of IFN- + T reg cells also expressed IL-10.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:9867..9902:sentences:ea5c8cc98d17026630ed0cebbd5d23f4	IFNG|IL10	IFN-g|IL-10	T reg cells express IFN-g and IL-10.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:10290..10409:sentences:0fda0ad2e71f2f1a8784dd3f679c9d3d	IFNA1|FOXP3	IFN|Foxp3	A similar percentage of M133 + S358-specific T reg cells expressed IFN- as was detected in infected Foxp3 gfp mice (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:10882..10990:sentences:4a8514d1136d8d4f4994fa9d53337efc	FOXP3|FOXP3|IFNA1	Foxp3|Foxp3|IFN-	5.1  0.5 and 4.6  0.3% of Foxp3  and Foxp3 + cells, respectively, expressed IFN- after in vivo BFA treatment.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:10992..11287:sentences:7e594019c7706a763a87d4e0fda3d27c	IFNA1|CD4	IFN|CD4	(F) IFN- is expressed at higher levels in effector CD4 T cells than in T reg cells after peptide M133 + S358 stimulation (data from 10 single or pooled brain samples analyzed at 7, 14, or 28 d after infection are combined) or after in vivo BFA treatment (six mice in two independent experiments).
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:11369..11490:sentences:e058d3c57564588e15fa0a0c54fb2684	FOXP3|FOXP3|FOXP3|CD4	Foxp3|Foxp3|Foxp3|CD4	ramers, we detected 163  10 Foxp3  and 25  2 Foxp3 + M133-specific CD4 T cells per three naive Foxp3 gfp mice (n = 3; Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:11700..11825:sentences:320ef85cc57e979bda55948bb691f1bf	FOXP3|CD4|	Foxp3|CD4|TCR	0.2-5% of splenic CD4 T cells were M133 specific in uninfected M133 TCR Rg mice and, of these cells, 0.5-1% were Foxp3 + (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:11934..12095:sentences:ada5c59770e2e709b461e8566d90429d	IFNA1|CD4|	IFN-|CD4|TCR	To determine whether IFN- + M133-specific T reg cells were detectable in infected M133 TCR Rg mice, we infected mice that contained <1% Rg CD4 T cells with rJ2.2.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:12097..12175:sentences:cadec090b2aba738b6c6b6a8b54472a9	IFNA1|CD4	IFN-|CD4	The frequency of M133-specific CD4 T cells as assessed by IFN- expression (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:12292..12396:sentences:f5923ba31f11bd9e15405027dbdf3ff8	FOXP3|IFNA1	Foxp3|IFN	A small fraction of these cells were Foxp3 + and most expressed IFN- after M133 peptide stimulation (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:12941..13262:sentences:7289452145defe9ed76fb8770d2d3529	IFNA1|IL10|IL17A|MOG|MOG	IFN|IL-10|IL-17|myelin oligodendrocyte glycoprotein|MOG	S4) . However, many of the IFN- + cells were helios intermediate, making it uncertain as to whether all of these cells were thymically derived.. IL-10 + and IL-17 + myelin oligodendrocyte glycoprotein (MOG) 35-55 -specific T reg cells are present in the brains of mice with experimental autoimmune encephalomyelitis (EAE).
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:13296..13386:sentences:600ac0d9653ed264cdd583d9b40e7c01	IFNA1|IL10	IFN-|IL-10	mice showed that virus-specific T reg cells expressed IFN- and IL-10 in the inflamed brain.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:13388..13550:sentences:b6a9a091e01ebe470584f99cf6432a6c	MOG|FOXP3	MOG|Foxp3	To determine whether this was also true in autoimmune settings, we examined cytokine production by MOG 35-55 -specific T reg cells in Foxp3 gfp mice with EAE (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:13558..13683:sentences:06dc78e01d6e4fae5ce07d291a4c6b46	FOXP3|CD4	Foxp3|CD4	In these mice, 12 and 32% CD4 T cells in the inflamed brain were Foxp3 + at 15 and 32 d after immunization, respectively (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:13685..13881:sentences:4995b6197f0790b6ee38f09a2236d70b	|MOG	IL-10, IFN-, and IL-17|MOG	S5 C) . To determine whether these T reg cells expressed cytokines in response to peptide stimulation, we exposed cells directly ex vivo to MOG 35-55 and measured IL-10, IFN-, and IL-17 production.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:13883..14018:sentences:f46203a43e899b1a91c01304ed18c7da	IL10|IL17A|MOG	IL-10|IL-17|MOG	IL-10 was expressed by the majority of cytokine-producing MOG 35-55specific T reg cells, whereas small percentages expressed IL-17 (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:14127..14312:sentences:d20be40bc7d7b3efd3c2b7e53232b4e7	IL10|IL17A|MOG|MOG	IL-10|IL-17|myelin oligodendrocyte glycoprotein|MOG	S5 E) .. IL-10 + and IL-17 + myelin oligodendrocyte glycoprotein (MOG) 35-55 -specific T reg cells are present in the brains of mice with experimental autoimmune encephalomyelitis (EAE).
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:14695..15002:sentences:cc59d5291a2a21d598da2ee18660a208	|CD4	IL-10 and IFN|CD4	However, we previously showed that this tetramer was not as efficient as cytokine expression in identifying M133-specific effector CD4 T cells (Zhao et al., 2009) . Subsequently, we identified a greater frequency of M133-specific T reg cells by cytokine staining for IL-10 and IFN- after peptide stimulation.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:15597..15781:sentences:65a7adf4ffd7a88fd3a6782a257ce60a	IL10|IL17A|MOG|MOG	IL-10|IL-17|myelin oligodendrocyte glycoprotein|MOG	4 B) .. IL-10 + and IL-17 + myelin oligodendrocyte glycoprotein (MOG) 35-55 -specific T reg cells are present in the brains of mice with experimental autoimmune encephalomyelitis (EAE).
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:16289..16483:sentences:eb97e6992472d2b17be91176bdac3cb6	CD69|ICOS|CTLA4|IL10	CD69|ICOS|CTLA-4|IL-10	Consistent with this, brain-derived T reg cells expressed higher levels of CD69, ICOS, and CTLA-4 directly ex vivo and of IL-10 after stimulation with anti-CD3 antibody or PMA and ionomycin (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:17408..17524:sentences:2b9172496a187732e0adf1cc950045bc	FOXP3|	Foxp3|TCR	Second, M133specific T reg cells can be detected in the spleens and LNs of naive Foxp3 gfp and Rg M133 TCR mice (Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:17813..18027:sentences:146f25a13aba23ce1caeffa47db80025	|CD4	IFN--and IL-10|CD4	In summary, we demonstrate the presence of IFN--and IL-10-expressing virus-specific T reg cells in the CNS of infected mice and show that these T cells suppress proliferation of cognate epitope-specific CD4 T cells.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:19407..19609:sentences:58da3e5074981229b2d811bc40017f2d	IL10|CD4	IL-10|CD4	After stimulation, epitope-specific CD4 T cells useful for detecting epitope-specific T reg cells because IL-10 was produced in virally infected mice and in mice with EAE after peptide stimulation ( Fig.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:19912..20305:sentences:6349086db9d37d7ab930831599be8885	IFNA1|IFNA1|CD4	IFN-|IFN|CD4	2) . The continued expression of IFN- by virus-specific T reg cells likely occurs because virus antigen persists in the infected CNS (Bergmann et al., 2006; Zhao et al., 2009) . Epitope M133-specific T reg cells suppressed proliferation of effector CD4 T cells responding to the same epitope, suggesting that if IFN- expression diminishes T reg cell suppressive function, its effect is limited.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:22239..22480:sentences:99a56913dc76e30d3d1b576ac14c4829	IFNA1|IL10|TNF|IL2|IL17A	IFN-|IL-10|TNF|IL-2|IL-17	epitopes encompass residues 133-147 of the transmembrane (M) protein and residues 358-372 of the surface (S) glycoprotein (Xue and Perlman, 1997; Haring et al., 2001) . Intracellular expression of IFN-, IL-10, TNF, IL-2, or IL-17 was assayed.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:23003..23265:sentences:b9b8dc33812c552001cb6adec429206a	FOXP3|CD4|CD4	Foxp3|CD4|CD4	rJ2.2.M Y135Q -infected brains (pooled from 10 mice) or naive spleens of Foxp3 gfp mice using a CD4 + T cell isolation kit and AutoMACS (both from Miltenyi Biotec) or a mouse CD4 + T cell enrichment kit and Purple EasySep Magnet (both from STEMCELL Technologies).
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:23755..23847:sentences:5c0a80688ba99b74d1b367586aabed54	FOXP3|CD4	Foxp3|CD4	After 66 h, cells were harvested and stained with anti-CD4-PE and anti-Foxp3-Alexa Fluor 647.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:23849..23927:sentences:f35d15846876f0abad433af840924287	CD4|FOXP3	CD4|Foxp3	CD4 + Foxp3  responder cells were analyzed for CFSE dilution by flow cytometry.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:24539..24817:sentences:0592d235fb8b93278ac0859a42455f2b	FCGR3B|CD4|CD4|CD4|	CD16|CD4|CD4|CD4|CD16/32	CD4 T cells were isolated by negative selection using a CD4 T cell isolation kit II. CD4 T cells were then stained with anti-CD16/32 mAb (2.4G2) and PEconjugated I-A b /M133 tetramers as described in the previous section (except tetramer was used at 4 g/ml to reduce background).
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:24933..25127:sentences:543cbdf7342c872749f181a28ddc1632	ITGAM|ITGAX|ITGA2|CD4	CD11b|CD11c|CD49b|CD4	Cells were then stained with anti-CD3-PerCP, anti-CD4-Alexa Fluor 700, and non-T cell lineage (dump) markers (eFluor 450-conjugated anti-CD11b, anti-CD11c, anti-F4/80, anti-B220, and anti-CD49b).
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:25277..25567:sentences:a9a492f4b2cab9c59158a443a48d5b7c	FOXP3|MOG	Foxp3|MOG	Foxp3 gfp mice using a previously described method (Wang et al., 2006) . In brief, mice were immunized with 0.4 ml of an emulsion containing 300 g MOG 35-55 (>95% purity; AnaSpec) in PBS and an equal volume of CFA containing 1 mg Mycobacterium tuberculosis H37Ra (Difco Laboratories) by s.c.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:26379..26552:sentences:0fa9f7d4e91e17264505fd72d782e931	IFNA1|IFNA1|CD4	IFN|IFN|CD4	were captured using a mouse IFN- secretion assay (Miltenyi Biotec) as previously described (Pewe et al., 2004) . IFN--expressing CD4 T cells were sorted with a FACSDiva (BD).
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:27462..27630:sentences:47a94f505b130e8bc1288d0ec3dec3be	CD4|	CD4|TCR	The majority of CD4 T cells in the infected CNS were GFP + . I-A b /M133 tetramer + GFP + cells were sorted from the infected CNS and analyzed for TCR- chain expression.
+SARS:13e6c9b0730b53139910cfa6835ae4c460a30851:fulltext:589085563645822b65b81cfd3529ab52:29547..29624:sentences:a589e6dc02189898dad2ebdc29978633	FCGR3B|FCGR2C|CD4	CD16|CD32|CD4	Cells were then incubated with anti-CD16/CD32-biotin and anti-CD4-PerCP-Cy5.5,
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:1003..1113:sentences:c8994d00bbe19f2da318edafea98d95b	FBL|SNORD15A	fibrillarin|snoRNA	In all cases, fibrillarin is found in multi-component complexes containing RNA (snoRNA, pre-rRNA) and proteins.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:1115..1354:sentences:1004f00123b967746f2c33aa3b4a732e	NOP56|NOP58|FBL|SNORD15A	Nop56|Nop58|fibrillarin|snoRNA	In eukaryotes, the mature box C/D snoRNP complex competent for snRNA/pre-rRNA modification contains the RNA-binding 15.5-kDa protein and the two related proteins Nop56 and Nop58 in addition to fibrillarin and the snoRNA (5) .. INTRODUCTION.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:3440..3846:sentences:cef12b482c6119a5f7d45716f576b43c	NOP56|FBL|FBL	Nop56|fibrillarin|fibrillarin	The C-terminal region of fibrillarin targets it to CBs (3, 18) and interacts directly with Nop56 (20) . Together, the central and C-terminal regions of the protein constitute a conserved Ado-Met-dependent methyltransferase (MTase)-like domain that contains S-adenosyl methionine (SAM, the methionine group donor) binding motifs and provides the MTase activity of fibrillarin (8, 10, 21, 22) .. INTRODUCTION.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:4056..4323:sentences:90b1316cd3d48ed7d2dc1c6168219249	NCL|FBL	nucleolin|fibrillarin	The nucleocapsid proteins of porcine arterivirus and avian coronavirus infectious bronchitis virus (IBV) interact with nucleolin and fibrillarin (23, 17) , and as a result the normal functions of these nucleolar proteins may be diverted for the benefit of the viruses.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:4724..5001:sentences:b8eb33138acdab158b43c4a69ce7422e	ASZ1|FBL	ORF3|fibrillarin	It has been shown that the ability of the plant groundnut rosette virus (GRV, the genus Umbravirus) to move long distances through the phloem, the specialized plant vascular system, strictly depends on the interaction of its movement protein (the ORF3 protein) with fibrillarin.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:5003..5711:sentences:394472bd38135a152ea97b3d33ec3afe	ASZ1|FBL|FBL|FBL	ORF3|fibrillarin|fibrillarin|fibrillarin	This interaction is essential for nucleolar import of the ORF3 protein via CBs, re-localization of some fibrillarin from the nucleolus to cytoplasm, and assembly of cytoplasmic umbraviral RNP particles capable of long-distance spread and systemic infection (16, 28, 29) . It has also been demonstrated that fibrillarin interacts with the multifunctional protein VPg of potato virus A (the genus Potyvirus) (30) and the 2b silencing suppressor protein of cucumber mosaic virus (the genus Cucumovirus) (31) . These data indicate that interaction with fibrillarin may be a general GAR-region spacer "R region" "-rich region" Figure 1 . Schematic representation of AtFib2 protein (A) and its deletion mutants (B).
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:6869..7387:sentences:919506b8156886105e05a2862e9d6446	NOP56|NOP58|FBL|FBL|SNORD15A|SNORD15A	Nop56|Nop58|fibrillarin|fibrillarin|snoRNA|snoRNA	Indeed, it is generally accepted that the specificity of targeting of these complexes to the sites of modification of rRNA may not be determined by fibrillarin but rather by the human 15.5 kDa protein and/or Nop56/Nop58 (or their functional analogues in other organisms) and by the snoRNA components (5, 41, 42) . However, since fibrillarin is the catalytic component of the C/D snoRNP, it is predicted to form critical contacts with the guide RNA (snoRNA) and target RNA (pre-rRNA) in the assembled C/D snoRNP complex.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:7677..7903:sentences:049a86c2af6dd35f044830a654f8fee1	NHP2L1|FBL	Snu13p|fibrillarin	While some reports show that fibrillarin binds directly and specifically to snoRNAs in the absence of additional factors (43, 44) , other reports suggest that this interaction requires other cofactors such as yeast Snu13p (15.5
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:10205..10703:sentences:fd0b5111c095bb7f59320ab91642e031	ASZ1|ASZ1|FBL	ORF3|ORF3|fibrillarin	coli-produced fibrillarin lacks post-translational modifications [for example, methylation (12)], this protein was able to form regular ring-like protein complexes with a virus protein, ORF3 (29) or functional (infectious) RNP complexes with virus RNA and ORF3 (16) . These were similar in appearance to those detected in infected plants (16, 29) . Thus, post-translational modifications of AtFib2 are not required for at least some of its in vitro activities.. Electrophoretic mobility shift assay.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:12103..12331:sentences:d6ed4924d917fe41d63b21d5916be162	RNU1-1|SNORD15A	U1 snRNA|snoRNA	Arabidopsis thaliana U3 snoRNA and U1 snRNA were transcribed by T7 RNA polymerase (Amersham Life Science) from PCR products containing a T7 promoter and the corresponding cDNA sequence (the constructs were kindly provided by S.H.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:13920..14293:sentences:9a266573d7097b7931dcf2aadc82c099	FBL|FBL|FBL|SNORD15A	fibrillarin|fibrillarin|fibrillarin|snoRNA	To analyse the RNA-binding properties of AtFib2, we tested its ability to interact with RNAs that fibrillarin is associated with during rRNA biogenesis: U3 snoRNA (one of the fibrillarin-associated snoRNAs (240 nt in length; 32,33) (Figure 2A and B) and 18S and 26S rRNAs, whose precursors are in vivo targets for the MTase activity of fibrillarin (6,32) ( Figure 2C and D).
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:16192..16361:sentences:c440bee90a42654fcf9c1a8d1556e632	SNORD15A|RNU1-1	snoRNA|U1 snRNA	AtFib2 was able to bind both these RNA substrates in a way similar to U3 snoRNA-the apparent K d values were 0.13 mM for U1 snRNA and 0.16 mM for PGEM7 RNA ( Figure 2B ).
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:18105..18314:sentences:85cc4492d194fc9dc6ec22efd59b3264	FBL|SNORD15A	fibrillarin|snoRNA	Within the snoRNP complex, SAM (the methyl group donor) is attached to fibrillarin (8, 10, 22) . Therefore, we have tested the influence of this ligand on the AtFib2 binding to U3 snoRNA, pGEM7 RNA and TMV RNA.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:18531..18857:sentences:8b53b2dd1b4b51a9be598316a3716737	||FBL	p19|p21|fibrillarin	Several well-studied silencing suppressors (p19, p21 and HC-Pro) inhibit the intermediate step of RNA silencing via binding to siRNAs (58) . Some recent indications that fibrillarin may be involved in the process of suppression of gene silencing induced by viruses (30) prompted us to probe its ability to interact with siRNAs.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:20395..20601:sentences:ae93a3bc750012e9ec37787102dbd60b	FBL|SNORD15A	fibrillarin|snoRNA	Collectively, these data suggest that fibrillarin binds RNA with no or little sequence or structure specificity [dsRNA and ssRNAs of different lengths, snoRNA, snRNA, rRNAs, virus RNAs, tRNA, poly(A), etc.].
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:28559..28848:sentences:fcdd88953adf44b52c820d973f72b382	ASZ1|ASZ1|FBL	ORF3|ORF3|fibrillarin	This protein was shown to be able to fulfil at least some of fibrillarin functions in vitro such as formation of regular ring-like protein complexes with the GRV ORF3 protein or functional (infectious) RNP particles with GRV RNA and ORF3 (16, 29 ; see also 'Materials and Methods' section).
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:30041..30952:sentences:a3dc1765ac1cb66eff06af85aafdfe02	NOP58|FBL|NOP58|NOP56|SNORD15A|FBL|FBL|SNORD15A|SNORD15A	Nop58|fibrillarin|Nop58|Nop56|snoRNA|fibrillarin|fibrillarin|snoRNA|snoRNA	Low specificity of RNA binding by the plant fibrillarin is in good agreement with the data suggesting that the crucial role in targeting of the methylation snoRNP complex to the specific sites of pre-rRNAs is played by other core components (5, 20, 32, 59) . The 15.5 kDa protein initiates snoRNP assembly by specific recognition and binding of K-turn in the C/D site of snoRNAs (45) . Then, Nop58 and fibrillarin are independently recruited to the snoRNA (41, 45) . In cross-linking experiments, Nop58 was in contact with the C box and showed a specific interaction (41) . Nop56 is involved in the formation of snoRNP complex via interaction with fibrillarin and within the complex establishes direct and sequence-specific interactions with C 0 box of snoRNA (20, 41, 45) . The mature snoRNP complex is directed to the site of methylation by sequence-specific duplex formation between guide snoRNA and pre-rRNA.
+SARS:169eb7d3419808c29066e6e5ed091a8d54bc214a:fulltext:c27d7c8862e9c199fc2906ea495c2cbb:34281..34590:sentences:940c8a8a9399ef2a2a8024bda9f78bda	NOP56|NOP58	Nop56|Nop58	It is likely that these two RNA-binding sites (in a concert with other proteins, 15.5 kDa protein, Nop56/Nop58) can interact with guide (snoRNAs and scaRNAs) and substrate (rRNA, snRNAs) RNA molecules, respectively, to place their duplex containing the methylation site closer to the active SAM-binding centre.
+SARS:185a01541eeba3c18e5c68ee961fdabd6069564e:abstract:581572abfc14158dbeda4dd228d2ec5c:1065..1234:sentences:4c75740f976c08c0dbe4467f702d1e85	CTLA4|CD274	CTLA-4|PD-L1	Therefore, CTLA-4/Ig plus PD-L1/2 combination therapy represents a candidate approach to circumvent the bottleneck of immune responses directed toward transgene products.
+SARS:185a01541eeba3c18e5c68ee961fdabd6069564e:title:810d33e2cdb109a21efde9f3e7bb732b:0..122:sentences:1f8586464a8d05ad6be60fddef83d009	CTLA4|CD274	CTLA-4|PD-L1	Improved Immunological Tolerance Following Combination Therapy with CTLA-4/Ig and AAV-Mediated PD-L1/2 Muscle Gene Transfer
+SARS:185b7937f511fb8fe9edb47eb508fea5876aeecf:abstract:f4869e3b1037620134c5b085616b6e57:348..534:sentences:c9644ba6ec941f44621fb56b17f280a7	STAT1|MYD88	STAT1|MyD88	Utilizing models for SARS-CoV infection, key components of innate immune signaling pathways have been identified as protective factors against SARS-CoV disease, including STAT1 and MyD88.
+SARS:185bc5c5addfa50d75d15b288537d11bd4a4aa5d:abstract:543cbd0e302813f2ab480741ed2981fd:724..1037:sentences:c90579b605443b5b6f150fc5b8e26d03	VPS37A|VPS37A|TMEM251|ALS2|TMEM41B	vacuolar protein sorting 37 homolog A|VPS37A|TMEM251|ALS2|TMEM41B	Genome-wide screening of our reporters in mammalian cells recovered virtually all known autophagy-related (ATG) factors as well as previously uncharacterized factors, including vacuolar protein sorting 37 homolog A (VPS37A), transmembrane protein 251 (TMEM251), amyotrophic lateral sclerosis 2 (ALS2), and TMEM41B.
+SARS:185bc5c5addfa50d75d15b288537d11bd4a4aa5d:abstract:543cbd0e302813f2ab480741ed2981fd:1197..1471:sentences:9536f95c5da86c020678c2e955418379	TMEM41B|VMP1|VMP1	TMEM41B|vacuole membrane protein 1|VMP1	TMEM41B is an integral endoplasmic reticulum (ER) membrane protein distantly related to the established autophagy factor vacuole membrane protein 1 (VMP1), and our data show that these two factors play related, albeit not fully overlapping, roles in autophagosome biogenesis.
+SARS:18b5af09d99469ad7872da1b5bf4beb19c909ec1:abstract:aec6641990af06f82ceef9a2eb40bab8:140..354:sentences:dcbe93d9e5cc753c46d0f5d2c6be0746	ACE2|ACE2|ANGPT1	ACE2|ACE2|ANG-1	The high catalytic efficiency of ACE2 for the generation of angiotensin (ANG)-1-7 from ANG II suggests an important role of ACE2 in preventing ANG II accumulation, while at the same time enhancing ANG-1-7 formation.
+SARS:18b5af09d99469ad7872da1b5bf4beb19c909ec1:abstract:aec6641990af06f82ceef9a2eb40bab8:356..496:sentences:9e5f5728d351ac1a4fc34b458a7a5d1e	ACE|ACE2	ACE|ACE2	ACE and ACE2 may have counterbalancing functions and a regulatory role in fine-tuning the rate at which ANG peptides are formed and degraded.
+SARS:18b5af09d99469ad7872da1b5bf4beb19c909ec1:abstract:aec6641990af06f82ceef9a2eb40bab8:498..644:sentences:c94d2fe84bdc9922ba1b764be4f8d7ac	ACE|ACE2	ACE|ACE2	By counterregulating the actions of ACE on ANG II formation, ACE2 may play a role in maintaining a balanced status of the renninangiotensin system.
+SARS:18b5af09d99469ad7872da1b5bf4beb19c909ec1:abstract:aec6641990af06f82ceef9a2eb40bab8:749..966:sentences:f3782a73dc5acd3e7c1812bb8d483d9f	ACE2|ACE2|ACE2|ACE	ACE2|ACE2|ACE2|ACE	Studies using models of ACE2 ablation and the pharmacologic administration of an ACE2 inhibitor suggest that decreased ACE2 activity alone or in combination with increased ACE activity may play a role in both diseases.
+SARS:18d519cf1ea884ddf381067f0733c18d8ad94c7a:abstract:dd493f2b3cb6b499b03f1f534602400f:666..853:sentences:d36a24734778ade5dfa1ddb95c6a922e	IL6|IL8|IL9	IL-6|IL-8|IL-9	Moreover, we highlighted a polyfunctional immune activation only in PBMC exposed to Asian strain, due to the induction of an inflammatory profile (IL-6, IL-8) and of a Th9 (IL-9) response.
+SARS:18fa3d1a5503e1943ce8e657416f9da8fe2cb475:abstract:3d468f7fa21188a1c46b799a4c79ccd7:1014..1124:sentences:794b29ea3189d7f5080ab385bee8b79d	ANXA5|HSPB1	annexin A5|HSPB1	Moreover, western blotting analysis further confirmed the changes of annexin A5 and HSPB1 during IBV infection.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:95..643:sentences:2270435f6678e37a68953d05a9c49f37	CSF2|CSF2|TNF|IFNG|TNF|IRF6	G-CSF) (16) ; and granulocyte/macrophage colony-stimulating factor|GM-CSF|TNF-a|IFN-y|TNF-a|LPS	Astrocytes can also be induced to express the following cytokines : I1A (9, 10) ; TNF-ca (10) (11) (12) (13) ; IIr6 (10, 14, 15) ; granulocyte colony-stimulating factor (G-CSF) (16) ; and granulocyte/macrophage colony-stimulating factor (GM-CSF) (16) . The stimulatory agents that induce cytokine production by astrorytes include LPS, Cat+ ionophore, viruses, and cytokines themselves (II,l, TNF-a, IFN-y) .. . The cytokine TNF-a has been postulated to have a central role in augmenting inflammatory demyelination and intracerebral immune responses.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:645..1455:sentences:e6f1a774deb3ebbba0305f9343fdc440	TNF|ICAM1|IFNG|TNF|TNF	TNF-a|ICAM-1|IFN-y|TNF-a|TNF-a	TNF-a has a diverse range of functions in the CNS, which include induction ofclass I MHC antigens on astrocytes (17, 18) ; induction of ICAM-1 on human fetal astrocytes (19) ; upregulation of class II MHC antigens induced by IFN-y and/or virus on astrorytes (6-8); stimulation of IIr6 secretion by astrocytes (14, 15) ; proliferation of adult astrorytes (20) ; myelin damage (21) ; and lysis of oligodendrocytes (12) . Astrocytes also express high affinity receptors for TNF-a (7), as well as produce TNF-a, which may represent an autocrine pathway of stimulation for these cells.. . A variety of animal models exist for the study of CNS disease involving inflammatory demyelinating lesions . The best characterized experimental model for CNS autoimmune disease is experimental allergic encephalomyelitis (EAE).
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:3587..4078:sentences:2b061f49d32210a46d55cc7970a5340e	TNF|TNF|TNF|TNF|IFNG|IFNG|IRF6|IRF6	TNF-a|TNF-a|TNF-a|TNF-a|IFN-y|IFN-y|LPS|LPS	Of particular interest is the fact that the genes for TNF-a and functionally related TNF-a (lymphotoxin) map within the MHC gene complex (30) . Since many autoimmune diseases are strongly associated with class I and II MHC gene products, TNF-a/TNF-0 are plausible candidates for cytokines involved with autoimmunity.. . We have previously demonstrated that astrorytes from the outbred rat strain Sprague Dawley secrete TNF-a in response to LPS alone, IFN-y plus LPS, and IFN-y plus ID10 (11).
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:4080..4236:sentences:f93dcd9ba2dda26b5b42892069ab3de4	IFNG|TNF|TNF|TNF|IRF6	IFN-y|TNF|TNF-a|TNF-a|LPS	IFN-y alone does not induce TNF-cx production by astrocytes but acts to enhance LPS-induced TNF-a synthesis and to synergize with Ilrlf for TNF-a production.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:4238..5218:sentences:ffc4d7176ec311186c1654807d2e7399	TNF|IFNG|IFNG|TNF|TNF|IFNG|TNF|TNF|IFNG|TNF|TNF|IFNG|IRF6|IRF6|IRF6	TNF-a|IFN-y|IFN-y|TNF-a|TNF-a|IFN-y|TNF-a|TNF-a|IFN-y|TNF-a|TNF-a|IFN-y|LPS|LPS|LPS	The most potent TNF-a production is observed when astrorytes are pretreated with IFN-y for 8-12 h before exposure to either LPS or IIr1/3, suggesting that IFN-y provides a priming signal to the astrocyte . The aim of this study was to examine TNF-a expression by astrocytes from inbred BN and Lewis rats in response to the three different stimuli . We report that TNF-a expression at both the mRNA and protein level is differentially regulated in these strains depending upon the stimuli used for induction . Astrocytes from EAE-resistant BN rats are refractive to the priming effect of IFN-y for enhanced LPS-induced TNF-a production, and produce very low levels of TNF-a in response to IFN-y/IIr1O . In contrast, astrocytes from EAE-susceptible Lewis rats are hyporesponsive to the LPS induction signal, and extremely sensitive to the priming effect of IFN-y for subsequent TNF-a production . Also, Lewis astrocytes produce high levels of TNF-a when stimulated by IFN-y and IIAO.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:5220..5357:sentences:86fdda14ccb9ec93ac2f5dd88b0f015a	IFNG|TNF|IRF6	IFN-y|TNF-a|LPS	Thus, Lewis and BN astrocytes are differentially regulated by LPS and IFN-y with respect to TNF-a gene expression.. Materials and Methods.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:6299..6501:sentences:0d343283db2f070448ae22ed14539afa	GFAP|ITGAM	GFAP|MAC-1	Astrocyte cultures were routinely >97% positive for GFAP, and <2% of the cells were microglia based on their positive staining for nonspecific esterase and MAC-1, a mAb that reacts with the C3b receptor.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:6503..6776:sentences:734fca9eef1f0e2787f963e762b04782	GFAP|ITGAM	GFAP|MAC-1	In subsequent experiments, astrocytes were purified by four repetitions of trypsinization and replating to remove contaminating microglia ; after such manipulation, the astrocyte cultures were >99% positive for GFAP, and negative for nonspecific esterase and MAC-1 staining.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:10620..10757:sentences:90a312e5c4cbede62452be4bc359e4bc	IFNG|IFNG|IRF6|IRF6	IFN-y|IFN-y|LPS|LPS	monolayers of astrocytes that had been incubated with culture media, LPS, IFN-y plus LPS, and IFN-y plus IIT1# for various time intervals.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:11051..12451:sentences:ab4d537725c65b859aba94da2d49b2a3	TNF|TNF|	TNF|TNF-a|TNT	PCR was performed as previously described (11, (36) (37) (38) . Briefly, 2 kg of total RNA isolated from astrocyte cultures was reverse transcribed by 200 U of Moloney mouse leukemia virus reverse transcriptase (Bethesda Research Laboratories, Bethesda, MD) for 10 min at room temperature, then 1 h at 42C, using oligo(dT) as a primer, in a final volume of 20 Al . The resultingcDNA was amplified with 2 U of AmpliTaq DNA Polymerase (Perkin Elmer Cetus, Norwalk, CT) in a final volume of 100 Al, containing 10 mM Tris-HCI, 50 mM NaCl, 1.5 mM MgCI, 0.01% gelatin, 1 mM of each deoxynucleotide triphosphate, and 100 pmol each of primers I and II . Primer I (ATGAG-CACAGAAAGCATGATC) is complementary to position 144-164 of the 5' end of mouse TNF-ca cDNA (39) , and primer II (TACAGGCTTGTCACTCGAATT) is complementary to position 399-419 of the 3' end of the mouse TNF-a mRNA . Amplification was carried out in a twin block system (Ericomp Inc., San Diego, CA) for 30 cycles (one cycle = 94C for 1 min, 55C for 3 min, and 72C for 3 min) . Aliquots (1-16 141) of each resulting reaction mixture were applied to a 1% agarose gel, subjected to electrophoresis, and visualized by Southern blot hybridization with a 1,300bp mouse TNT-a cDNA insert (40) . The autoradiographs were quantitated by scanning densitometry with a video densitometer (620 ; Bio-Rad Laboratories, Richmond, CA).. Materials and Methods.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:13022..13307:sentences:90121a17a689059b70c8e1ff3bdc368a	IFNG|IFNG|TNF|IRF6	IFN-y|IFN-y|TNF-a|LPS	Lewis and BN astrocyte cultures were treated with varying concentrations of LPS (1-10,000 ng/ml) with and without IFN-y (100 U/ml), or IFN-y (1-1,000 U/ml) plus RAO (1,000 U/ml) for 18 h, at which point the supernatants were harvested and assayed for TNF-a production . As shown in Fig.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:13309..13387:sentences:cd637f51a0ce3e12c2f7f4b6fbada4e0	TNF|IRF6	TNF-a|LPS	1 , BN astrocytes produced TNF-a in response to LPS in a dose-dependent manner.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:13389..13500:sentences:e8ca411d0cdd6cf340226be9268bde1b	IFNG|TNF|IRF6	IFN-y|TNF-a|LPS	Pretreatment of these cells with IFN-y, then LPS, did not result in significant enhancement of TNF-a production.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:13502..14241:sentences:12e46cd62f58d892b50cbfc51b92fa8c	TNF|IL10|IFNG|TNF|IFNG|IRF6|TNF|TNF|IRF6	TNF-a|IL 10|IFN-y|TNF-a|IFN-y|LPS|TNF-a|TNF-a|LPS	Even more striking was the observation that BN astrocytes secreted neglible amounts of TNF-a in response to the stimuli of IFNy/IL 10 . This induction pathway was previously shown to be dependent on a priming signal generated by IFN-y, then subsequent exposure to 11,10 (11) . Lewis astrocyte cultures exhibited a different induction pattern with respect to TNF-a production . Lewis astrocytes responded poorly to LPS alone at all concentrations tested, yet when pretreated with IFN-y, then exposed to LPS, TNF-a protein production increased significantly (Fig . 2) . Lewis astrocytes also produce TNF-a in response to IFN-y/IIr10, in the range of what was previously observed for astrorytes from the outbred rat strain Sprague-Dawley (11).
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:14422..14569:sentences:e8cd6f025a7c4af6e5058f925ed94291	TNF|IFNG|TNF|IRF6|IRF6	TNF-a|IFN-y|TNF-a|LPS|LPS	The Ft astrorytes produced low amounts of TNF-a in response to LPS, and IFN-y pretreatment significantly enhanced LPS-induced TNF-a production (Fig.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:14571..14781:sentences:72f7cbc2e85df9395ef32aefa7483450	TNF|IFNA1|TNF|IRF6	TNF-a|IFN-|TNF-a|LPS	3) . The absolute levels of TNF-a in response to IFN-, y/ LPS, though, were less than those observed for the Lewis astrorytes . The Fl astrocyte TNF-a production in response to IFN-y/IIr1O was modest .. Results.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:14783..15080:sentences:6ee356b810d4fa399c13be63b4e6cbf4	|TNF|PTGER3|TNF|IRF6	LPS-and IFN-, y|TNF-a|PGE2|TNF-a|LPS	Prostaglandins have been demonstrated to inhibit LPS-and IFN-, y/LPS-induced TNF-a expression in murine macrophages (41) (42) (43) (44) . As astrorytes have the ability to secrete PGE2 (45) , we wished to determine if endogenous PGE production contributed to strain differences in TNF-a production.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:15280..15953:sentences:131515cf7ad26498b5af7ed93a857be8	TNF|TNF|IFNG|IFNG|TNF|TNF|IFNA1|TNF|PTGER3|TNF|IRF6|IRF6|IRF6	TNF-a|TNF-a|IFN-y|IFN-y|TNF-a|TNF-a|IFN|TNF-a|PGE2|TNF-a|LPS|LPS|LPS	Treatment of cultures with indomethacin increased TNF-a production by both BN and Lewis astrocytes, but did not alter the overall pattern of TNF-a expression in response to LPS or IFN-y/LPS (Table 1) . Similar results were obtained for IFN-y/IIr1a-induced TNF-a production (data not shown) . Most striking is the consistent low level of TNF-a production by Lewis rats in response to LPS plus indomethacin, and the enhancement with IFN-,y pretreatment . These results suggest that differential TNF-a production by astrorytes from BN and Lewis rats is not due to suppression by endogenous PGE2 . TNF-a mRNA Expression by Astrocytes from EAE-resistant and -susceptible Strains.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:16117..16557:sentences:8df812c73da299623e496e866b1733f5	TNF|IFNG|IFNG|IRF6|IRF6	TNF-a|IFN--Y|IFN-y|LPS|LPS	We had previously used the sensitive technique of reverse transcription (RT PCR) to demonstrate levels of TNF-a mRNA in astrorytes because very low levels of this specific RNA are expressed (11) . The astrorytes from BN and Lewis were incubated with LPS (10 jig/ml) for 4 h, IFN--Y (100 U/ml) for 8 h followed by LPS for an additional 4 h, or IFN-y (100 U/ml) for 8 h followed by IIAR (100 U/ml) for an additional 4 h; then RNA was isolated.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:16754..17016:sentences:4a99c12c18f4bab2301062111c0bddbe	TNF|IFNG|IRF6|IRF6|TNF|	TNF|IFN-y|LPS|LPS|TNF|y/11,10	4 , the amplified TNF-ot cDNA sequence is detected in astrocytes stimulated with LPS alone, IFNy/LPS, or IFN-y/11,10, but not in unstimulated astrocyte cultures . The amplified sequence, hybridizing with a mouse TNF-cx cDNA probe, had the expected size of 275 bp.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:17401..18108:sentences:6096a17d044baae3a3cc26f0076a71ed	TNF|TNF|IFNG|TNF|IFNG|IL1A|IFNG|TNF|IFNG||IRF6|IRF6|IRF6|IRF6|IRF6	TNF|TNF|IFN-y|TNF|IFN-y|IL1|IFN-y|TNF|IFN-y|TNT|LPS|LPS|LPS|LPS|LPS	Comparing TNF-ci mRNA levels in BN astrorytes, our results indicate that these cells express TNF-oi mRNA in response to LPS alone, and slightly more upon pretreatment with IFN-y (1.5-fold increase) . Low levels of TNF-ot mRNA are expressed in response to stimulation with IFN-y/IL1# compared with mRNA levels from LPS-80 6 Tumor Necrosis Factor Expression by Astrocytes or IFN-y/LPS-treated astrocytes . When examining TNF-ci mRNA expression by Lewis astrorytes, we observed that low levels of TNF-ot mRNA are detected in cells stimulated with LPS alone, enhanced expression with the combined stimuli of IFN-y/LPS (2.5-fold increase), and even higher levels of TNT-ot mRNA upon stimulation with IFN-y/IIr1/3.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:18200..18407:sentences:f52d7042ef47f8f043afe77e48b17d6d	IFNA1|TNF|	IFN|TNF|y/11,10	1 and 2) , although the differences in the mRNA levels are not as pronounced . When TNF-cx mRNA levels are compared between BN and Lewis astrocytes, the most striking difference is in response to IFN-.y/11,10
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:18717..19131:sentences:38a416dd5193406a92da83ff4f8141e9	IFNG|IFNG||TNF|IFNG|TNF|TNF|IFNG|IRF6|IRF6|IRF6	IFN-y, IFN-y|IFN-y|IL1/3|TNF|IFN-y|TNF-a|TNF|IFN-y|LPS|LPS|LPS	Peritoneal macrophages were obtained from adult Lewis and BN rats as described in Materials and Methods, and exposed to the stimuli of LPS, IFN-y, IFN-y/LPS, and IFN-y/IL1/3 . As shown in Table 2 , peritoneal macrophages from both strains produce TNF-ci in response to LPS, and IFN-y pretreatment enhances TNF-a production . In addition, these cells produce TNF-ot in response to IFN-y/IL1j3 in a comparable manner.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:20058..20359:sentences:09f3f73c01afaef0196c5164667a8d4c	IFNG|IL6|TNF|IL1A|IRF6|IRF6	IFN-y|IL6|TNF-a|IL1a|LPS|LPS	We examined 11,6 production by Lewis and BN astrocytes in response to LPS, IFN-y, and IL11B to determine ifdifferential cytokine expression by these cells extended to 1176 . We have recently demonstrated that primary rat astrocytes secrete IL6 upon stimulation with LPS or the cytokines TNF-a and IL1a.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:20361..21221:sentences:a110a8bb26bb6482bc5097426af7cf63	IFNG|IL6|IFNA1|IFNG|IFNG|IL6|IL6|IFNG|IFNG|IL6|IL6|IL6|IFNG|IFNG|IL10|TNF|IRF6|IRF6|IRF6|IRF6|IRF6	IFN-y|IL-6|IFN|IFN-y|IFN-y|IL6|IL6|IFN-y|IFN-y|IL-6|IL6|IL6|IFN-y|IFN-y|IL10|TNF|LPS|LPS|LPS|LPS|LPS	IFN-y alone has no effect on IL-6 production, but synergizes with 11710 for enhanced IIr6 expression (14) . Lewis and BN astrocytes were treated with LPS (1 P.g/ml) with or without IFN -'y (100 U/ml), IFN-y (100 U/ml), and ILl)3 (1,000 U/ml), or with IFN-y (100 U/ml) plus IL1O (1,000 U/ml) for 18 h, at which point the supernatants were harvested and assayed for IL6 production . Both Lewis and BN astrocytes secrete low levels of IL6 protein in response to LPS alone, and IFN-y synergizes with LPS to enhance 11,6 secretion . IFN-y alone does not induce IL-6 production, but enhances IIAO-induced IL6 expression (Table 3) . These findings demonstrate that Lewis and BN astrocytes make comparable amounts of IL6 protein in response to LPS, IFN-y/LPS,11,10, and IFN-y/IL10, and indicate that differences in TNF-ca production appear to be selective.. Discussion.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:21456..21560:sentences:ac30fb85ba15ae4f22d285d429f6144a	PTGER3|TNF	PGE2|TNF-a	Endogenous levels of PGE2, a known inhibitor of TNF-a, did not differ in astrocytes from the two strains.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:21755..22137:sentences:444d999ee537c16f2d08857d27cf5508	IL6|IFNG|IRF6	IL6|IFN-y|LPS	In addition, IL6 production by Lewis and BN astrocytes is comparable in response to induction by LPS, IFN-y, and IWO, indicating that cytokine production in general is not altered . Taken together, these results indicate that the differential expression ofTNF-a mRNA and protein in Lewis and BN astrocytes may involve transcriptional and/or post-transcriptional events .. Discussion.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:22139..22278:sentences:9f5128b051f410e1026f9e3a0b769f23	IFNG|TNF	IFN-y|TNF-a	The pattern ofresponsiveness of astrocytes from both strains to IFN-y priming for TNF-a production is consistent with data from Massa et al.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:22469..22818:sentences:7a2707eb6c8b97f1c36b8897d28ecf81	IFNG|IFNG|IFNG|IFNG|TNF|IFNG	IFN-y|IFN-y|IFN-y|IFN-y|TNF-a|IFN-y	The lack of IFN-y responsiveness in the BN astrocyte could be the result ofdifferences in (a) the number and/or affinity of IFN-y receptors; (b) intracellular second messengers activated by IFN-y; (c) astrocytespecific transcriptional factors activated or modified by IFN-y; or (d) TNF-a DNA regulatory regions responsive to factors induced by IFN-y.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:22820..23411:sentences:000cbe61354284db70e3ec73a84c619a	IL6|IFNG|IFNG|IFNG|IFNG|IFNG	IL-6|IFN-y|IFN-y|IFN-y|IFN-y|IFN-y	Our results would suggest that BN astrocytes express functional IFN-y receptors capable of binding ligand and generating a biological response as evidenced by IL-6 production in response to IFN-y priming, thus ruling out inherently defective IFN-y-induced signal transduction . Macrophages from the A/J strain ofmice are deficient in their response to IFN-y for acquisition of tumoricidal competence (46) . These macrophages do not respond to IFN-y by activation of protein kinase C (PKC) or by efflux of intracellular Cal', indicating a defect in the transduction signals initiated by IFN-y.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:23853..24276:sentences:57ceb74cbddbe11f74bde2f33e236ae7	IFNG|IFNA1|IFNA1	IFN-, y|IFN|IFN	Future studies will be required to determine if these two intracellular signaling pathways are operational in the BN astrocyte in response to IFN-, y . It is also possible that BN astrocytes exhibit a defect in some aspect of IFN-'y-mediated signal transduction that is distal to the activation of second messengers, such as IFN-yinduced transcription factor(s) that interact with regulatory elements in the TNF-ci promoter.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:24278..24650:sentences:c01436ed5f1aed6282f77eca650a052c	|NFKB1|TNF|IFNG|TNF|IFNG|IRF6|IRF6|IRF6|TNF	IFN-' r|NF-KB|TNF-a|IFN-y|TNF-a|IFN-y|LPS|LPS|LPS|TNF	Recently, LPS and IFN-' r were shown to activate transcription of the mouse TNF-ca gene in murine peritoneal macrophages via the activation of NF-KB (47) . TNF-a expression in these cells is different from that ofrat astrocytes, as LPS and IFN-y alone induce macrophage TNF-a production, whereas IFN-y alone has no effect in astrocytes, but enhances LPS-induced expression.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:24652..24898:sentences:f60ff5b076ba1f4cab78bf29fd5b9354	IFNG|TNF|IRF6	IFN-y|TNF-a|LPS	The priming signal mediated by IFN-y may not be expressed or expressed in an aberrant manner in BN astrorytes, resulting in minimal enhancement of LPS-induced TNF-a expression, and minimal expression of IFN-y/I1,10-induced TNF-oc mRNA and protein.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:25132..25331:sentences:7418b9a45552c30dcacd16c54ae7413a	IL6|IRF6|IRF6	IL6|LPS|LPS	LPS is capable ofinducing IL6 protein production by Lewis astrocytes, and we have also found that LPS inhibits the expression ofIFN-y-induced class II antigens on these same cells (Chung, IY, and E.N.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:25333..25486:sentences:779313e3ced6d41fceed42191bf1e2c4	TNF|IRF6	TNF-a|LPS	Benveniste, unpublished observation) . Thus, Lewis astrocyte hyporesponsiveness to LPS is not global, but seems to be restricted to TNF-a gene expression.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:25488..26240:sentences:a9c2e8517821ba73409d2d4acd67b9ad	TNF|TNF|TNF|TNF|TNF|TNF|IRF6|IRF6	TNF-a|TNF-a|TNF|TNF-a|TNF-a|TNF|LPS|LPS	In C3H/Hej mice (endotoxin resistant), peritoneal macrophages produce no detectable TNF-a protein, even when expressing TNF-a mRNA (40) . It has been suggested that a dual defect prevents TNF-ci expression in these mice; high concentrations of LPS are required to induce TNF-a mRNA levels within the cell, and a posttranscriptional defect prevents the translation of the mRNA to TNF-a protein . Our findings are somewhat similar, although low levels of TNF-ca mRNA are detected in LPStreated Lewis astrorytes even when high concentrations of LPS (10 leg/ml) are used for stimulation . This would suggest a partial transcriptional block, which can not be overcome by using high concentrations ofLPS, as well as a posttranscriptional defect .. Discussion.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:26242..26453:sentences:a73c66907eee74705c5a71273fe255ae	TNF|IFNG|IRF6|IRF6	TNF-a|IFN-y|LPS|LPS	When comparing TNF-ci mRNA and protein expression in the two strains, the differences in TNF-ci mRNA levels are not as striking as those for TNF-a protein, especially in response to either LPS alone or IFN-y/LPS.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:26709..26840:sentences:2c9a89cd3dac027bdb0076eadc4144af	TNF|IRF6	TNF-a|LPS	The analysis by PCR has increased our level of sensitivity, and we are now able to detect TNF-a mRNA from LPS-stimulated astrorytes.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:27020..27259:sentences:4a1c2e6f98fcb39b46627d8b14b71762	TNF|IFNG|IFNG|IRF6	TNF-a|IFN-y|IFN-y|LPS	We have observed that although TNF-a protein levels are comparable for astrocytes stimulated with IFN-y/LPS and IFN-y/IW0 from Lewis and Sprague Dawley strains (11) , RNA levels are consistently higher from IFNy/IIT1f-stimulated astrocytes.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:27261..27593:sentences:718cd3e62a97c800598fb77ec62c0771	TNF|IFNG|IRF6|IRF6|TNF	TNF|IFN-y|LPS|LPS|TNF	This may reflect TNF-(x mRNA instability in LPS-stimulated astrocytes, as observed by Lieberman et al . (10) . Alternatively, transcriptional activity in response to LPS for Lewis astrocytes, and IFN-y/II710 for BN astrocytes, may occur, with a subsequent block in either translation or secretion of mature TNF protein .. Discussion.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:27760..28358:sentences:0684128e5c318b7cd809d99f21fc3d50	IFNG|TNF|IFNG|TNF	IFN-y|TNF-a|IFN-y|TNF-a	The different profile of responsiveness in Lewis and BN astrocytes (especially in response to IFN-y) is not a generalized feature of this developmental stage, as neonatal microglia from these two strains respond equally well to all stimuli tested for TNF-a production . We propose that the ability of the Lewis astrocyte to respond to IFN-y, a rytokine not normally present in the CNS except during inflammatory disease states, by expression of class II MHC antigens and TNF-a production, may contribute selectively to intracerebral immune responses and inflammation in this rat strain.. Discussion.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:28534..29329:sentences:3c3057bd888cb44547a7c4447c489ec4	IFNG|TNF|IFNA1|TNF|TNF|IFNG|TNF	IFN-y|TNF-a|IFN|TNF-a|TNF-a|IFN-y|TNF-a	Activated T cells in the Lewis CNS could serve as an endogenous source of the rytokine IFN-y, and prime astrocytes for TNF-a expression . Infiltrating macrophages and resident astrocytes/microglia represent sources of ILI that could interact with IFN-y-primed astrocytes, resulting in TNF-a production . TNF-a production by Lewis astrocytes in response to IFN-y and IIJ1 may perpetuate the influx of non-antigenspecific inflammatory cells into the CNS by increasing the permeability of endothelial cells (48) , and by enhancing expression of adhesion molecules on both brain endothelium and astrocytes (19, 49) . Additionally, astrocyte TNF-a production may kill or damage neighboring oligodendrocytes (12) and directly damage the myelin sheath (21) , contributing to demyelination .. Discussion.
+SARS:1425915f5f44c6e2bb0753cbe0531cbcbad46d13:fulltext:8b49b2980c64acb9732ad01befd8cafb:29331..29778:sentences:ff239611f9a8b3fe2c2e3924890b0893	TNF|TNF|TNF|IRF6	TNF-a|TNF-a|TNF-a|LPS	There are reports suggesting a causal relationship between rytokine production and disease development . LPS-induced TNF-a production by macrophages from the autoimmuneprone NZB x NZW Fl strain is significantly less than that from MHC-matched normal mice, and the administration of TNF-a protects this strain from developing lupus nephritis (50) . These data suggest that depressed production of TNF-a may contribute to development of autoimmunity.
+SARS:1908bc865262cc8ad989e48e944febdf9eb88ec3:abstract:ad47fe88215b31f93ebf58df4f80a8e5:483..679:sentences:6ceafdecde91aaf8d1b4dcf568b91731	|PSEN2	Ad-7|Ad-4	Classic and advanced diagnostic techniques were used ResultsSeventy-nine percent (213/271) of new recruits were seronegative for either adenovirus serotype 4 (Ad-4) or adenovirus serotype 7 (Ad-7).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:901..2070:sentences:0ad691adfdee84f7cd766cedc44e029c	DPP4|DPP4|DPP4|DPP4|DPP4|DPP4|INS|INS|INS	DPP4|DPP4|DPP4|Dpp4|DPP4|DPP4|insulin|insulin|insulin	DPP4 is a serine protease that cleaves a variety of substrates including incretin hormones, chemokines, growth factors, and neuropeptides [4] . It is ubiquitously expressed on the apical surface of many cell types and also occurs as a soluble form (sDPP4) in the circulation and other body fluids [5, 6] . There is accumulating evidence that DPP4 is involved in the development of chronic liver disease [5, 7, 8] . DPP4 is highly expressed in the liver, and its expression as well as circulating levels are increased in NAFL and NASH [8e10] . sDPP4 is suggested as biomarker of NAFLD [11] and was shown to be a valid measure for hepatocyte apoptosis and fibrosis [12] . Genetic ablation of Dpp4 in mice [13] and rats [14] results in improved insulin sensitivity and liver function, and pharmacological inhibition of DPP4 causes reduction of hepatic steatosis and improvement of insulin sensitivity in mouse models of obesity [15, 16] and diabetes [17] . Beside its role in the degradation of incretin hormones, DPP4 was shown to exert incretin-independent functions such as the induction of insulin resistance [18e21] and inflammation [22] in different cellular systems.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:2072..2243:sentences:d27d7893ccbf53ca72acabcb136ef38d	DPP4|DPP4|INS	DPP4|DPP4|insulin	However, whether elevated DPP4 and in particular hepatic DPP4 triggers insulin resistance and NAFLD or simply reflects the state of liver disease is not entirely clarified.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:2245..2854:sentences:3bd6226eae0a619d666f5c43804bcf5f	DPP4|DPP4|DPP4|DPP4|INS|INS	DPP4|Dpp4|DPP4|Dpp4|insulin|insulin	We recently demonstrated in diet-induced obesity mice that expression and release of DPP4 is substantially increased in liver when compared to adipose depots [23] . We further showed that elevated expression of Dpp4 in livers of 6-week-old mice associates with early insulin resistance, which, in turn, triggers later liver steatosis [23] . In the current study, we analyzed the DPP4 activity in plasma of healthy and NAFLD subjects and elucidated the effect of hepatocyte-specific Dpp4 overexpression on the development of insulin resistance and liver steatosis in mice under obese conditions.. Human samples.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:4062..4242:sentences:4df03a72f3c379025e2859b80a7b4b3c	DPP4|HPRT1	Dpp4|Hprt	Hepatocyte-specific Dpp4 transgenic mice (Dpp4-Liv-Tg) were generated by the company genOway (Lyon, France) via Hprt (hypoxanthine phosphoribosyl-transferase) targeted transgenesis.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:5336..5489:sentences:64acb52ed2de40c42fb84b068a3c4a5b	ADIPOQ|ADIPOQ|LEP|LEP|ADIPOQ	Adiponectin|Acrp30|Leptin|leptin|adiponectin	Plasma adiponectin and leptin levels were measured by Mouse Adiponectin/Acrp30 (DY1119, R&D Systems) and Mouse/Rat Leptin (MOB00, R&D Systems) ELISA kits.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:5915..6158:sentences:46a572a310cbbfaa28ba44815431dc5a	SLC17A5|	AST|T2449	Plasma triglyceride (T2449, F6428, G7793, Sigma), free fatty acid (91096, 91898, 91696, Wako), cholesterol (10017, Human), ALT (12212, Human), AST (12211, Human), and GGT (12213, Human) levels were measured according to manufacturer's protocol.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:7576..7676:sentences:fe90dc9eb3cd27506da40eb3b7d1b6c7	AKT1|INS	Akt|insulin	For relative Akt-phosphorylation, untreated insulin-stimulated controls were set to 100%.. Histology.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:8969..9154:sentences:ea7af3d91e65b80cece526651075c31d	DPP4|INS	DPP4|insulin	Cells were treated with various concentrations of recombinant human DPP4 (1180-SE-010, R&D Systems) for 48 h before being serum-starved (3 h) and insulin-stimulated (10 min, 100 nmol/l).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:10392..10563:sentences:aaed798b8e0d00569f8442f71bd503cc	DPP4|INS	DPP4|insulin	Significance levels were set for pvalues of less than 0.05 (*), 0.01 (**) and 0.001 (***).. Plasma DPP4 activity is increased in patients with NAFLD and insulin resistance.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:11284..11480:sentences:0fdd7a1af5cacdffe68161d48c9c3962	DPP4|DPP4|INS	DPP4|DPP4|insulin	26.6 AE 0.6, p < 0.001), increased plasma DPP4 activity could also be originated from elevated adipose tissue mass.. Plasma DPP4 activity is increased in patients with NAFLD and insulin resistance.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:11487..11779:sentences:02e6b8aae4017d523512917fcac189eb	DPP4|DPP4|GLP1R|DPP4|DPP4	Dpp4|DPP4|GLP-1|DPP4|Dpp4	Liver-specific Dpp4 overexpression results in elevated plasma DPP4 activity and diminished GLP-1 levels To investigate whether elevated levels of DPP4 in fatty livers are cause or consequence of the disease, we generated a transgenic mouse model with a hepatocyte-specific Dpp4 overexpression.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:12338..12769:sentences:82f3f538873918237de30721aa549dab	DPP4|DPP4|DPP4|DPP4|CDH1|DPP4	DPP4|DPP4|DPP4|Dpp4|E-cadherin|DPP4	Moreover, comparing endogenous DPP4 levels in different metabolic tissues of WT mice reveal the highest expression of DPP4 in the liver (Figure 2A,B) . Immunohistochemical staining of DPP4 in liver sections suggests increased membrane localization in Dpp4-Liv-Tg mice indicated by a co-staining with the plasma membrane marker E-cadherin , and plasma DPP4 activity (C) of ageand sex-matched subjects with or without (control) NAFLD.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:12819..12961:sentences:8ae5a3e9606c0c2cc8724140212c902a	DPP4|INS	DPP4|insulin	One-tailed t-test was performed to test whether liver fat, insulin sensitivity index, and plasma DPP4 activity are increased in NAFLD subjects.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:12963..13068:sentences:1653b3e08dd3579e5ddaf94c7fb8df16	DPP4|INS	DPP4|insulin	*p < 0.05, ***p < 0.001.. Plasma DPP4 activity is increased in patients with NAFLD and insulin resistance.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:13407..13751:sentences:044f49c3e44423db0eb6f291c9a42ec2	DPP4|DPP4|DPP4|DPP4|GLP1R	Dpp4|DPP4|DPP4|Dpp4|GLP-1	In addition, cell supernatants of primary hepatocytes from Dpp4-Liv-Tg mice showed higher DPP4 concentration and activity than those from WT controls (Supplementary Figure 1C,D) . Since incretin hormones are known substrates of DPP4, we next analyzed the effect of hepatic Dpp4 overexpression on the half-life of glucagon-like peptide 1 (GLP-1).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:13753..13975:sentences:bd704cca8cd06177463d8ed71418388c	GLP1R|DPP4|GLP1R	GLP-1|Dpp4|GLP-1	Fifteen minutes after oral glucose gavage, portal vein concentration of the active form of GLP-1 was similar in WT and Dpp4-Liv-Tg animals, indicating no differences in GLP-1 secretion from intestinal L-cells ( Figure 2E ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:13977..14217:sentences:1e691e7d9871fa07b330a629b7d78f56	GLP1R|DPP4|GLP1R|DPP4	GLP-1|Dpp4|GLP-1|DPP4	However, analysis of blood obtained from vena cava (after liver passage) revealed a 2-fold reduction of active GLP-1 in Dpp4-Liv-Tg mice, suggesting an increased cleavage and inactivation of GLP-1 by hepatocyte originated DPP4 ( Figure 2E ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:14219..14468:sentences:128812b7acfcc5752c037de89bac6dc9	DPP4|DPP4|GLP1R|DPP4|INS	Dpp4|DPP4|GLP-1|DPP4|insulin	Together, these data indicate that hepatic overexpression of Dpp4 results in elevated plasma DPP4 activity, which, in turn, leads to reduced post-prandial GLP-1 levels.. Plasma DPP4 activity is increased in patients with NAFLD and insulin resistance.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:15197..15393:sentences:542cee9e8c8e54d2491a64f22da9e33b	EMR1|TNF|TNF|CCL2|CCL2|DPP4	Emr1|TNFa|Tnf|MCP1|Ccl2|Dpp4	Indeed, the expression of the macrophage marker F4/ 80 (Emr1) and of proinflammatory cytokines (TNFa (Tnf) and MCP1 (Ccl2)) were increased in white adipose tissue of Dpp4-Liv-Tg mice ( Figure 3E ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:16547..16875:sentences:847fb5c3d0a3fb64919f93c72e9fc830	PLIN2|DPP4	perilipin 2|Dpp4	As a consequence, liver weight showed a tendency to be higher than of WT mice (Figure 4 B) . Histological examinations confirmed the increased accumulation of ectopic fat ( Figure 4C ,D) and larger lipid droplets, indicated by staining of the lipid droplet coating protein perilipin 2 in livers of Dpp4-Liv-Tg mice ( Figure 4E ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:16877..17502:sentences:080ced2dd2d694159883198d092aa796	GGTLC1|SLC17A5|DPP4|DPP4|PPARG|CD36|DPP4	gamma-glutamyl transpeptidase|AST|Dpp4|DPP4|PPARg|CD36|DPP4	Plasma analysis of markers for liver damage showed significantly elevated levels of gamma-glutamyl transpeptidase (GGT, p < 0.05) and numerical increased alanine aminotransferase (ALT, p  0.171) and aspartate aminotransferase (AST, p  0.132) levels (Table 1) . However, markers for inflammation and fibrosis were similar in livers of WT and Dpp4-Liv-Tg animals (Supplementary Figure 2) . Taken together, elevated levels of DPP4 in the liver cause hepatic steatosis with indications of liver damage but not inflammation and fibrosis in mice on a HFD.. PPARg and CD36 expression in the liver is induced by elevated hepatic DPP4.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:17771..18326:sentences:a832eda3f20c0ba4377c88bb3d894408	SREBF1|CPT1A|APOB|DGAT2|DPP4|PPARG|PPARG|CD36|DPP4	Srebf1|Cpt1a|Apob|Dgat2|Dpp4|peroxisome proliferator activated receptor gamma|Pparg|Cd36|Dpp4	Focusing on genes involved in lipid metabolism, we detected no changes in genes of triglyceride hydrolysis, de novo lipogenesis (except Srebf1), and only slightly elevated mRNA levels of Cpt1a, Apob, and Dgat2 in Dpp4-Liv-Tg mice (Supplementary Figure 3) . The most striking effect was observed for the transcription factor peroxisome proliferator activated receptor gamma (Pparg) and its downstream target fatty acid translocase (Cd36), which were both significantly increased in livers of Dpp4-Liv-Tg mice (2.2-fold and 2.3fold, Supplementary Figure 3 ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:18328..18672:sentences:07ea4c8246f714b3d120dcfd07703030	MOGAT1|MOGAT1|PPARG|DPP4|PPARG|CD36|MOGAT1	Monoacylglycerol O-acyltransferase 1|Mogat1|PPARg|Dpp4|Pparg|Cd36|Mogat1	Monoacylglycerol O-acyltransferase 1 (Mogat1), another target gene of hepatocyte PPARg, also tended to be higher in Dpp4-Liv-Tg mice (Supplementary Figure 3) . Validation using quantitative real-time PCR confirmed a significantly elevated expression of Pparg and Cd36 and a trend towards higher Mogat1 levels in transgenic animals ( Figure 5A ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:18674..18800:sentences:936b7b28b56a64d839b77e4dcb251ea9	PPARG|CD36|DPP4	PPARg|CD36|Dpp4	In agreement, western blot analysis showed higher PPARg and CD36 protein levels in livers of Dpp4-Liv-Tg animals ( Figure 5B ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:18802..18937:sentences:734e9b1e62f2e26c0a84f4a4ac3fb968	DPP4|PPARG	DPP4|PPARg	Interestingly, only PPARg isoform 1 was upregulated in these samples, suggesting an isoform-specific effect of DPP4 on PPARg expression.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:18939..19080:sentences:4cbe62fd491d7b964971aeeccb686c49	DPP4|PPARG|CD36|DPP4|INS	DPP4|PPARg|CD36|DPP4|insulin	In summary, DPP4-induced liver steatosis associates with elevated hepatic PPARg and CD36 expression.. DPP4 induces hepatic insulin resistance.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:19082..19459:sentences:7de9e8737c4a5a627296b711f3e7233c	DPP4|DPP4|DPP4|INS|INS|INS	Dpp4|DPP4|DPP4|insulin|insulin|insulin	We have recently shown that early alterations in hepatic Dpp4 are associated with insulin resistance resulting in later liver steatosis [23] . As studies on primary human adipocytes and skeletal muscle cells discovered direct effects of soluble DPP4 on the insulin sensitivity of these cells [18] , we tested whether elevated DPP4 levels also affect hepatic insulin sensitivity.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:19461..19600:sentences:30bcd8d712693d6656477a781d47d634	DPP4|INS	DPP4|insulin	Human HepG2 cells were treated with various concentrations of recombinant human DPP4 (rhDPP4) and analyzed for their insulin responsiveness.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:19602..19952:sentences:d50303d0fb7d278ae4587f2ca19693ca	DPP4|INS	DPP4|Insulin	Insulin-stimulated Aktphosphorylation was unaffected with low dose of rhDPP4 (75e150 ng/ ml) but completely blunted with a dosage of 300e500 ng/ml ( Figure 6A) . Also, in primary murine hepatocytes obtained from 12week-old lean WT mice, 500 ng/ml recombinant mouse DPP4 (rmDPP4) reduced the insulin-stimulated Akt-phosphorylation by 15% ( Figure 6B ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:19954..20166:sentences:60d62266590f27650678d07ddbd05b41	DPP4|DPP4|INS	Dpp4|Dpp4|insulin	Moreover, adenoviral-mediated overexpression of fulllength Dpp4 (Ad-Dpp4) [23] in primary hepatocytes led to a reduction of insulin sensitivity by 30%, when compared to Ad-Gfp infected control cells ( Figure 6C ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:20168..20472:sentences:1d23d39085bc3d2645750f8454649943	DPP4|DPP4|AKT1|INS	Dpp4|Dpp4|Akt|insulin	Primary hepatocytes obtained from 12-weekold standard diet fed WT and Dpp4-Liv-Tg mice did not differ in lipid content (data not shown) but revealed differences in insulin responsiveness, as hepatocytes from Dpp4-Liv-Tg mice showed an 18% lower Akt-phosphorylation than those of WT controls ( Figure 6D ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:20474..20628:sentences:909cfd384268dcf708af428f3b300e46	DPP4|DPP4|INS|INS	DPP4|DPP4|insulin|insulin	Taken together, soluble DPP4 reduced the insulin sensitivity of human and mouse liver cells, suggesting a direct role of DPP4 in hepatic insulin signaling.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:20630..20771:sentences:8e57ffd7039ff8222f92caa3722c1fb3	DPP4|INS|INS	Dpp4|insulin|insulin	To test hepatic insulin sensitivity in WT and Dpp4-Liv-Tg mice, we injected insulin into 30-week-old animals and sacrificed them 15 min later.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:20773..20913:sentences:bb8c66fb0b3fbeaaa084eb05d9aeb8c7	AKT1|DPP4|INS	Akt|Dpp4|insulin	Figure 6E shows that insulin-stimulated Akt-phosphorylation was markedly lower in livers of Dpp4-Liv-Tg mice when compared to WT littermates.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:20915..21124:sentences:a762e5287653c331b39edd45f01e12a6	DPP4|INS|INS	Dpp4|insulin|insulin	In agreement, insulin tolerance test at 22 weeks of age confirmed the impaired insulin sensitivity of Dpp4-Liv-Tg mice ( Figure 6F) , however, at a time-point when fatty liver was already induced ( Figure 4A ).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:21126..21628:sentences:7e3aac2b00d9111e12f02f4e55e0b18b	INS|DPP4|ADIPOQ|DPP4|DPP4|INS|INS|INS|LEP	insulin|Dpp4|adiponectin|Dpp4|Dpp4|insulin|insulin|insulin|leptin	Fasting insulin levels as well as HOMA-IR (homeostatic model assessment for insulin resistance) were numerically increased in Dpp4-Liv-Tg mice but did not reach statistical significance (Table 1) . Finally, we considered leptin to adiponectin ratio as another measure for systemic insulin resistance [31] and found increased ratio in Dpp4-Liv-Tg mice at 30 weeks of age (Table 1) . Thus, overexpression of Dpp4 in livers of diet-induced obesity mice impairs the hepatic insulin sensitivity.. DISCUSSION.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:21630..21917:sentences:826a1853c2cad86bae685174dfe2d492	DPP4|DPP4|GLP1R	DPP4|Dpp4|GLP-1	The present data demonstrate that (i) subjects suffering from NAFLD exhibit elevated plasma DPP4 activity and that (ii) hepatocyte-specific overexpression of Dpp4 contributes to elevated plasma activity of the enzyme, which, in turn, causes diminished glucose-induced active GLP-1 levels.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:21919..22118:sentences:1b774a4a8aed278f37c91de6b525bf88	DPP4|INS	Dpp4|insulin	Moreover, overexpression of Dpp4 in the liver (iii) promotes the development of hepatic insulin resistance and NAFLD and (iv) enhances adipose tissue expansion and inflammation under obese conditions.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:22909..23215:sentences:ed5da2ec6fe3e2233800dc58ee79ed44	DPP4|DPP4|INS	Dpp4|Dpp4|insulin	Although we show increased hepatic steatosis as a consequence of Dpp4 overexpression, our data indicate that the elevated hepatic lipid accumulation in Dpp4-Liv-Tg mice is a secondary effect of alterations in (i) hepatic insulin sensitivity and (ii) energy homeostasis via interference in the incretin axis.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:23217..23386:sentences:ac28c1ed02cb613a497f6893c9feecfe	DPP4|INS|INS|INS	Dpp4|insulin|insulin|insulin	Dpp4-Liv-Tg mice display severe hepatic insulin resistance at 30 weeks of age, and insulin tolerance test indicates impaired insulin sensitivity already at a younger age.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:23388..23610:sentences:5e3af112b2e0d94a621015c89cf0775c	DPP4|DPP4|INS|INS	DPP4|DPP4|insulin|insulin	The fact that human HepG2 cells and murine primary hepatocytes showed impaired insulin sensitivity in response to DPP4 leads to the conclusion that DPP4 has a direct incretin-independent effect on hepatic insulin signaling.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:23612..23763:sentences:9813565b822c56b6d4e6d40b4b08ebf1	DPP4|DPP4|AKT1	DPP4|Dpp4|Akt	Insulinstimulated Akt-phosphorylation was blunted by the treatment with recombinant DPP4 as well as by adenoviral and transgenic overexpression of Dpp4.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:24075..24744:sentences:1104053a7197d8df762fb33e1f093742	DPP4|INS|DPP4|DPP4|DPP4|DPP4|INS|INS|INS|INS|INS	DPP4|insulin|DPP4|DPP4|DPP4|DPP4|insulin|insulin|insulin|insulin|insulin	This is in line with recently published data showing improved insulin sensitivity and lower fat content in HepG2 cells after siRNA-mediated suppression of DPP4 [32] . Furthermore, studies in primary human adipocytes showed insulin resistance by the administration of recombinant DPP4 [18] and improved insulin sensitivity when DPP4 was downregulated [20] . Moreover, long-term DPP4 inhibition improved insulin sensitivity and reduced liver fat content in animals with diet-induced hepatic steatosis and insulin resistance [16, 33] . Thus, DPP4 has an autocrine effect on hepatic insulin signaling which might contribute to later accumulation of ectopic fat in the liver.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:24835..24979:sentences:5998e3d0449da4f1d398af2daa72eb1d	DPP4|GLP1R	Dpp4|GLP-1	Here we show that Dpp4-Liv-Tg mice exhibited lower levels of active GLP-1 in the periphery, whereas portal vein concentrations were not affected.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:24981..25247:sentences:b73800606c553f8a1fabe2bb85245d83	DPP4|GLP1R|DPP4|GLP1R	Dpp4|GLP-1|DPP4|GLP-1	This clearly demonstrates that despite normal secretion from intestinal L-cells, hepatic Dpp4 overexpression leads to a substantial reduction of active GLP-1 after liver passage, suggesting hepatic DPP4 as a major contributor in the degradation of postprandial GLP-1.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:25249..25396:sentences:4893ad50c7dff28d551d7a07427adfa8	DPP4|DPP4|GLP1R	DPP4|DPP4|GLP-1	Since hepatic DPP4 expression is usually confined to the bile canalicular domain, it is unlikely that DPP4 reaches the bloodstream to degrade GLP-1.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:25765..26400:sentences:41a2834169ca18b8e7abf89c64f1e516	DPP4|DPP4|SLC17A5|DPP4|DPP4|SLC17A5|DPP4	DPP4|Dpp4|AST|Dpp4|Dpp4|AST|DPP4	In line with this, human studies have shown associations of serum DPP4 with markers for liver damage (GGT and ALT) as well as hepatocyte fibrosis and apoptosis [12, 35] . In contrast, Dpp4-knockout rats reveal lower serum AST and ALT after 2 months on a Western diet [14] , and Dpp4-deficient mice display less liver fibrosis and inflammation in an experimental model of liver injury [36] . Here, we show that hepatocyte-specific Dpp4 overexpression resulted in significant higher levels of GGT and numerical increased AST and ALT concentrations, providing further evidence for a direct connection between hepatic DPP4 and liver damage.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:26402..26818:sentences:1bcfbde596b4de985225f50901e8469f	DPP4|DPP4|DPP4|DPP4|PPARG|CD36	Dpp4|DPP4|Dpp4|Dpp4|PPARg|CD36	The observed hypercholesterolemia of Dpp4-Liv-Tg mice is in line with previous studies, showing increased cholesterol levels in human subjects with elevated hepatic DPP4 [9] , and reduced plasma cholesterol levels in Dpp4deficient rats [14] . The elevated triglyceride content in livers of Dpp4-Liv-Tg mice appears to be the consequence of augmented levels of PPARg and CD36, both being implicated in liver steatosis.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:26820..27305:sentences:9853656739849f80303d1f1aabc75c7a	DPP4|PPARG|DPP4|PPARG|DPP4|PPARG|DPP4|PPARG|PPARG	DPP4|PPARg|DPP4|PPARg|DPP4|PPARg|DPP4|PPARg|PPARg	Similarly, exogenous DPP4 increases lipid accumulation and PPARg expression in pre-adipocytes [37] , and activation of DPP4 on the surface of macrophages by middle east respiratory syndrome corona virus (MERS-CoV) induces PPARg expression [38] . On the other hand, DPP4 was identified as PPARg target gene in cells derived from human placental tissue [39] . The mechanism of DPP4-mediated PPARg induction is still unclear, whereas effects of increased hepatic PPARg are well understood.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:27307..27764:sentences:0786e391f43de0a644f75b69bd5cb38b	PPARG|PPARG|PPARG|PPARG|CD36|MOGAT1|MOGAT1|DPP4	PPARg|PPARg|PPARg|PPARg|Cd36|monoacylglycerol O-acyltransferase 1|Mogat1|Dpp4	Hepatocyte-specific expression of PPARg is associated with fatty liver in human [40] and mice [41, 42] , and hepatic overexpression of PPARg induces liver steatosis [43] , whereas PPARg-knockout reduces hepatic fat content in mice on a HFD [44] . The major targets of PPARg in the liver are fatty acid (Cd36) and monoacylglycerol O-acyltransferase 1 (Mogat1), both being implicated in fatty liver disease [45] , and upregulated in livers of Dpp4-Liv-Tg mice.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:27766..27879:sentences:ed77a1f10af881765f73a11fbdfec9ec	PPARG|CD36|DPP4	PPARg|CD36|Dpp4	Thus, high PPARg and CD36 levels in Dpp4-Liv-Tg livers seem to contribute to elevated levels of hepatic steatosis.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:27881..28167:sentences:b58131709f10e2a241cf6ebe04d82483	F2RL1|F2RL1|DPP4	protease-activated receptor 2|PAR2|DPP4	Wronkowitz and colleagues recently identified protease-activated receptor 2 (PAR2) as DPP4 receptor [22] , which is implicated in attenuation of obesity, adipose tissue inflammation, macrophage infiltration Quantification of protein content is depicted relative to tubulin levels (n  4).
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:28285..28979:sentences:d7566803dab35d87e90e5ca4ff1721a1	DPP4|MAPK1|NFKB1|TNF|IL6|DPP4|DPP4|DPP4|DPP4|DPP4|INS	DPP4|MAPK|NFkB|TNFa|IL6|DPP4|DPP4|DPP4|Dpp4|Dpp4|insulin	and insulin resistance [46, 47] . It has been shown that soluble DPP4 induces inflammation in human smooth muscle cells via MAPK and NFkB-mediated pathways [22] , and a study in primary human adipocytes revealed suppression of TNFa-induced IL6 secretion after genetic silencing of DPP4 [20] . Moreover, it was suggested that DPP4 enhances inflammatory actions by upregulating toll-like receptors (TLRs) in kidney and adipose tissue, while DPP4 inhibition has anti-inflammatory effects [48] . The present data demonstrate an increased expression of macrophage markers and proinflammatory cytokines in adipose tissue of Dpp4-Liv-Tg mice, despite no effects on adipose Dpp4 expression.. DISCUSSION.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:28981..29179:sentences:eed9738dc7a2b15005113babf737869f	DPP4|DPP4|F2RL1	DPP4|DPP4|PAR2	Since elevated activity of circulating DPP4 is of hepatic origin, it is likely that hepatic DPP4 contributes to the induction of adipose inflammation via PAR2-and TLR-mediated pathways.. CONCLUSIONS.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:29331..29456:sentences:3698c165eab7e8281b96dc2ad381be09	DPP4|INS	Dpp4|insulin	Overexpressing Dpp4 specifically in hepatocytes of mice resulted in hepatic insulin resistance and pronounced liver steatosis.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:29458..29624:sentences:5d0bbc06288f8f7e86a70932c184ce68	DPP4|INS	DPP4|insulin	This finding demonstrates that DPP4 is involved in the regulation of hepatic insulin sensitivity and subsequently lipid storage and not solely a marker of the disease.
+SARS:15b009c611ca19c1c8eac1a7f686e03fe2b4e8ee:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:29626..29839:sentences:9dd10b085510744fe778edffa21852c4	DPP4|INS	DPP4|insulin	Based on our findings, we propose the application of DPP4 inhibitors in the therapy of NAFLD patients in order to improve hepatic insulin sensitivity and to prevent further accumulation of ectopic fat in the liver.
+SARS:174f63ff45fc7bbecf0f559200761ad76691b6fb:fulltext:45c9f3b2efc601a867ecae3c25b9c3eb:13507..13808:sentences:60824baa5061e12486f3fc7d24e008e6	SMAD3|SMAD6	smad3|smad6	The underlying mechanisms may be associated with its ability to downregulate the expression of TGF-1, connective tissue growth factor and mothers against decapentaplegic homolog 3 (smad3), as well as upregulating the protein expression of smad6 (77) .. Antidiabetic activity.. Neuroprotective activity.
+SARS:174f63ff45fc7bbecf0f559200761ad76691b6fb:fulltext:45c9f3b2efc601a867ecae3c25b9c3eb:15806..16896:sentences:3381755e0b81abb307e8d3707b94a41e	PPARA|SREBF1|LIPE|CES1|CES1|AGER|MT-CO2|PTGS2|CTGF|CTGF||ACHE|ACHE|BDNF|BDNF|SLC17A5	PPAR|SREBP-1c|HSL|TGH|triacylglycerol hydrolase|RAGE|COX-2|cyclooxygenase-2|CTGF|connective tissue growth factor|Smad3/6, mothers against decapentaplegic homolog 3 and 6|AChE|acetylcholinesterase|BDNF|brain-derived neurotrophic factor|AST	In vivo (107) function and attenuates MI/R-induced injury TC, total cholesterol; TG, triglyceride; LDL-C, low-density lipoprotein cholesterol; HDL-C, high-density lipoprotein cholesterol; PPAR, peroxisome proliferator-activated receptor; SREBP-1c, sterol regulatory element-binding protein-1c; HSL, hormone-sensitive lipase; TGH, triacylglycerol hydrolase; FAS, tumor necrosis factor receptor superfamily member 6; AGEs, advanced glycation end products; TGF-1, transforming growth factor-1; ECM, extracellular matrix; RAGE, receptor for advanced glycosylation end product; COX-2, cyclooxygenase-2; CTGF, connective tissue growth factor; Smad3/6, mothers against decapentaplegic homolog 3 and 6; AChE, acetylcholinesterase; pCREB, phosphorylated cyclic AMP response element binding protein; BDNF, brain-derived neurotrophic factor; DA, dopaminergic; MDA, malondialdehyde; MAO, monoamine oxidase; SOD, superoxide dismutase; AST, aspartate transaminase; ALT, alanine transaminase; DPPH, 1-diphenyl-2-picrylhydrazyl; MI/R, myocardial ischemia and reperfusion.. Improves myocardial Water extract.
+SARS:174f63ff45fc7bbecf0f559200761ad76691b6fb:fulltext:45c9f3b2efc601a867ecae3c25b9c3eb:26526..27059:sentences:b37ddd0da63e388657b19fe5c9105327	MAPK3|AKT1	extracellular signal-regulated kinases 1/2|Akt	The mechanism associated with these compounds may be mediated via interactions with a microsomal activating system (14) . Fu et al (107) reported that the water extract of Cassiae semen (10 mg/kg/day, for one week) effectively improved myocardial function, and attenuated myocardial ischemia and reperfusion-induced injury and apoptosis in diabetic animals, which is potentially attributable to the reduced plasma lipid levels and the triggered cell survival Akt and extracellular signal-regulated kinases 1/2 signaling.. Conclusions.
+SARS:1926a717f92225eb7539c0fe190cefe1b067f08e:abstract:f55c8159dbeb83bb89191e10b32c41d1:565..719:sentences:fb3a1c3a4fe7fb6e9fbab6d540bddef8	GAPDH|UBC	GAPDH|UBC	RESULTS: UBQ 10 + GAPDH and UBC + Actin1 were identified as suitable reference genes for RT-qPCR normalization under RSV and RBSDV infection, respectively.
+SARS:1933570de05de8d0f1fa9d58993c2e206bb4095f:abstract:b1ddd8e988b9e7565d203ad1dc900254:702..912:sentences:91cbaa2cd4ee60475a78de45c195ce88	ARSF|CSF2	ASF|CSF	This scenario is clearly illustrated by the regular occurrence of transboundary animal diseases (TADs), such as foot-and-mouth disease (FMD), classical swine fever (CSF), African swine fever (ASF), among others.
+SARS:1954505b8d34d065e8140c40db252d0e21fe4bb0:abstract:564d44efc352c6b401fcbb88026876c3:482..733:sentences:dfe1260bd2efd4af57158611f828abd5	MAP1LC3A|ATG5|MAP1LC3A|LAMP1	LC3|Atg5|LC3|LAMP-1	By using confocal microscopy we showed in FMDV-infected cells co-localization of non-structural viral proteins 2B, 2C and 3A with LC3 (an autophagosome marker) and viral structural protein VP1 with Atg5 (autophagy-related protein), and LC3 with LAMP-1.
+SARS:196d55353760e8e1ddbc2e2cce92f806351b747c:title:b8f33c0dfd4f2644888d3fd0964794c5:0..166:sentences:3a0d3561b4dfba00b3a22fc4ed32a9f2	MAPK14|MAPK8|TNF	P38|JNK|TNF	P38 and JNK Mitogen-Activated Protein Kinases Interact With Chikungunya Virus Non-structural Protein-2 and Regulate TNF Induction During Viral Infection in Macrophages
+SARS:18d7f4c8e204349b39a037c19874cff1b34d0f97:fulltext:026ea4b1221bb1833bf375d5900cd09a:1881..2671:sentences:03d9b54ff473786a666d8395b0c9bcea	ACE2|ANPEP|ANPEP|ACE2|ANPEP	ACE2|aminopeptidase N|APN|ACE2|APN	987 npg enzyme 2 (ACE2) for SARS-CoV [14, 15] and HCoV-NL63 [16] , or aminopeptidase N (APN) for HCoV-229E [17] . Like ACE2 and APN, however, DDP4 is expressed on the surface of several cell types, including those found in human airways, and possesses ectopeptidase activity, although this enzymatic function does not appear to be essential for viral entry [18] . Sequence and modeling analysis of S glycoproteins from several human coronaviruses has revealed a potential receptor-binding domain (RBD) of MERS-CoV [10, 19] . However, given the relatively low degree of homology between S glycoprotein sequences and mechanisms of interaction with distinct cell surface receptors, it is likely that there is a significant variability in structural features among respective RBD receptor pairs.
+SARS:18d7f4c8e204349b39a037c19874cff1b34d0f97:fulltext:026ea4b1221bb1833bf375d5900cd09a:11963..12381:sentences:1c36200768fef8870f892f8bf02de20e	DPP4|ACE2|DPP4|DPP4|ACE2	DPP4|ACE2|DPP4|DPP4|ACE2	Furthermore, it is also clear that the enzymatic site of DPP4 is distant from MERS-CoV RBD-binding site (Figure 1 ), similar to the structure of ACE2 binding with SARS-CoV RBD [14] . This provides a structural explanation for previous findings showing that DPP4 enzymatic inhibitors do not block the viral entry of MERS-CoV [9] . However, the overall structural features of DPP4 are clearly distinct from those of ACE2.
+SARS:18d7f4c8e204349b39a037c19874cff1b34d0f97:fulltext:026ea4b1221bb1833bf375d5900cd09a:16155..16409:sentences:c383bb7b878e5bbc5a1375317323efc4	AGBL1|DPP4	CCP4|DPP4	The structure was determined by the molecular replacement method with PHASER [21] in CCP4 suite [22] . The search models are DPP4 extracellular domain structure (PDB code 2G63) and SARS-CoV RBD structure deleting the receptor-binding loop (PDB code 2AJF).
+SARS:196d55353760e8e1ddbc2e2cce92f806351b747c:abstract:8df8154b7af089a51c1d032fe014e7fd:537..784:sentences:3c8077411f6ca93f4f87446ec22e756a	MAPK14|MAPK8|MAPK8|MAPK14	p38|JNK|JNK|p38	It was observed that CHIKV induces both p38 and JNK phosphorylation in macrophages in a time-dependent manner and p-p38 inhibitor, SB203580 is effective in reducing infection even at lower concentration as compared to the p-JNK inhibitor, SP600125.
+SARS:196d55353760e8e1ddbc2e2cce92f806351b747c:abstract:8df8154b7af089a51c1d032fe014e7fd:786..887:sentences:35d80cfc2a49a202d34ea0029787281c	MAPK8|MAPK14	p-JNK|p38	However, inhibition of p-p38 and p-JNK decreased CHIKV induced TNF production in the host macrophages.
+SARS:196d55353760e8e1ddbc2e2cce92f806351b747c:abstract:8df8154b7af089a51c1d032fe014e7fd:990..1250:sentences:1eda9b242246c72cf714d369cf8dd775	IRF3|JUN|TNF	IRF3|c-jun|TNF	Additionally, it was noticed that the expressions of key transcription factors involved mainly in antiviral responses (p-IRF3) and TNF production (p-c-jun) were induced significantly in the CHIKV infected macrophages as compared to the corresponding mock cells.
+SARS:196d55353760e8e1ddbc2e2cce92f806351b747c:abstract:8df8154b7af089a51c1d032fe014e7fd:1252..1413:sentences:ec75dea91d8227d99830bc9b3f536d06	TNF|MAPK14|MAPK8|JUN	TNF|p38|JNK|c-jun	Further, it was demonstrated that CHIKV mediated TNF production in the macrophages is dependent on p38 and JNK MAPK pathways linking p-c-jun transcription factor.
+SARS:196d55353760e8e1ddbc2e2cce92f806351b747c:abstract:8df8154b7af089a51c1d032fe014e7fd:1415..1519:sentences:c8b51632559b373c7896297652e7b3ed	RTN2|MAPK8|MAPK14	nsP2|p-JNK|p38	Interestingly, it was found that CHIKV nsP2 interacts with both p-p38 and p-JNK MAPKs in the macrophages.
+SARS:196d55353760e8e1ddbc2e2cce92f806351b747c:abstract:8df8154b7af089a51c1d032fe014e7fd:1690..1996:sentences:40b3302f13cc81e3171be593a2786f57	MAPK14|RTN2|MAPK8|MAPK8	p38|nsP2|JNK|p-JNK	A strong polar interaction was predicted between Thr-180 (within the phosphorylation lip) of p38 and Gln-273 of nsP2, whereas, no such polar interaction was predicted for the phosphorylation lip of JNK which indicates the differential roles of p-p38 and p-JNK during CHIKV infection in the host macrophages.
+SARS:196d55353760e8e1ddbc2e2cce92f806351b747c:abstract:8df8154b7af089a51c1d032fe014e7fd:1998..2231:sentences:f230596a5de78117536148dc11031bff	TNF|MAPK8|JUN|RTN2|MAPK14	TNF|p-JNK|c-jun|nsP2|p38	In summary, for the first time it has been shown that CHIKV triggers robust TNF production in the host macrophages via both p-p38 and p-JNK/p-c-jun pathways and the interaction of viral protein, nsP2 with these MAPKs during infection.
+SARS:19dcbc62263225d430f506aa5745d23a66543de8:title:431fe2daa7973eff93f572176f195e1c:0..111:sentences:1da28a9c1d08d687ecea8c18f22084d2	ITIH4|MAP3K5	gp120|ASK-1	Binding of HIV-1 gp120 to DC-SIGN Promotes ASK-1-Dependent Activation-Induced Apoptosis of Human Dendritic Cells
+SARS:19e096b2ffdf2d39fa0e28a263bc20a3323bcb5f:abstract:bc43906cd3200324f66120f6c4f95f55:0..216:sentences:d3a76c9afc773a294f306273e5bf6688	|CRP|CRP|IL6|IL6	ORF1|C-reactive protein|CRP|interleukin-6|IL-6	Risk indicators viral load (ORF1ab Ct), lymphocyte percentage (LYM%), C-reactive protein (CRP), interleukin-6 (IL-6), procalcitonin (PCT) and lactic acid (LA) in COVID-19 patients have been proposed in recent studies.
+SARS:19e096b2ffdf2d39fa0e28a263bc20a3323bcb5f:abstract:bc43906cd3200324f66120f6c4f95f55:530..690:sentences:2b396ff2b6e3916b9b9e934be1c441df	IL6|CRP	IL-6|CRP	Our data showed that CRP, PCT, IL-6, LYM%, lactic acid and viral load could predict prognosis and guide classification of COVID-19 patients in different degrees.
+SARS:19e096b2ffdf2d39fa0e28a263bc20a3323bcb5f:abstract:bc43906cd3200324f66120f6c4f95f55:692..779:sentences:4714403c350519e6e3410f80354a35ca	IL6|CRP	IL-6|CRP	CRP, IL-6 and LYM% were more effective than other three factors in predicting prognosis.
+SARS:19daf2ddb12b04fd7091cab38d3f45645cebce07:abstract:6d1f14dffbdc4f86083a90d58c2c8e29:736..852:sentences:0ebe6d7a88d3f6e2a447d71057ecaf18	HSPB1|VIM|LGALS1	HSP27|vimentin|galectin-1	Moreover, Western blot analysis confirmed the up-regulation of HSP27, vimentin and the down-regulation of galectin-1.
+SARS:19e9c8796df362aa81ecfabf7730cfa4df5e5be6:abstract:a904773b82bd9f31fdc2f20c616b7b10:1281..1459:sentences:0f7db565ac73319106759b8414c84036	DDX58|IFIH1	RIG-I|MDA5	The pattern recognition receptors: RIG-I and MDA5 were highly up-regulated during rabies virus infection in MmBr, suggesting their involvement in promotion of antiviral responses.
+SARS:19e9c8796df362aa81ecfabf7730cfa4df5e5be6:abstract:a904773b82bd9f31fdc2f20c616b7b10:1461..1637:sentences:072014f6ca5858141ad3fda1603047a6	CD14|CD68	CD14|CD68	The presence of CD14 and CD68 in MmBr suggested MmBr cells are microglia-like cells which play a key role in host defense against infections in the central nervous system (CNS).
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:10018..10505:sentences:f4c95872e4c8a4817cadbc328cde4361	WBP1|MEST	Wbp1|pEG1	To study trafficking of mutant invertase-Wbp1 fusion protein, cells were transformed with pEG1-QK (Gaynor et al., 1994) . Invertase activity was measured as described previously (Goldstein and Lampen, 1975; Johnson et al., 1987) . Briefly, mid-log cultures grown in synthetic complete medium without uracil were harvested, washed with 10 mM sodium azide, and resuspended in 0.1 M sodium acetate, pH 5.1. Samples were divided for assaying cell surface and intracellular invertase activity.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:19245..19407:sentences:a8dc968c26430743e6a8626bfd4443fb	VPS29|SNX8|VPS35|VPS8	pep11|mvp1|vps35|vps8	We found sop mutants identical with pep11 (Jones, 1977) , mvp1 (Ekena and Stevens, 1995) , vps35 (Paravicini et al., 1992) , vps27 (Piper et al., 1995) , and vps8.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:19894..20146:sentences:eb59a5ae89c1a899c354a59984b19a2f	VPS36|UVRAG	VPS36|VPS38	By complementation of these three mutants with a collection of 42 vps mutants (obtained from B. Horazdovsky), we determined that our selection had resulted in identification of VPS13, VPS36, and VPS38, which had not been previously cloned and sequenced.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:20250..20419:sentences:747711154135e54e0b04ab56ea3681f0	VPS36|UVRAG	VPS36|VPS38	The predicted protein sequences of VPS13, VPS36, and VPS38 were then analyzed by BLAST searches, revealing novel proteins of 3144, 566, and 439 amino acids, respectively.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:21772..22136:sentences:bcd540fe06800f56956513bf4b5515da	SNX8|VPS29|VPS35|UVRAG|VPS8	mvp1|pep11|vps35|vps38|vps8	Previous work classifying vps mutants on the basis of vacuolar morphology is of importance to understanding the significance of identifying a subset of vps mutants as suppressors of pma1 ts (Raymond et al., 1992) . Most of the sop/vps mutants fall into class A (mvp1, pep11, vps35, vps13, vps38, and vps8), which have vacuolar morphology similar to wild-type cells.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:23894..24124:sentences:ff25dacfd0fb4b9149abbf327eb90eb8	PRC1|WBP1	PRC1|Wbp1	Expression of the chimera is high since it is regulated by the PRC1 (encoding CPY) promoter (Gaynor et al., 1994) . Table III shows that cell surface expression of the invertase-Wbp1-Q-K chimera is increased in all vps/sop mutants.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:25622..25759:sentences:2f23eec0fda4999600309b6ef16a7c92	VPS36|UVRAG	vps36|vps38	Complementation analysis of CYP-secreting sop mutants with a complete set of vps mutants led to identification of vps13, vps36, and vps38.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:30104..30163:sentences:e62136d7e8b8941ada8fbd4552daf4e0	VPS8|VPS36	vps8|vps36	The smallest halos were observed surrounding vps8 and vps36.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:30427..30903:sentences:850e510405c8f56b0f4511d8a7e8f94c	MEST|WBP1	pEG1|WBP1	One of the first steps in proteolytic processing of pro- factor is Kex2-mediated removal of the pro-peptide (Fuller et al., 1988; Payne and Schekman, 1989) . To determine whether unprocessed pro- factor is secreted by MAT sop mutants, cells were radiolabeled with [ 35 S]cysteine and (Table I) were transformed with pEG1-QK bearing a mutant WBP1-SUC2 fusion (Gaynor et al., 1994) and assayed after growth to mid-log phase in synthetic complete medium minus uracil (2% glucose).
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:31529..31666:sentences:9fe431f1ebb23970108eb71b99125796	VPS36|VPS29	vps36|pep11	Endogenous invertase activity was measured in bsd2, vps36, and pep11 in the presence of vector alone; activity was similar in all strains.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:32662..32799:sentences:8b2c06cdefe126f3f48556d8741f8d5b	VPS8|UVRAG	vps8|vps38	6 B) . Most of the vps/sop mutants also secrete unprocessed  factor, although secretion of pro- factor is low from vps8, vps13, and vps38.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:33751..33907:sentences:0675f556918bf3c9f680aa97f58a14af	SNX8|VPS29|VPS35	mvp1|pep11|vps35	7, arrow) . Strikingly, Kex2 levels are also significantly decreased in mvp1, pep11, and vps35 cells, as well as the non-vps sop mutants, sop2 and sop6 (Fig.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:34315..34471:sentences:43cf2c6b31b6d6543db074ac7e17ea9b	UVRAG|VPS8	vps38|vps8	6 B) . Among the class A vps/sop mutants, loss of Kex2 is not observed in mutants that have endosome-to-vacuole traffic defects (vps13, vps38, and vps8; Fig.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:37527..37712:sentences:fff7bb6ad1891ed746beb08f324c12a3	UVRAG|VPS36	VPS38|VPS36	SOP selection resulted in molecular identification and phenotypic characterization of three VPS genes, VPS13, VPS38, and VPS36, as well as six novel genes that regulate membrane traffic.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:39592..40111:sentences:7f7cb2e8cef0fe288fb11965b8d2f3ad	PIK3C3|CHMP2A|CHMP2A|	vps34|vps2|vps21|ypt51	Our results underscore the interplay between protein trafficking in the endocytic and biosynthetic pathways (Piper et al., 1995; Singer-Kruger, 1995) . Previously, three vps mutants, vps34, vps2/ren1, and vps21/ypt51, have been identified that display dual defects in endocytic and biosynthetic traffic to the vacuole (Davis et al., 1993; Munn and Riezman, 1994; Singer-Kruger, 1995) . Because indirect immunofluorescence localization suggests mutant Pma1 traverses an endosomal compartment en route to the vacuole (Fig.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:41856..41922:sentences:b9f8f687daf9198753fa80e923038787	SNX8|VPS29|VPS35	mvp1|pep11|vps35	7) . In several class A vps/sop cells (mvp1, pep11, and vps35; Fig.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:48686..48901:sentences:24a21836060e1de3eef28da8084896bc	SNX8|VPS29|VPS35|VPS36	mvp1|pep11|vps35|vps36	We have placed the sop/vps mutants mvp1, pep11, vps35, the class E mutants vps27 and vps36, and sop2 and sop6 in this class because Kex2 trafficking between Golgi and endosome appears defective in these mutants (Fig.
+SARS:1863b855d1e87b1a2b85a88c71c0b8753619f0b2:fulltext:2665027cb0b2aca29f6d9ca7da59480b:49263..49392:sentences:1f8fdd4fed7186d9841f49f15ca86c76	UVRAG|VPS8	vps38|vps8	vps13, vps38, and vps8 are candidates for this subclass; these vps/ sop mutants are defective in endosome-to-vacuole traffic (Fig.
+SARS:19eed2e91c17ea20e9cbda665e19fad13a948ecf:title:58d74d0ae073c55adf35aa160c69e8c4:0..101:sentences:1a61d41bc3189b7415085a8df67f85f8	MARCH8|BSG|BSG	miR|CD147|EMMPRIN	Human Cytomegalovirus Encoded miR-US25-1-5p Attenuates CD147/EMMPRIN-Mediated Early Antiviral Response
+SARS:19e18a7c27512439dac91fc1096937fd03496c13:abstract:4b64da0e495f4f5cc0606d2af1b0eb9f:299..538:sentences:2899ccec1557033b04047cff65306e6d	AGT|REN	angiotensin II|renin	Cardiovascular and renal abnormalities are associated with the overactivation of RAS, which can be constrained by angiotensin- converting enzyme inhibitors (ACEIs), angiotensin II (Ang-II) -AT1 receptor blockers (ARBs) and renin inhibitors.
+SARS:19e18a7c27512439dac91fc1096937fd03496c13:abstract:4b64da0e495f4f5cc0606d2af1b0eb9f:586..664:sentences:77aac09b7c040822563f63e9f0e77725	REN|AGT|AGT	renin|angiotensinogen|Angiotensin I	The renin catalyzes the conversion of angiotensinogen to Angiotensin I (Ang-I).
+SARS:1a100a697005ed92ac6630b1262050dd6838166f:abstract:15acc401882653f08234f4a184511a53:561..855:sentences:df0bbefe3232374ee2f46e962381df7f	MME|ACE	neprilysin|angiotensin-converting enzyme	Because of the number of pathologically relevant changes in inflammation and tumor progression that can be directly attributed to neprilysin and angiotensin-converting enzyme, a particular focus will be on the role of these enzymes in modulating innate and adaptive immune responses in the skin.
+SARS:18aa7bfcf8b4dfcad03cf4836aaaa5345d6cfdc7:fulltext:2b8f4454bdfc45e14090288eda7713e5:22652..23039:sentences:172e1865e57f7f53f32d02a794b783b1	VEGFA|FLT1|TLR3|TICAM1	VEGFa|VEGFR1|TLR3|TRIF	The authors demonstrated that inhibition of blinding choroidal neovascularization from a model of age-related macular degeneration in mice was as effective using control nonspecific siRNA as by administration of siRNA targeting VEGFa or VEGFR1 and that the effects could occur via cell surface toll-like receptor-3 (TLR3), its adaptor TRIF and induction of interferon- and interleukin-12.
+SARS:18aa7bfcf8b4dfcad03cf4836aaaa5345d6cfdc7:fulltext:2b8f4454bdfc45e14090288eda7713e5:23162..23595:sentences:070af0fd617dd863c247d4018a4bf3e4	VEGFA|TLR3	VEGFa|TLR3	For example, injection of a cocktail of siRNA targeting VEGFa or control together with siLacor control into the eyes of our reporter mice given laser-injury induced choroidal neovascularization (a model predictive of efficacy in humans) could help show if suppression of choroidal neovascularization effects were mediated by RNAi where luciferase induction would be observed or by TLR3 where no luciferase signal would be seen.. Mock.
+SARS:18aa7bfcf8b4dfcad03cf4836aaaa5345d6cfdc7:fulltext:2b8f4454bdfc45e14090288eda7713e5:24674..24957:sentences:116d48acb85ead95da5bd2d99d47ca07	HTT|SDHC	huntingtin|pGL3	The HD promoter fragment was obtained by NcoI digestion of the qp25 construct (David Housman, HDF CHDI Reagent Resource Bank) containing the huntingtin promoter and exon 1 to yield an 800 bp product that was inserted into the NcoI site of the pGL3-Basic vector (Promega, Madison, WI).
+SARS:1a3ac4ed56c42714b04e97e0e5e11a93c5a91508:fulltext:4adab95b6c489c49e112237d5ab30fc5:14395..15035:sentences:e850e42dbe88959f14aabb2bebf3913f	MAN1A1|RPN1|RPN1	Man9|ribophorin I|ribophorin I	The extent to which the high mannose oligosaccharide side chains in ribophorin I undergo removal of peripheral mannose residues was assessed by a kinetic analysis of the distribution of radioactive mannose in ribophorin oligosaccharides obtained from cells labeled with 2[3H]mannose for l, 7, and 24 h. The oligosaccharides obtained from immuneprecipitated ribophorin I by pronase digestion and endoglycosidase H treatment were analyzed by high resolution Biogel P-4 gel filtration chromatography (13) . After l h of labeling, the major radioactive peaks corresponded to Man9GlcNAc and MansGlcNAc, and a small shoulder to GlcMan9GlcNAc (Fig.
+SARS:1a3ac4ed56c42714b04e97e0e5e11a93c5a91508:fulltext:4adab95b6c489c49e112237d5ab30fc5:18864..19220:sentences:c660e894fd421a43565f51766e226f87	HMGCR|CYB5A	HMG-CoA reductase|cytochrome b5	Obviously, glycosylation is not required for retention in the ER since, in contrast to the ribophorins and the recently characterized HMG-CoA reductase (6, 7, 3 l), all other ER proteins investigated, such as cytochrome P-450 (3) and its reductase, cytochrome b5 and its reductase, epoxide hydrolase (29, 41), and Ca ++ ATPase (8, 37) are not glycoproteins.
+SARS:19df6a2ae9a9070dd15404465eed98ad222b27f0:abstract:5fbac948fb4d46cd9976de2d61ac0875:987..1151:sentences:3d0aa3231da060e02231fb6618c38ba4	IFI30|CTSL	GILT|cathepsin L	We also found that the induction of GILT expression reduced the level and activity of cathepsin L, which is required for the entry of these RNA viruses in lysosomes.
+SARS:19df6a2ae9a9070dd15404465eed98ad222b27f0:abstract:5fbac948fb4d46cd9976de2d61ac0875:1153..1415:sentences:54c254acf652aec0d424708720b1266d	IFI30|CTSL	GILT|cathepsin L	Our data indicate that GILT is a novel antiviral ISG that specifically inhibits the entry of selected enveloped RNA viruses in lysosomes via disruption of cathepsin L metabolism and function and may play a role in immune control and pathogenesis of these viruses.
+SARS:1a52404c7cdc68445f80cb3ddde5781d4ec5cbe5:abstract:51481c7a86280fdb6e2ca69b13ca1fbb:724..936:sentences:457a650ff54ec63d5d1ec49533c3735d	CTTNBP2|CWC15	ORF4|ORF5	Sequencing analysis of the S (S1 portion), HE, ORF4 and ORF5 genes of BCoV isolates associated with different clinical syndromes indicated that neither insertions or deletions could explain their distinct tropism.
+SARS:1a537a4d664e3ee6f53bbb7566e4837f31945b8d:abstract:1e252f58563ce420b49646cc0cda5c54:222..454:sentences:afb01abd190b891f5dfc4f466fdbacbe	CD8A|MBP|MBP|MBP	CD8|myelin basic protein|MBP|MBP	We found that CD8(+) myelin basic protein (MBP)-specific T cell tolerance can be broken and autoimmunity induced by infection with a virus that does not express MBP cross-reactive epitopes and does not depend on bystander activation.
+SARS:1a537a4d664e3ee6f53bbb7566e4837f31945b8d:abstract:1e252f58563ce420b49646cc0cda5c54:456..581:sentences:1769c83f369336db8aba5e051b573d60	|MBP	TCR|MBP	Instead, the virus activated dual T cell receptor (TCR)-expressing T cells capable of recognizing both MBP and viral antigens.
+SARS:1a39379895d1e136f64c7b79ef2204de094dfa75:fulltext:1e4ca561cf03b22c9f8fb64070e98799:2464..2810:sentences:37973a7d62565aeee5ec12bba2f52962	PBRM1|IVNS1ABP	PB1|NS1	This "PLEX-ID/Flu assay" includes one pan-influenza primer set targeting the PB1 segment, five pan-influenza-A primer pairs targeting individually NP, M1, PA, PB2 and NS1 genes, one pan-influenza B primer pair targeting the PB2 segment, and two additional primer pairs targeting two surface antigens HA (H1) and NA (N1) genes [12] .. INTRODUCTION.
+SARS:1a22c841a95f784a81243b8ce488d79212a62338:title:f4ed4a534f6712d4de054955aa256f0d:0..108:sentences:065ba4a1fe0cbab429dbcbd37cab4209	IFNG|IRF1	Interferon gamma|IRF1	Interferon gamma inhibits transmissible gastroenteritis virus infection mediated by an IRF1 signaling pathway
+SARS:1a6bc37482c1bf714fe45b3a596281f764cc85d7:title:d51a49ed0380191509f93d9e574b11e8:0..202:sentences:e10beec72495388aa9636aa78c84de99	PIK3CG|AKT1	PI3K|Akt	The celecoxib derivative kinase inhibitor AR-12 (OSU-03012) inhibits Zika virus via down-regulation of the PI3K/Akt pathway and protects Zika virus-infected A129 mice: A host-targeting treatment strategy
+SARS:1a80ce2336e72d0e9283afaf12e5d25255f4984e:abstract:c3e85b54b6bca3c90930391c5a4225a1:473..559:sentences:2a0f335ebf006c72482e531d1f269390	MX1|IFNB1	MxA|interferon-beta	The human MxA protein is one of the most prominent proteins induced by interferon-beta.
+SARS:1a953aebaf30f36a8a16b51f0cc128da5202ebc4:title:7e205d0894e8093f2285aab024f0c5bf:0..70:sentences:236e50c9f21cca675a95cab192001bee	DDX58|IFIH1	RIG-I|MDA5	Therapeutic Targeting of RIG-I and MDA5 Might Not Lead to the Same Rome
+SARS:1a80ce2336e72d0e9283afaf12e5d25255f4984e:title:d377c5cfc38b72606ca4a8c59870820c:0..94:sentences:6663f370996a91ac4c83bcfe5efc4b96	IFNB1|MX1	interferon-beta|MxA	The antiviral effect of interferon-beta against SARS-Coronavirus is not mediated by MxA protein
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:2532..2816:sentences:7860d3d6283a636d4b0ddb567d5bb68c	SOCS3|STAT6	SOCS3|STAT6	11, 12 Other groups have described how intratracheal or intranasal delivery of siRNA targeting effectors of Th2driven inflammation like SOCS3 and STAT6 improved disease outcome in rodents, although direct target engagement in pathology-relevant cells was not conclusively demonstrated.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:5396..5625:sentences:d36d5922156d9e368b553a24b5783713	CTNNB1|CTNNB1|SSB	b-catenin|Ctnnb1|Ssb	To evaluate if RNAi-mediated activity can be induced in the mouse lung after local siRNA administration, we generated siRNAs against two ubiquitously expressed gene targets, b-catenin (Ctnnb1), and Sjgren syndrome antigen B (Ssb).
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:11257..11502:sentences:2a30e6abe1f43bb3ea65faf82dacd2ed	ITGAX|ITGAX|PTPRC|PTPRC	CD11c|CD11c|CD45|CD45	15 Mouse lungs were enzymatically dissociated, and the resulting single-cell lung mix suspension was sequentially fractionated using MACS microbead technology into CD11c + cell, CD11c-depleted CD45 + cell, and CD45 neg cell subsets ( Figure 4A ).
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:11663..11826:sentences:b5fb4b75ac5866e38a790d20c301d51d	PTPRC|ITGAX	CD45|CD11c	32 Analysis of the CD45 + cell subset containing hematopoietic cells confirmed the lack of CD11c + cells, demonstrating the success of the cell separation approach.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:11828..12264:sentences:8239c14b9b508f6da477c3e446f3430c	PECAM1|PTPRC|PECAM1|PECAM1|ITGAX|PECAM1	CD31|CD45|CD31|CD31|CD11c|CD31	Staining with pan-endothelial (CD31) and epithelial (CD326) cell markers segregates the CD45 neg cell subset (non-hematopoietic cells) into CD31 neg CD326 + cells (containing most epithelial cells represented in lung), CD31 + cells (endothelial cells), and CD31 neg CD326 neg cells (fibroblasts smooth muscle cells).. Lung Cell Fractionation Demonstrates siRNA-Mediated Target Gene Knockdown in CD11c + Cells and Non-hematopoietic Cells.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:12695..13268:sentences:4cff9ddc9c8c897232088fd8432cabf5	ITGAX|PTPRC|CTNNB1|ITGAX|PTPRC	CD11c|CD45|Ctnnb1|CD11c|CD45	In addition, a lower but significant and reproducible knockdown (>35%) was detected in the non-hematopoietic (CD45 neg ) cell subset, while no significant activity was observed in CD11c-depleted hematopoietic cells ( Figure 4B) . A secondary observation from this analysis is that the CD45 + cells only contained about half of the Ctnnb1 target mRNA as the other populations, reflecting intrinsic differences in tissue-specific gene expression patterns.. Lung Cell Fractionation Demonstrates siRNA-Mediated Target Gene Knockdown in CD11c + Cells and Non-hematopoietic Cells.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:16754..16979:sentences:d462c17a68367be4da56ce4a356103b8	PTPRC|PECAM1|PTPRC|PECAM1	CD45|CD31|CD45|CD31	16 June 2019 endothelial (defined as CD45 neg CD31 + ) and epithelial (CD45 neg CD31 neg CD326 + ) cell subsets with over 90% purity using a fluorescence-activated cell sorter (FACS) from mouse lungs 3 days after siRNA dosing.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:16981..17373:sentences:ceeaef4c89190f6137db004078cfba6d	KDR|KDR|ICAM2|ICAM2|PECAM1|PECAM1|SCGB1A1|PDPN|SFTPA1	Vegfr2|Kdr|CD102|Icam2|CD31|Pecam1|Scgb1a1|Pdpn|Sftpa1	Analysis of mRNA expression of pan-endothelial markers Vegfr2/Kdr, CD102/Icam2, and CD31/Pecam1 demonstrated the effective separation of endothelial cells from the mixed lung population ( Figure 6A) . Likewise, analysis of Cyp2f2 and Scgb1a1 (club cells), Pdpn (alveolar epithelium I), and Sftpa1 (alveolar epithelium II) demonstrated the successful separation of a subset of epithelial cells.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:17375..17735:sentences:92247bdd9b1df982ad42dc61b767d6ae	TUBB4A|ACTA2|MUC5AC|PTPRC|PECAM1	Tubb4|Acta2|Muc5ac|CD45|CD31	Lung-cell-specific markers Tubb4 (ciliated cells), Acta2 (smooth muscle cells), and Muc5ac (goblet cells) did not segregate into the epithelial or endothelial subsets, indicating cells expressing these markers are present in the triple-negative (CD45 neg CD31 neg CD326 neg ) subset (data not shown).. RNAi Activity in the Lung Is Inhibited by siRNA PEGylation.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:20073..20381:sentences:dc07bd6280b492b22cb0fc09a5f947ae	TNFSF4|TNFSF4|IL13|IL5	OX40L|OX40L|IL-13|IL-5	As expected due to the effect of OX40L modulating T cell memory response, siRNA-treated mice with reduced OX40L expression had significant lower levels of Th2-associated cytokines interleukin-13 (IL-13) and IL-5 mRNA in total lung ( Figure 7C ) and protein in bronchoalveolar lavage (BAL) fluid ( Figure 7D ).
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:20934..21179:sentences:fbd1c8a6f7fcb0cfa62ffbf8713df118	SCPEP1|AGO2	RISC|Ago2	Once internalized and engaged by cytosolic RNA induced silencing complex (RISC), the RNA duplex is unraveled and the guide (antisense) strand is bound to Ago2 protein, the endonuclease responsible for site-specific degradation of the target mRNA.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:25233..25466:sentences:41e91205136f7e94d3536ad1e6ea5d97	PTPRC|PECAM1	CD45|CD31	However, a direct correlation between cellular siRNA content and mRNA knockdown cannot be established, since the epithelial (CD45 neg CD326 + CD31 neg ) cell subset showed similar mRNA knockdown (60%) with 200-fold lower siRNA levels.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:26038..26315:sentences:db729158d67084c427feeca26f3c1b19	ITGAX|TNFSF4	CD11c|OX40L	36, 37 Using a protocol similar to those that established the effectiveness of anti-OX40L-blocking antibodies, 38 we have demonstrated that intratracheal delivery of siRNA induces gene silencing within the DC-containing lung CD11c + cell population and modulates lung pathology.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:26527..26678:sentences:8bb4ff76f2bf7837d9837bb699dc1ad6	TNFSF4|IL13|IL5	OX40L|IL-13|IL-5	In correspondence with the role of DC-expressed OX40L in memory Th2 responses, we observed a downregulation of IL-13, IL-5, and IgE in siRNA-dosed mice.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:27918..28145:sentences:7533508909ec115362e28427acea9fd2	CTNNB1|SSB	Ctnnb1|Ssb	48 Primary sequences and chemical modification schemes of siRNA targeting mouse Ctnnb1, Ssb, Tnsf4, and siRNA controls employed in our studies are summarized in Figure S1 . Oligonucleotides were dissolved and dosed in 50 mL PBS.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:30136..30162:sentences:d8082223785ead6db1641301bbeb804c	ITGAX|PECAM1	CD11c|CD31	CD11c-PE-Cy7, and CD31-APC.
+SARS:17526c4d7ebc24e00acdd7c803eb97dd34980e41:fulltext:81a1f69594526f8f21983c209b9aa0b4:31709..31879:sentences:f91f87a26d9af6a25fca694ff02571ac	PTPRC|PTPRC|PECAM1	CD45|CD45|CD31	An epithelial cells subset was identified as CD45 neg CD326 + CD31 neg cells, and endothelial cells were identified as CD45 neg CD326 + cells.. Lung Cell Subset Isolation.
+SARS:1a953aebaf30f36a8a16b51f0cc128da5202ebc4:abstract:94a167bb7601e83b0eb88bbb7caf27a8:0..197:sentences:92a7de76be228acbd69b59761fe0ed34	DDX58|IFIH1|ADM	RIG-I|MDA5|PAMP	RIG-I and MDA5 receptors are key sensors of pathogen-associated molecular pattern (PAMP)-containing viral RNA and transduce downstream signals to activate an antiviral and immunomodulatory response.
+SARS:1a953aebaf30f36a8a16b51f0cc128da5202ebc4:abstract:94a167bb7601e83b0eb88bbb7caf27a8:359..540:sentences:7aa5f7cba892a293d7fa9023990c6aa4	DDX58|IFIH1	RIG-I|MDA5	Current knowledge testifies to the redundant, but also distinct, functions mediated by RIG-I and MDA5, opening opportunities for the use of specific and potent nucleic acid agonists.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:2892..3191:sentences:e9400a5d5ff59f1040049a08d216d3ba	CASP1||||	caspase 1|P35|P35|P35|caspases	P35 directly inhibits many caspases, including insect Sf-caspase 1, human caspases 1, 3, 6, 7, 8 and 10 and mouse caspase 1. 14,15 Indeed, P35 cleavage products remain irreversibly associated to the caspase through a covalent thioester bond between P35 D87 residue and the caspase catalytic cysteine.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:3488..3717:sentences:4b6ed4c9e0c26cc3cccdf66d2132e440	|||CASP9	P49|caspases|P35|caspase 9	19 Besides effector caspases, P49 also affects initiator caspases that P35 fails to suppress, like insect Sf-caspase X and human initiator caspase 9.. Caspase Cleavage as a Way for Viruses to Counteract Apoptosis: Die Another Day.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:4000..4224:sentences:6047e07089e405cdfa8ace544fca79e0	|RYBP|||CASP1|	P35|AAP-1|caspases|caspases 3 and 9|caspase 1|P49	20 Like P35 and P49, ORF390 (also referred as WSSV449 or AAP-1) is suggested to act as an inhibitor substrate 21 and is able to block several caspases, including human caspases 3 and 9 as well as insect Sf-caspase 1 in vitro.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:4226..4448:sentences:5ab4f6bcc90599159198d6b934e6d705	CASP3|CASP9	caspase 3|caspase 9	ORF390 ability to suppress caspase activity is associated with consensual caspase cleavage sites: 269 DEVD 272 k that targets caspase 3, and 230 VETD 233 k and 300 LEHD 303 k that are both required for caspase 9 inhibition.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:5870..6000:sentences:76de08c763bca1382a799e17f5a4fe76	IVNS1ABP|CASP3|IVNS1ABP	NS1|caspase 3|NS1	22 This requirement was associated with NS1 protein being cleaved through two caspase 3 sites leading to five NS1-related products.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:7032..7120:sentences:73b33d84c418603b48aaf58d30fe09c8	BCL2|BIRC5	Bcl2|Survivin	Interestingly, HPV increases the levels of both antiapoptotic Bcl2 and Survivin proteins.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:7578..7767:sentences:0246224aba1d1224d624b0ddc43a9f8f	|CASP3	caspases 3, 8 and 9|caspase 3	Besides, HAstV activates caspases 3, 4, 6, 7, 8 and 9. 27, 28 In vitro, caspases 3, 8 and 9 are able to target VP90 27 but only caspase 3 or 9 silencing reduces VP70 generation on infection.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:11317..11413:sentences:39c481000ebfa6e1f1b6bafcd7ba61b8	IVNS1ABP|	NS1|caspases	As described above, AMDV NS1 protein is cleaved by caspases, which allows full viral replication.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:11723..11924:sentences:86e53ca684076804249e4cf12d324730	CASP10|CASP7	caspase 10|caspase 7	Besides, VP protein expression in either transfected or AMDV-infected cells mainly activates caspase 10, followed by caspases 6, 9, 3 and 7, with caspase 7 as the more efficient in VP cleavage in vitro.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:12543..12868:sentences:41747b7e84476dde190488eac1278b59	IVNS1ABP|	NS1|caspases	As it is possible that both NS1 and VP cleavages do not inevitably occur simultaneously depending on the pattern of activated caspases, it would result in either effective or attenuated viral replication and allow the virus to spread or persist.. Caspase Cleavage as a Way for Viruses to Counteract Apoptosis: Die Another Day.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:13039..13312:sentences:6b9ddaf25ef033774e59d881ace82cdd	|IVNS1ABP|MAPK14	caspases|NS1|P38	However H-1PV is able to activate caspases in non-transformed cells, leading to the cleavage of NS1, a non-structural protein (NS) notably involved in viral DNA replication and gene expression by transactivating P38 promoter, which controls the synthesis of capsid proteins.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:13397..13550:sentences:52e1e75076f9eed00f4c4b252ee03d1d	IVNS1ABP|IVNS1ABP|MAPK14	NS1|NS1|P38	When ectopically expressed, NS1-Nterm acts as a dominant negative on NS1-driven P38 promoter transactivation, and dramatically decreases viral production.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:16564..16769:sentences:af03ee12dff56e70b878bc94fd8c9593	|CASP2	caspases|caspase 2	The viral ionic channel M2 protein is also cleaved by caspases, likely caspase 2 and/ or 3 36, 37 in both human and avian influenza viruses and was shown to be associated with avian influenza pathogenicity.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:18080..18508:sentences:ab93586aca51bd20d5b235581726bf1c	CASP3|	caspase 3|caspases 6 and 7	TGEV infection is able to induce caspases 3, 6, 7, 8 and 9 activation 43,44 and the cleavage of the structural NP N, leading to a stable 41-kDa fragment (N 0 ). 44 N protein is targeted in vitro by caspases 6 and 7, and less efficiently by caspase 3. In HRT18jap1 cells, the infection causes apoptosis but is not productive, suggesting that caspase activation (and possibly N caspase cleavage) prevents progeny virion generation.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:19409..19548:sentences:a51b40afcde1d5a922652cef2e45b910	CASP2|CASP6	caspase 2|caspase 6	46 Only caspase 2 and far less efficiently caspase 6 process FCV capsid protein in vitro at cleavage sites that have not been described yet.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:21270..21541:sentences:7b16c4d3bf5692ea2bd1def0730315ff	EIF4E|TBP	CBP|TBP	Interestingly, AdE1A-binding abilities to transcription factors such as CBP and TBP are affected by the cleavage, suggesting that it might modulate the expression of early viral genes.. Unknown Functions of viral protein Caspase Cleavages: On her Majesty's Secret Service.
+SARS:1a6e69772e4e79d9106015988c0d6ed48dc25ceb:fulltext:679f1038ab0a2690d5e110c3b8c930a5:21639..21804:sentences:77b9c621876ca9f22f03cadf741e135c	CASP8|	caspase 8|caspases	MC159P, an MCV protein, exhibits antiapoptotic properties by protecting cells from Fas-induced apoptosis through caspase 8 inhibition but is not targeted by caspases.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:923..1220:sentences:9f5ceeea2445c0eea86ad5227f6d7eb7	TMPRSS2|ERG|ETV1|ETV4|TMPRSS2|ERG	TMPRSS2|ERG|ETV1|ETV4|TMPRSS2|ERG	The recurrent gene fusion event in prostate cancer involves an androgen controlled gene, TMPRSS2, and members (ERG, ETV1 and ETV4) of the ETS transcription factor family (2, 5, 6) . Among these fusion genes, TMPRSS2:ERG is the most prevalent and the only member detected in the majority of reports.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:1330..1938:sentences:53820b63b0f2e9db9da89c10c3d63ad9	TMPRSS2|TMPRSS2|ERG	TMPRSS2|TMPRSS2|ERG	It was found in approximately half (15-78%) of all prostate cancers (2, (6) (7) (8) (9) (10) (11) (12) (13) (14) (15) (16) (17) . As an androgen-related transcription factor controlling cell proliferation, TMPRSS2:ERG has been associated with disease pathogenesis and is a promising biomarker for prostate cancer progression, prognostication and early detection (18) (19) (20) (21) . While the presence of TMPRSS2:ETS fusion genes is highly prostate cancerspecific, its significance as a prognostic biomarker is still controversial partly because many of the clinical studies have been relatively small scale.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:2252..2393:sentences:2cce3ab0fff195a97b1ba81d3b294abd	TMPRSS2|ERG	TMPRSS2|ERG	Several approaches that have been used previously for hematological malignancies have been applied to detect TMPRSS2:ERG exon fusion variants.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:3202..3414:sentences:e934c0d6f8b4d3b1d09964c27d901c57	TMPRSS2|ERG	TMPRSS2|ERG	Here, we describe an exon array-based detection system, combined with a RT-PCR reaction, that accurately determines multiple TMPRSS2:ERG fusion transcripts in specimens with only a minor population of tumor cells.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:5224..5638:sentences:7435c2c87c8f7d7c442eead4923a4c23	CHGA|TMPRSS2|ERG|CHGA	CGA|TMPRSS2|ERG|CGA	The forward (GTT TCC CAG TCA CGA TCC AGG AGG CGG AGG CGG A) and reverse primers (GTT TCC CAG TCA CGA TCG GCG TTG TAG CTG GGG GTG AG) are located at exon 6 of ERG and exon 1 of TMPRSS2 respectively, as described (2, 9) . The 5 0 -ends of both primers have the sequence of primer B (GTT TCC CAG TCA CGA TC) for the subsequent step of PCR labeling with a single primer B as described previously (25) .. Probe labeling.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:9233..9281:sentences:10677ff6ef2d019edfc33507035f778c	TMPRSS2|ERG	TMPRSS2|ERG	Microarray-based TMPRSS2:ERG exon fusion mapping.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:9283..9611:sentences:281949c69b5126cad596b6df01c0836b	TMPRSS2|ERG	TMPRSS2|ERG	To develop a multiplexing assay that is highly sensitive in clinical samples of high complexity, we adopted our Virochip system (25) . The key protocol, Round ABC, designed for unbiased amplification (29) , is crucial for identifying various fusion variants in this application.. Microarray-based TMPRSS2:ERG exon fusion mapping.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:9613..9993:sentences:44dee6479468355a9c3f16021cb6fc5d	TMPRSS2|TMPRSS2|ERG|TMPRSS2|ERG|ERG|ERG	TMPRSS2|TMPRSS2|ERG|TMPRSS2|ERG|ERG|ERG	Through literature review, we found that most of the TMPRSS2:ERG fusion junctions are between exons 1 or 2 of the TMPRSS2 and exons 2-5 of the ERG (2, 7, 9, 13) . Such constraints perhaps are related to whether a functional ERG protein can be made from the gene fusions (9) . Therefore, we initially used a pair of primers at exon 1 of the TMPRSS2 and exon 6 of the ERG for RT-PCR.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:10260..10785:sentences:27f140ffc19f1ea3f5a43b43eec4a3fc	TMPRSS2|TMPRSS2|ERG|ERG	TMPRSS2|TMPRSS2|ERG|ERG	Printed on the array are 30-mer oligonucleotide probes derived from exons 1-3 of the TMPRSS2 and exons 1-5 of the ERG (Table 1) . Each selected sequence is represented by two complementary probes (F: forward and R: reverse complement) since sometimes PCR-labeled amplicons may bind to only one strand of the probe, based on empirical observations (25) . We observed that probes with reverse complementary (R) orientation worked consistently with our RT-PCR labeling protocol.. Microarray-based TMPRSS2:ERG exon fusion mapping.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:10787..10901:sentences:159f134a276eb007746acb222abcd2fe	TMPRSS2|ERG	TMPRSS2|ERG	A prostate cancer cell line, VCaP, (30) with a TMPRSS2 and ERG fusion (2) was used for initial feasibility testing.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:10903..11101:sentences:367984ca37dd4b103ca5b5592cb2a65b	TMPRSS2|ERG	TMPRSS2|ERG	The total RNA was subjected to RT-PCR with a pair of primers located at exon 6 of ERG and exon 1 of TMPRSS2 (2, 9) . The unpurified product was labeled and hybridized on the microarray ( Figure 1B ).
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:11103..11194:sentences:802f59d3f2831921f895b2ed5d9d526e	TMPRSS2|ERG	TMPRSS2|ERG	Only spots corresponding to exon 1 of TMPRSS2 and exons 4-5 of ERG developed strong signals.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:11196..11383:sentences:860b12bd3e0e5312aaa47c8df16410c8	TMPRSS2|TMPRSS2|ERG|ERG	TMPRSS2|TMPRSS2|ERG|ERG	This result indicates the fusion junction is at the exon 1 of TMPRSS2 and exon 4 of ERG, which is consistent with a previous report (2) .. Microarray-based TMPRSS2:ERG exon fusion mapping.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:11846..12006:sentences:5d6e41af63a57d86f039f5ff0e85cbe5	TMPRSS2|ERG	TMPRSS2|ERG	The level of sensitivity is superior to previous methods for detecting fusion transcripts (24) .. TMPRSS2:ERG fusion junction mapping in primary prostate cancer.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:12008..12226:sentences:dc841128ef3592e84cb3e9de7a98535a	TMPRSS2|ERG	TMPRSS2|ERG	To test the ability of the exon mapping array to detect and characterize TMPRSS2:ERG fusion transcripts in clinical samples, we isolated total RNA from frozen unpurified primary prostate tissues obtained during surgery.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:12228..12912:sentences:828bfda45d95127808a3b4a04287ad06	TMPRSS2|ERG	TMPRSS2|ERG	T1F  GGGCGGGGAGCGCCGCCTGGAGCGCGGCAG  T2F  ACATTCCAGATACCTATCATTACTCGATGC  T3F  GGTCACCACCAGCTATTGGACCTTACTATG  T1/2F  TGGAGCGCGGCAGGTCATATTGAACATTCC  G1F  AGGGACATGAGAGAAGAGGAGCGGCGCTCA  G2F  AGACCCGAGGAAAGCCGTGTTGACCAAAAG  G3F  GCTGGTAGATGGGCTGGCTTACTGAAGGAC  G4F  TTATCAGTTGTGAGTGAGGACCAGTCGTTG  G5F  CTCTCCTGATGAATGCAGTGTGGCCAAAGG  T1R  CTGCCGCGCTCCAGGCGGCGCTCCCCGCCC  T2R  GCATCGAGTAATGATAGGTATCTGGAATGT  T3R  CATAGTAAGGTCCAATAGCTGGTGGTGACC  T1/2R  GGAATGTTCAATATGACCTGCCGCGCTCCA  G1R  TGAGCGCCGCTCCTCTTCTCTCATGTCCCT  G2R  CTTTTGGTCAACACGGCTTTCCTCGGGTCT  G3R  GTCCTTCAGTAAGCCAGCCCATCTACCAGC  G4R CAACGACTGGTCCTCACTCACAACTGATAA G5R CCTTTGGCCACACTGCATTCATCAGGAGAG T, TMPRSS2; G, ERG.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:12914..13024:sentences:c0f674cf43c99317db6d4dcdc7763a40	TMPRSS2|ERG	TMPRSS2|ERG	F, forward probe; R, reverse complement probe.. TMPRSS2:ERG fusion junction mapping in primary prostate cancer.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:13265..13360:sentences:efd14c62b43f5170da34aba70535cfe3	TMPRSS2|ERG	TMPRSS2|ERG	The results showed that 7/20 cancers but 0/10 nonmalignant samples had TMPRSS2:ERG fusion genes.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:13910..14110:sentences:76fa9f8a2f002636a9e8d4f40b6a599d	TMPRSS2|ERG	TMPRSS2|ERG	In order to map multiple fusion junctions in a single assay, we redesigned the exon array to include junction probes between exons 1 and 2 of the TMPRSS2 gene and exons 1-6 of the ERG gene ( Table 2 ).
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:14336..14468:sentences:b6b5fcbab30cd542cd41b24a13ca00a7	TMPRSS2|ERG	TMPRSS2|ERG	In this case, the two fusion transcripts are between exon 4 of the ERG fused to either exon 1 (T1G4) or exon 2 (T2G4) of the TMPRSS2.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:14877..15027:sentences:44d86d8c263621776f3952b6cfdc3aa3	TMPRSS2|ERG	TMPRSS2|ERG	Table 3 also lists the percentages of cancer cells in the tumors, the Gleason tumor grades and the detected variants of TMPRSS2:ERG fusion transcripts.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:15621..16574:sentences:1da2758794eab9aa72b2a7c90afbd0ba	TMPRSS2|ERG	TMPRSS2|ERG	T1G1F  CCTGGAGCGCGGCAGCCCCCGAGGGACATG  T1G2F  CCTGGAGCGCGGCAGGTTATTCCAGGATCT  T1G3F  CCTGGAGCGCGGCAGCCGTCAGGTTCTGAA  T1G4F  CCTGGAGCGCGGCAGGAAGCCTTATCAGTT  T1G5F  CCTGGAGCGCGGCAGATGCCACCCCCAAAC  T1G6F  CCTGGAGCGCGGCAGATCCTACGCTATGGA  T2G1F  ATGGCTTTGAACTCACCCCCGAGGGACATG  T2G2F  ATGGCTTTGAACTCAGTTATTCCAGGATCT  T2G3F  ATGGCTTTGAACTCACCGTCAGGTTCTGAA  T2G4F  ATGGCTTTGAACTCAGAAGCCTTATCAGTT  T2G5F  ATGGCTTTGAACTCAATGCCACCCCCAAAC  T2G6F  ATGGCTTTGAACTCAATCCTACGCTATGGA  T1G1R  CATGTCCCTCGGGGGCTGCCGCGCTCCAGG  T1G2R  AGATCCTGGAATAACCTGCCGCGCTCCAGG  T1G3R  TTCAGAACCTGACGGCTGCCGCGCTCCAGG  T1G4R  AACTGATAAGGCTTCCTGCCGCGCTCCAGG  T1G5R  GTTTGGGGGTGGCATCTGCCGCGCTCCAGG  T1G6R  TCCATAGCGTAGGATCTGCCGCGCTCCAGG  T2G1R  CATGTCCCTCGGGGGTGAGTTCAAAGCCAT  T2G2R  AGATCCTGGAATAACTGAGTTCAAAGCCAT  T2G3R  TTCAGAACCTGACGGTGAGTTCAAAGCCAT  T2G4R  AACTGATAAGGCTTCTGAGTTCAAAGCCAT  T2G5R  GTTTGGGGGTGGCATTGAGTTCAAAGCCAT  T2G6R  TCCATAGCGTAGGATTGAGTTCAAAGCCAT T, TMPRSS2; G, ERG.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:17320..17718:sentences:9ab3eb402408b5c20bbb0408b289eb9b	TMPRSS2|TMPRSS2|ERG|ERG	TMPRSS2|TMPRSS2|ERG|ERG	We designed two probes for the FISH assays, one at the promoter region of TMPRSS2 (green in Figure 5 ) and the other at exon 2 of ERG (red in Figure 5 ). We observed heterogeneity of the FISH patterns in some primary prostate cancer samples ( Figure 5 ). It is more difficult to find interstitial deletions between TMPRSS2 and ERG in tumor samples containing low percentages of cancer cells by FISH.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:18041..18196:sentences:db54b5ffd28c56ec7153e3f852e384dc	TMPRSS2|ERG	TMPRSS2|ERG	We have established a simple assay that can concurrently profile variants of TMPRSS2:ERG fusion transcripts by combining a single RT-PCR with an exon array.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:18825..19237:sentences:61a667475bfdb7bca047494778d8d61c	TMPRSS2|ERG	TMPRSS2|ERG	1  30  7  T1-G4; T2-G4  2  2 0  5  3  5 0  5  4  20  6  T1-G4  5  8 0  9  6  1  6  7  9 0  8  8  2 0  4  9  8 0  8  10  1  6  T1-G2  11  2  6  12  70  7  13  20  9  T1-G4  14  1  6  15  70  8  T1-G4; T2-G4  16  20  8  17  80  8  T1-G4; T2-G4  18  50  7  T1-G2; T1-G3; T1-G4  19  80  7  20 80 7 Figure 5 . Heterogeneity of FISH patterns of interstitial deletion between TMPRSS2 and ERG in a primary prostate tumor.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:21277..21846:sentences:0d731c173b58bc50b55e3494ad02c6ff	FLI1|TMPRSS2|ERG	FLI1|TMPRSS2|ERG	The current assay should facilitate a thorough compilation of the gene fusion variants in primary prostate specimens, which may be useful for stratifying the aggressiveness of prostate cancer (13) . In this regard, fusion variants of EWS with another member of the ETS family, FLI1, have been shown to be an independent predictor of disease progression in Ewing's sarcoma (40, 41) . It will be of interest to compare in transfected cells the biological activities of the different TMPRSS2:ERG variants from patients with contrasting clinical outcomes (41) .. DISCUSSION.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:21848..22147:sentences:0b5dfa36dd3ee269ab5c37936148dfdd	TMPRSS2|ERG	TMPRSS2|ERG	While some studies have suggested that the presence of TMPRSS2:ERG fusions is associated with more aggressive disease or higher Gleason tumor grade, other investigators did not reach the same conclusion (12, 14, 17, 20, 23, 42) . We also did not find such an association in a small series of samples.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:22704..23140:sentences:966df37ac9ce92af9ed3014519d74024	TMPRSS2|TMPRSS2|ERG|ERG	TMPRSS2|TMPRSS2|ERG|ERG	Thus, there is past interest (24, 44) in applying TMPRSS2:ERG fusion assays for such application since PSA and many other markers in development are not truly prostate cancer-specific (45) . A recent study reported a TMPRSS2:ERG assay with a sensitivity of detecting 1600 VCaP cells (24) . However, this level of sensitivity might not be sufficient for broad clinical application, especially with small biopsy specimens or urine samples.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:23554..23863:sentences:a0180d093ff20d74d02e1f74569bf5d5	TMPRSS2|ETV1|TMPRSS2|ETV4|ABL1	TMPRSS2|ETV1|TMPRSS2|ETV4|BCR-ABL	The same strategy can be applied to detect other less prevalent fusion transcripts (TMPRSS2:ETV1 and TMPRSS2:ETV4) in prostate cancer (2, 5, 6) . In addition, the exon array approach can also be applied to other fusion genes, such as BCR-ABL in CML and clonal Ig/TCR rearrangements in lymphocytic malignancies.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:24306..24476:sentences:7367b49657f5a99c3d4a8f63ffca5cf8	TMPRSS2|ERG	TMPRSS2|ERG	There are some shortcomings of using RNA transcripts as prostate cancer biomarkers, despite our ability to achieve very sensitive detection of TMPRSS2:ERG fusion variants.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:24554..24859:sentences:367b6d073c1132dd86fa1fd3030bf7ba	TMPRSS2|ERG	TMPRSS2|ERG	Second, commonly used drugs that inhibit androgen growth pathways, including GnRH agonists and testosterone antagonists, may diminish the production of the TMPRSS2:ERG mRNA fusion transcript, thereby producing false-negative results in patients on hormonal therapy with evolving androgenindependent tumors.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:24861..25274:sentences:207921a532328c4d2b63db8dd8f2a87c	TMPRSS2|ERG|TMPRSS2|ERG	TMPRSS2|ERG|TMPRSS2|ERG	Indeed, it has been reported that TMPRSS2:ERG mRNA fusion transcripts are not expressed in androgen-independent tumors in spite of the presence of interstitial deletions in between TMPRSS2 and ERG at chromosome 21q22 (10) . While FISH is useful for identifying genomic rearrangements, it has relatively lower resolution and is difficult to use in highly heterogeneous samples with small percentages of tumor cells.
+SARS:1a7676018fd73150a122c2afb1362324dbab4918:fulltext:472d743ef435f2c1da50813532388c63:25276..25667:sentences:60cd97d9feae574fad06933ee6e12914	YME1L1|TMPRSS2|ERG	PAMP|TMPRSS2|ERG	We have recently developed a technology, designated Primer Approximation Multiplex PCR (PAMP) for identifying breakpoints in genomic DNA without the need to purify cancer cells from normal tissues (26) . We are optimizing this assay for detecting the breakpoints between TMPRSS2 and ERG loci for primary prostate tumors to overcome any potential problems associated with RNA based biomarkers.
+SARS:1b1b133fc211d0bf8af604d58bedafd5fac7cde9:abstract:113d5de3042eec4ca546a9a5a5304e28:736..956:sentences:39616bf9eb192c9f6563018adc993c88	SH2D3C|PRSS57	nsp3|nsp4	Three non-structural transmembrane proteins, nsp3, nsp4, and nsp6, were expressed in cells singularly or in combination and the effects on cellular membranes investigated using electron microscopy and electron tomography.
+SARS:1b42f78eee63e2f5c5a58a59759dc119ef1f73da:abstract:304db48be0e863291ca3288aa98f3ea6:758..956:sentences:f1378fd27ae59dde1082aa024dac060f	ACE2|REN	ACE2|renin	Mechanistically, cationic nanoparticles can directly bind ACE2, decrease its activity and down-regulate its expression level in lung tissue, resulting in deregulation of the renin-angiotensin system.
+SARS:1b4d2b000ee885e242aa3b237597158d17889125:abstract:c158f052eed6b65962b7d5a6f69fe203:0..182:sentences:652f28bda36b9079c826ca3dd0cb624f	CBX4|CPE|CPE	PC2|carboxypeptidase-E|CPE	Abstract Pro-protein convertase-2 (PC2) and carboxypeptidase-E (CPE) proteins are two major members of the pro-protein convertases that involve in the maturation of protein precursor.
+SARS:1b4d2b000ee885e242aa3b237597158d17889125:abstract:c158f052eed6b65962b7d5a6f69fe203:184..542:sentences:86ccce8d81afa1845f060a5070f265bd	CBX4|CBX4|CPE	PC2|PC2|CPE	By using PC2 activity, immunocytochemistry (ICC) and Western blot method, PC2, CPE and preproNPY protein expression levels were compared among mature retina tissue, RGC-5 cells and its differentiated cells, or brain cortex tissue, NS20Y tumor cells and its differentiated cells, or mature breast tissue, breast tumor cell RM1 and breast adenocarcinoma tissue.
+SARS:1b4d2b000ee885e242aa3b237597158d17889125:abstract:c158f052eed6b65962b7d5a6f69fe203:656..907:sentences:dd99a9bce940e674224ff5a3dd9aa6bf	CBX4|CPE	PC2|CPE	In the comparative experiments, more PC2 protein expression in the mature tissues and more CPE and preproNPY protein expression in the tumor cells or tumor tissue were observed, but no expression of preproNPY protein was observed in the mature tissues.
+SARS:1b4d2b000ee885e242aa3b237597158d17889125:abstract:c158f052eed6b65962b7d5a6f69fe203:1059..1202:sentences:ea1a152670adbaf83748d9ff0afde390	CBX4|CPE	PC2|CPE	The results demonstrated that the mature tissues showed stronger PC2/CPE-mediated pro-protein processing ability than the tumor cells or tissue.
+SARS:1b58422e266ab9339c919119923229d080f27360:title:d7e193ebd34c9716ab8d81c42b65494a:0..89:sentences:827fffa9fbdf6fde2d90971fd7698b82	ACE|ACE2|MMP9	ACE|ACE2|MMP-9	ACE/ACE2 Ratio and MMP-9 Activity as Potential Biomarkers in Tuberculous Pleural Effusions
+SARS:1b4d2b000ee885e242aa3b237597158d17889125:title:5d011d5733a741c0eb8ea30514a97d27:0..93:sentences:21c67c285d3bd0a25c7a93947df6f838	CBX4|CPE	PC2|CPE	PC2/CPE-mediated pro-protein processing in tumor cells and its differentiated cells or tissues
+SARS:1b47cb04a54a8bc6912840fa8ea1b0cf5f8084fe:title:ad8573c71d77b5ec519e5756cafc7451:0..205:sentences:42a40bacfc653e9ec91982a29a69b2c0	CHRNA1|HNRNPH2	CHRNA1|hnRNP H	Tannic acid facilitates expression of the polypyrimidine tract binding protein and alleviates deleterious inclusion of CHRNA1 exon P3A due to an hnRNP H-disrupting mutation in congenital myasthenic syndrome
+SARS:1b951e5d1f4773bd3cb1b558e18ea4527093184f:abstract:e4602923428ba76283ef748cd5f08edf:762..898:sentences:435e770f443feb2c6926c5124ff1c232	GZMB|UBC	Granzyme B|ubiquitin	We have developed two novel assays, UbL-Enterokinase light chain and UbL-Granzyme B, for quantifying ubiquitin and UbL protease activity.
+SARS:1bcfd5b202aad0aa650233d42247cf8c63864c67:abstract:9cc9a4d42661ba7d30f6c49172136d2c:787..995:sentences:92188a08038c0182107e3b5f5093710e	CTSB|CTSL	cathepsin B|cathepsin L	Here we show that the FECV strain WSU 79-1683 (FECV-1683) is highly dependent on host cell cathepsin B and cathepsin L activity for entry into the host cell, as well as on the low pH of endocytic compartments.
+SARS:1bcfd5b202aad0aa650233d42247cf8c63864c67:abstract:9cc9a4d42661ba7d30f6c49172136d2c:997..1118:sentences:cd87495a32d8044acdc27bbae0b01f6b	CTSB|CTSL	cathepsin B|cathepsin L	In addition, both cathepsin B and cathepsin L are able to induce a specific cleavage event in the FECV-1683 spike protein.
+SARS:1bcfd5b202aad0aa650233d42247cf8c63864c67:abstract:9cc9a4d42661ba7d30f6c49172136d2c:1120..1318:sentences:0c4548e976bda5a890fc0802b215a2c1	CTSL|CTSB	cathepsin L|cathepsin B	In contrast, host cell entry by the FIPV strains WSU 79-1146 (FIPV-1146) and FIPV-DF2 proceeds independently of cathepsin L activity and low pH, but is still highly dependent on cathepsin B activity.
+SARS:17c135abc3c6a212ba22ae3d3750e4a396933022:fulltext:f4ec99e984be805c54abf38c0bb9dab7:38017..38169:sentences:9c1dba572062371e8267e082704c9efc	NGFR|NTRK1	p75NTR|Trk	Peptidomimetics of the loop 1 and loop 4 domains of nerve growth factor can prevent neuronal death induced by p75NTR-dependent and Trk-related signaling.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:2486..2896:sentences:6172ed0f92abca3ef47f375cfe4732ba	EGFR|ERBB2|ERBB2|ESR1|PIK3CA|AKT1|MTOR	epidermal growth factor receptor|HER-2/neu|ErbB2|ER-alpha|PI3K|Akt|mTOR	The molecular mechanism underlying endocrine resistance of breast cancer is highly complicated and involves many molecules and pathways such as overexpression of epidermal growth factor receptor and/or the HER-2/neu/ErbB2 oncogene, 31 mutations in ER or loss of ER-alpha expression, 32,33 activation of the MAPK 32 and PI3K/Akt/mTOR signaling pathways, 34 and overexpression of cytochrome P450 (CYP450) enzymes.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:2898..3004:sentences:35b7f81c7a23e57a81dce880a5eaf557	PIK3CA|AKT1|MTOR	PI3K|Akt|mTOR	35 Among these factors, the activation of the PI3K/Akt/mTOR signaling pathway is dominant.. | INTRODUCTION.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:5189..5474:sentences:fb795211bb34fc1127639c325bb2a5f6	CCL2|TNF|TNF|CCL2|TNF	CCL2|tumor necrosis factor|TNF|CCL2|TNF	CCL2 and tumor necrosis factor (TNF) present in culture supernatants from MCF7-S, MCF7-R, M, MS, and MR macrophages were quantified using specific ELISA kits (Quantikine Human CCL2 Immunoassay and Quantikine Human TNF Immunoassay; R&D Systems) following the manufacturer's instructions.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:5544..5624:sentences:20852a300ca49186222770e4a40b94a9	CCL2|TNF	CCL2|TNF	CCL2 and TNF levels below the detection limit of the assay were recorded as zero.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:7990..8102:sentences:9c3b6d574c5eb10be0de57cd47c9c1cb	CD163|CCL2	CD163|CCL2	Correlation between CD163 and CCL2 was determined using Spearman rank-order correlation.. | Statistical analysis.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:9340..9432:sentences:eb9e36226cc01d8b994952ad91d060c3	CCR2|CCL2	CCR2|CCL2	We confirmed that CCR2, the receptor of CCL2, was expressed in both cell lines ( Figure S1 ).
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:9826..10059:sentences:919625704f2bba1dbe78ee46b70ebde1	CCL2|CCL2|PIK3CA|AKT1|MTOR	CCL2|CCL2|PI3K|Akt|mTOR	We found that CCL2 promotes endocrine resistance and reduces apoptotic proportion in the two hormone receptor-positive cell lines.. | CCL2 inhibits apoptosis and increases endocrine resistance by activating the PI3K/Akt/ mTOR pathway.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:10154..10350:sentences:c8ef4c8bd7c23fdc26eaa2cf9b44bb4f	PIK3CA|AKT1|MTOR|CCL2	PI3K|Akt|mTOR|CCL2	As the PI3K/Akt/mTOR signaling pathway is a classic pathway regulating cell proliferation, apoptosis, and endocrine resistance, we investigated the effect of CCL2 on the activation of this pathway.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:10352..10462:sentences:6890dc9dc33fd2dd5f915f3fe639adec	CCL2|AKT1|MTOR	CCL2|Akt|mTOR	When MCF7 cells were treated with 100 nmol/L CCL2, phosphorylation of Akt and mTOR was significantly increased.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:10464..10544:sentences:d7afed4a261ca0741f60b9b8ac4dd743	PIK3CA|AKT1|MTOR	PI3K|Akt|mTOR	Adding CM of MR to MCF7 cells also activated the PI3K/Akt/mTOR signaling pathway.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:10546..10739:sentences:0ef130ba94fa2746d002a7b7abced7da	CCL2|AKT1|MTOR	CCL2|Akt|mTOR	When MR was treated with 300 nmol/L Bindarit (a CCL2 synthesis inhibitor), the ability of the CM (MR + Bindarit) to increase the levels of phosphorylated Akt and mTOR was weakened ( Figure 2G ).
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:10741..11046:sentences:de7d42f4452cee1e8f40465a9737a73b	CCL2|PIK3CA|AKT1|MTOR|TNF|MTOR|FOXK1|CCL2	CCL2|PI3K|Akt|mTOR|Tumor necrosis factor alpha|mTORC1|FOXK1|CCL2	These results suggest that TAM promote endocrine resistance in breast cancer cells partly by secreting CCL2, which then activates the PI3K/Akt/ mTOR pathway.. | Tumor necrosis factor alpha and amino acid metabolism in CM activates the NF-kB and mTORC1-FOXK1 pathways of TAM promoting the secretion of CCL2.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:11048..11162:sentences:c0c2001a458a831747b21af61b928592	CCL2|TNF	CCL2|TNF	CCL2 secretion has been thought to be dependent on the transcription factor NF-B, which is activated by TNF in TME.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:11320..11508:sentences:34144918ec267bd1a3a9297c98105eb8	MTOR|FOXK1|MTOR|FOXK1|CCL2	mTORC1|FOXK1|mTORC1|FOXK1|CCL2	45 We tested the activation of the mTORC1-FOXK1 pathway in M, MS, and MR and found that activation of the mTORC1-FOXK1 pathway was consistent with the secretion trend of CCL2 ( Figure 3C ).
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:11510..11787:sentences:649e69b6e6a9dc0d08f683615dcda36b	TNF|MTOR|FOXK1|CCL2|GLI2|CCL2	TNF|mTORC1|FOXK1|CCL2|THP-1|CCL2	These results suggest that TNF and amino acid metabolism in CM activate the NF-B and mTORC1-FOXK1 pathways of TAM promoting the secretion of CCL2.. | Tumor-associated macrophages promote THP-1 and macrophage aggregation to the periphery of breast cancer cells by secreting CCL2.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:12120..12381:sentences:41032d477f1addfe0f72d25ff1e9f9c6	CCL2|PIK3CA|AKT1|MTOR|GLI2	CCL2|PI3K|Akt|mTOR|THP-1	The next question is whether the chemotaxis of THP-1 cells induced by these three F I G U R E 2 CC-chemokine ligand 2 (CCL2) secreted by tumor-associated macrophages (TAM) activates the PI3K/Akt/mTOR pathway to induce endocrine resistance in breast cancer cells.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:13399..13452:sentences:4039f29d9a690e9c9528c54cdb1abca8	PIK3CA|AKT1|MTOR	PI3K|Akt|mTOR	G, Western blot analysis of the PI3K/Akt/mTOR pathway.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:13454..13526:sentences:1c80b85b8bb218ffb773af0ff6d85eec	CCL2|PIK3CA|AKT1|MTOR	CCL2|PI3K|AKT|mTOR	CCL2 and CM of MR could activate the PI3K/AKT/mTOR pathway in MCF7 cells.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:13528..13627:sentences:39525f900c29139bb90fe6c2a0fba10e	PIK3CA|AKT1|MTOR	PI3K|AKT|mTOR	When MR was treated with Bindarit for 24 h, activation of the PI3K/AKT/mTOR pathway by CM decreased.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:13629..13946:sentences:41e04da483ebb6eb7e4d33d478cc7c0c	TNF|MTOR|FOXK1|TNF	TNF|mTORC1|FOXK1|tumor necrosis factor	*P < .05, **P < .01, ***P < .001 F I G U R E 3 Tamoxifen-sensitive MCF7 breast cancer cells (MCF7-S) and tamoxifen-resistant MCF7 breast cancer cells (MCF7-R) secrete tumor necrosis factor (TNF) and induce activation of the nuclear factor kappa B (NF-B) and mTORC1-FOXK1 pathways in tumor-associated macrophages (TAM).
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:14343..14395:sentences:280effd0b14f4bca302e768404a00b6b	MTOR|FOXK1	mTORC1|FOXK1	C, Western blot analysis of the mTORC1-FOXK1 pathway.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:14397..14467:sentences:a32d95eb005f81cbf80efc3c9d376af7	MTOR|FOXK1	mTORC1|FOXK1	CM of MCF7-S and MCF7-R could activate the mTORC1-FOXK1 pathway of TAM.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:14527..14618:sentences:32f0d3b18408f9fcc3a5504c0d5d5c09	MTOR|FOXK1	mTORC1|FOXK1	Therefore, CM of MCF7-R can promote activation of the mTORC1-FOXK1 pathway more than MCF7-S.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:14690..14995:sentences:e0aae00eaf290fda033e18f393173bdf	CCL2|GLI2	CCL2|THP-1	Results of the chemotaxis assay confirmed that the chemotaxis-inducing effect of TAM toward THP-1 cells was stronger than that of macrophages, the chemotaxis-inducing effect of MR was stronger than that of MS, and Bindarit the inhibitor of CCL2 reverses the enhanced chemotaxis ability of MR ( Figure 4A ).
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:15120..15343:sentences:366360526c95a41a436dc0970eee8bd7	CCL2|CD163	CCL2|CD163	Immunohistochemistry of serial pathological sections showed that a high expression of CCL2 in the paraneoplastic stroma was correlated with infiltration of CD163+ macrophages (r = 0.548, P < .001) ( Figure 4B and Table S2 ).
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:15345..15664:sentences:87e80fb2e8ecdcbd7a6bfa63f44eb491	CCL2|CCL2|GLI2|CCL2	CCL2|CCL2|THP-1|CCL2	We propose that tumor cells stimulate M2 polarization of macrophages, which leads to increased secretion of CCL2, and a high concentration of CCL2 in turn promotes THP-1 aggregation to form more M2-like macrophages.. | CCL2 expression in the stroma is correlated with poor PFS of patients with ER-positive breast cancer.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:16584..16727:sentences:5c2fcc0f95e476d8447e8eb4990899df	CCL2|CD163	CCL2|CD163	B, Representative images of immunohistochemical staining for CCL2 and CD163 and HE staining in serial sections from human breast cancer samples.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:17250..17556:sentences:5305f4458cc68ff75c35b92eff4c7eeb	CCL2|PIK3CA|AKT1|MTOR|CCL2|CCL2	CCL2|PI3K|Akt|mTOR|CCL2|CCL2	C, Proposed model for TAM-secreted CCL2 activating the PI3K/Akt/mTOR pathway to promote a malignant cycle of endocrine resistance and recruitment of monocytes (Table S3) Results showed that PFS of the CCL2 high-expression group was significantly shorter than that of the CCL2 low-expression group (P < .05).
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:17907..18029:sentences:274c4447c12eb40c664ee10a08791ef8	CCL2|PIK3CA|AKT1|MTOR	CCL2|PI3K|Akt|mTOR	We also found that TAM promote endocrine resistance by secreting CCL2, which activates the PI3K/Akt/mTOR signaling pathway.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:18304..18513:sentences:458e093308c009592b66f1339c228720	CCL2|CD163	CCL2|CD163	Analysis of tissue samples from patients with hormone receptor-positive breast cancer confirmed a correlation between high expression of CCL2 in the paraneoplastic stroma and infiltration of CD163+ macrophages.
+SARS:17f00e096a5f3ce94278a77011e6f38d7a47c618:fulltext:2f671bbbe57381f9858b09ff4d93e495:19562..19667:sentences:168b8bda36f23c64d25e3ce621541bec	CCL2|PIK3CA|AKT1|MTOR	CCL2|PI3K|Akt|mTOR	We found that CCL2 activates the PI3K/Akt/mTOR pathway, which is a classical endocrine resistance pathway.
+SARS:1bf18631b9c161ea2834b3d7c8ea42875319d18c:fulltext:de72e25760af00077a8e8e9fc2f02392:8482..8653:sentences:80ead4f53709b15d5b05b1e950ce4171	ISG15|MX1	ISG15|MX1	Where necessary (viral titers, viral UpE gene copy numbers, and ISG15 and MX1 mRNA expression levels), log 10 transformation was carried out to achieve normal distribution.
+SARS:1bf18631b9c161ea2834b3d7c8ea42875319d18c:fulltext:de72e25760af00077a8e8e9fc2f02392:11751..11984:sentences:445d1a79917a12db6d216f86241865f5	CXCL10|ISG15|MX1|TNF	IP-10|ISG15|MX1|TNF	4) . Cell lysates were collected at 6, 24, and 48 h postinfection, and mRNA expression of the IFN-inducible genes IP-10, ISG15, and MX1 and the proinflammatory cytokine TNF- is shown as the mean and SEM of three biological replicates.
+SARS:1bf853d3436f05746060ca8cc0ff18788784747a:abstract:78cb7a0af765239a993f2ef10e0f5d72:117..435:sentences:45fa79d45845afc4dd1419f989fccdd2	MBL2|MBL2|COLEC11|MASP2|MASP1|MASP2	mannan-binding lectin|MBL|collectin 11|MBL-associated serine proteases 1 and 2|MASP-1|MASP-2	After binding of mannan-binding lectin (MBL), ficolins or collectin 11 to carbohydrates or acetylated residues on pathogen surfaces, dimers of MBL-associated serine proteases 1 and 2 (MASP-1 and MASP-2) activate a proteolytic cascade, which culminates in the formation of the membrane attack complex and pathogen lysis.
+SARS:1bf853d3436f05746060ca8cc0ff18788784747a:abstract:78cb7a0af765239a993f2ef10e0f5d72:673..776:sentences:6d1f1e3bb1c38455734b02cefed1c39c	MASP1|MASP2	MASP1|MASP2	Polymorphisms in MASP1 and MASP2 genes are associated with protein serum levels and functional activity.
+SARS:1b58422e266ab9339c919119923229d080f27360:abstract:1b41da9a029b4bf0c18c6451f8c6cb8f:419..688:sentences:91bdbbf21eaa282de5cb2cbb478b6b31	ACE|ACE|ACE2|MMP2|MMP9	angiotensin converting enzyme|ACE|ACE2|MMP-2|MMP-9	Experimental design: The major components in RAS and extracellular matrix metabolism, including angiotensin converting enzyme (ACE), ACE2, MMP-2 and MMP-9 activities, were measured and compared in the patients with transudative (n = 45) and exudative (n = 80) effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:abstract:1b41da9a029b4bf0c18c6451f8c6cb8f:819..994:sentences:92984d7e0f3ec0f06443afcb50eb8859	ACE|ACE2|ACE|ACE2	ACE|ACE2|ACE|ACE2	Results: Increased ACE and equivalent ACE2 activities, resulting in a significantly increased ACE/ACE2 ratio in exudates, were detected compared to these values in transudates.
+SARS:1b58422e266ab9339c919119923229d080f27360:abstract:1b41da9a029b4bf0c18c6451f8c6cb8f:1074..1187:sentences:ff8aa4b069a2e9bc91a8eec10a385bdc	ACE|ACE2	ACE|ACE2	The significant correlation between ACE and ACE2 activity that was found in transudates was not found in exudates.
+SARS:1b58422e266ab9339c919119923229d080f27360:abstract:1b41da9a029b4bf0c18c6451f8c6cb8f:1189..1386:sentences:9430fe7f4fc015e337584f87163e08b4	ACE|MMP9|ACE2	ACE|MMP-9|ACE2	Advanced analyses showed significantly increased ACE and MMP-9 activities, and decreased ACE2 activity in tuberculous pleural effusions compared with those in pneumonia and adenocarcinoma effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:abstract:1b41da9a029b4bf0c18c6451f8c6cb8f:1388..1577:sentences:cae3842ff42ed69c8b165d67020ab957	ACE|MMP9	ACE|MMP-9	The results indicate that increased ACE and MMP-9 activities found in the exudates were mainly contributed from a higher level of both enzyme activities in the tuberculous pleural effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:abstract:1b41da9a029b4bf0c18c6451f8c6cb8f:1579..1758:sentences:42d75117b7b4cb05ce16f98bb1e410c7	ACE|ACE2|MMP9	ACE|ACE2|MMP-9	Conclusion: Interplay between ACE and ACE2, essential functions in the RAS, and abnormal regulation of MMP-9 probably play a pivotal role in the development of exudative effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:abstract:1b41da9a029b4bf0c18c6451f8c6cb8f:1760..1898:sentences:e346aca6dfe6e4acde7a6b42dde81460	ACE|ACE2|MMP9	ACE|ACE2|MMP-9	Moreover, the ACE/ACE2 ratio combined with MMP-9 activity in pleural fluid may be potential biomarkers for diagnosing tuberculous pleurisy.
+SARS:17bfdf17f46ae63e52c3e7c085bac97057e9ae61:fulltext:252a21ed454455b750374fc390588474:65..218:sentences:1ed692a13abc5c0a5788b1ebafa6effd	EXOSC2|	p7 and nonstructural protein 2|NS2	The viroporin p7 and nonstructural protein 2 (NS2) are accessory factors required for the assembly of infectious HCV particles (reviewed in reference 10).
+SARS:17bfdf17f46ae63e52c3e7c085bac97057e9ae61:fulltext:252a21ed454455b750374fc390588474:220..619:sentences:be0f67c1710932813d4f9b4a5326db0c	F2|NTPCR|KRAS|KRAS|KRAS	serine protease|NTPase|NS3|NS3|NS3	The minimal HCV replicase comprises the remaining nonstructural proteins NS3, NS4A, NS4B, NS5A, and NS5B (11) . NS3 is composed of two domains comprising an N-terminal serine protease that is activated by interaction with NS4A and responsible for proteolytic maturation of the replicase proteins and an NTPase/RNA helicase domain formed by the C-terminal two-thirds of NS3 (reviewed in reference 12).
+SARS:17bfdf17f46ae63e52c3e7c085bac97057e9ae61:fulltext:252a21ed454455b750374fc390588474:25014..26134:sentences:64c7f27f9d721aa2897cd953b71f0d03	|RTN2|RTN2|SH2D3C|RTN2|RTN2	nsp3, -4, and -6|nsp2|nsp2|nsp3|nsp2|nsp2	Distinct membrane-remodeling activities of protein precursors have been reported for poliovirus (43) , which, similar to HCV, induces DMVs in infected cells (44) . Moreover, in the severe acute respiratory syndrome coronavirus, three full-length transmembrane-containing nonstructural proteins (nsp3, -4, and -6) are needed to induce the formation of DMV-like structures that are morphologically similar to those found in infected cells (45) . Single expression of each of these nsps leads to a distinct membrane rearrangement such as membrane proliferation or induction of vesicles, but DMV formation appears to require the concerted action of all three nsps (45) . Along these lines, it is also known that the expression of replicase subunits nsp2 to nsp7 of arteriviruses induces membrane changes similar to those in infected cells (46) , with nsp2 and nsp3 playing the main role in inducing a membrane-bound scaffold for the arterivirus replication complex (46) . However, conversely to our findings, cleavage of the nsp2/3 junction by the nsp2 protease was not essential for the formation of DMVs (47) .. DISCUSSION.
+SARS:17fd86bef40a55871ecfc83dc845f3a988bf4aaa:fulltext:4b0f91865c47890ce684638ee6783ec0:776..1172:sentences:af357dc8fdabdf03e15a918d2dc898e0	EFNA1|EFNA1|EFNA2|EFNA5|EFNB1|EFNB2	ephrin-A1|ephrin-A1|ephrin-A2|ephrin-A5|ephrin-B1|ephrin-B2	To monitor ephrin binding, different concentrations of the indicated recombinant soluble ephrin ligands (human ephrin-A1 Fc transiently expressed in 293 cells and purified; mouse ephrin-A1, mouse ephrin-A2, human ephrin-A5, mouse ephrin-B1, and mouse ephrin-B2 from the ephrin sampler pack 3, SMPK3, R&D Systems; Minneapolis, MN) were injected over the captured CedV sG at a flow rate of 25 L/min.
+SARS:1c502cd68df3beab9bf303195a545ee76b198801:abstract:ddfe09d839723a02ff082cdf8e5e2e83:681..780:sentences:8adacfd371a37aa1ad7f1e810d8392f4	ENPEP|SORT1|CPD|SORT1	GP160|GP95|GP180|GP95	of 180,000 (GP160), 110,000, and 95,000 (GP95), while 2c had GP180, GP105, GP95, and one with a M.W.
+SARS:1c9f7f000678d675ea274867fc737f53ce4d7d95:abstract:b323f4de43c7218174adfc3c64ca4b12:629..943:sentences:4c3b2e837f21b5148afacc137c2d6889	MAPK14|TNF|IL1B|IL1A	p38|TNF-alpha|interleukin-1 beta|IL-1 beta	Here we show that infection of primary blood-derived feline mononuclear cells by FIPV WSU 79-1146 and FIPV-DF2 leads to rapid activation of the p38 MAPK pathway and that this activation regulates production of the pro-inflammatory cytokine tumor necrosis factor alpha (TNF-alpha) and interleukin-1 beta (IL-1 beta).
+SARS:1c9f7f000678d675ea274867fc737f53ce4d7d95:abstract:b323f4de43c7218174adfc3c64ca4b12:1120..1341:sentences:c139ba513e8af604901b4c7848d7dcc0	MAPK14|TNF	p38|TNF-alpha	FIPV-induced p38 MAPK activation was observed in primary feline blood-derived mononuclear cells individually purified from multiple SPF cats, as was the inhibition of TNF-alpha production by pyridinyl imidazole inhibitors.
+SARS:1bfdb418d0771a30669663e4fa7bc18f5745d780:fulltext:bbf62fcb422926a3f5b5469f4278150e:1251..1608:sentences:93d33113c6e0a7662048ac55913d0e8b	ACE|ACE|KNG1|AGT|AGT|AGT	Angiotensin converting enzyme|ACE|bradykinin|angiotensin I|angiotensin II|Angiotensin II	Angiotensin converting enzyme (ACE) breaks down the potent vasodilator, bradykinin to its inactivate metabolite and catalyzes angiotensin I to angiotensin II. Angiotensin II promotes hyperplasia and hypertrophy of vascular smooth muscle cells, induces the production of proinflammatory cytokines and causes endothelial dysfunction by free radical generation.
+SARS:1bfdb418d0771a30669663e4fa7bc18f5745d780:fulltext:bbf62fcb422926a3f5b5469f4278150e:7778..8126:sentences:ec072c27b10052e4abc0cb2069b2cecb	ACE|KNG1|ACE	ACE|bradykinin|ACE	(26) reported that the II genotype of ACE gene contributes to vascular dilatation at the site of aneurysm by 1) increased bradykinin activity, 2) another polymorphism responsible for vascular dilatation that is in linkage disequilibrium with ACE I/D polymorphism, 3) degeneration of endothelial cells, or 4) lack of vascular remodeling.. DISCUSSION.
+SARS:1cf210a0d7ab5720ae83bad2276f73299bd89a78:abstract:1251a610d866ccdf3c735e256df97464:259..430:sentences:cfc7f229695f6ba9c5c28cad2606dcde	IL10|IFNG	IL10|IFNg	Using intracellular staining, we found that in both GC patients and healthy controls, the majority of IL10-expressing CD8 T cells also presented concurrent IFNg expression.
+SARS:1cf210a0d7ab5720ae83bad2276f73299bd89a78:abstract:1251a610d866ccdf3c735e256df97464:432..662:sentences:afe9f87b149c7a81ea4da24ee233e56c	IFNG|IL10|IFNG|IL10	IFNg|IL10|IFNg|IL10	Interestingly, the frequency of IFNg+IL10+ CD8 T cells was significantly higher in GC patients than in healthy controls, while the frequency of IFNg+IL10- CD8 T cells was significantly lower in GC patients than in healthy controls.
+SARS:1cf210a0d7ab5720ae83bad2276f73299bd89a78:abstract:1251a610d866ccdf3c735e256df97464:664..821:sentences:737e8c83a649e4d90e3eddc7a45ba0f0	IFNG|IL10|IFNG|IL10	IFNg|IL10|IFNg|IL10	Compared to the IFNg-IL10- CD8 T cells, both IFNg+IL10- and IFNg+IL10+ CD8 T cells presented significantly higher expression of activation/inhibitory markers.
+SARS:1cf210a0d7ab5720ae83bad2276f73299bd89a78:abstract:1251a610d866ccdf3c735e256df97464:823..936:sentences:a7bc973ffca7af1d1db05109a4557d88	PDCD1|HAVCR2|KLRG1|IFNG|IL10	PD1|TIM3|KLRG1|IFNg|IL10	Interestingly, the IFNg+IL10+ cells presented lower PD1 and TIM3 and higher KLRG1 than the IFNg+IL10- CD8 T cells.
+SARS:1cf210a0d7ab5720ae83bad2276f73299bd89a78:abstract:1251a610d866ccdf3c735e256df97464:938..1062:sentences:be06be5e51df16c484fbb55517e6ac44	IFNG|IL10|CXCR5	IFNg|IL10|CXCR5	Remarkably, the IFNg+IL10+ CD8 T cells, but not the IFNg+IL10- CD8 T cells, were highly enriched in the CD45RO+CXCR5+ subset.
+SARS:1cf210a0d7ab5720ae83bad2276f73299bd89a78:abstract:1251a610d866ccdf3c735e256df97464:1064..1155:sentences:9aac1a34e90cbfb6b1995b09799879a6	IFNG|IL10	IFNg|IL10	Prolonged activation resulted in significant enrichment of IFNg+IL10+ CD8 T cells over time.
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:abstract:8902f7570dc184bbf79f6af4a956121d:1039..1262:sentences:46159f0160d3dbfc02446de3806bea95	|PRNP	hAd5|PrP	Oral immunization of white-tailed deer with hAd5:tgG-RL induced PrP(Sc)-specific systemic and mucosal antibody responses with an encouraging safety profile in terms of no adverse health effects nor prolonged vector shedding.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:396..1919:sentences:c7446fb51ee3f5e201f3939395009d9e	IFITM1|IFITM2|IFITM3|IFITM3|IFITM1|IFITM1|IFITM3|IFITM3|IFITM3|IFITM3|IFNA1	IFITM1|IFITM2|IFITM3|IFITM3|IFITM1|CD225|IFITM3|Ifitm3|IFITM3|IFITM3|IFN	Viral ribonucleoproteins (vRNPs) then enter the cytosol and translocate to the nucleus to commence replication (Medina and Garca-Sastre, 2011) . IFITM1, IFITM2, and IFITM3 comprise a family of restriction factors that possess broad antiviral activities Jiang et al., 2010; Mudhasani et al., 2013) . IFITM3 is most active against IAV and resides in late endosomes and lysosomes, while IFITM1 is located on the cell surface and blocks hepatitis C virus (HCV) and the filoviruses Ebola and Marburg Wilkins et al., 2013) . The IFITM proteins are members of the CD225 protein superfamily and contain two intramembrane domains (IM1 and IM2), which traverse through the cytosolic-facing leaflet of the lipid bilayer and are joined by a conserved intracellular loop (Yount et al., 2012) . IFITM3 plays a critical role in vivo because Ifitm3 / mice succumb to a normally mild IAV infection (Bailey et al., 2012; Everitt et al., 2012) . Furthermore, individuals with a variant of IFITM3 are more likely to suffer a worse course of influenza Zhang et al., 2013) . IFITM3 accounts for 50% to 80% of the in vitro protective effects of interferon (IFN) against IAV and blocks viral particle fusion subsequent to endocytosis, thereby preventing the cytosolic entry and nuclear translocation of vRNPs Weidner et al., 2010) . The IFITMs thus represent a restriction factor family of growing translational importance that protects the host at the earliest stages of infection (Diamond and Farzan, 2013; Perreira et al., 2013) .. INTRODUCTION.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:2009..2663:sentences:dd9cf63097b7ab9beff562447ef0605e	IFITM1|IFITM2|IFITM3|VAPA	IFITM1|IFITM2|IFITM3|VAPA	For example, it has been reported that the IFITMs decrease membrane fluidity and block viral-envelope-induced hemifusion, the latter conclusion predicated on the alleviation of an IFITM block to cell-to-cell fusion by oleic acid (Li et al., 2013) . Moreover, it has been postulated that the IFITMs inhibit VSV-g-mediated fusion by disrupting normal lipid trafficking, resulting in elevated levels of cholesterol in the late endosomal and lysosomal membranes . This last observation may arise from a direct interaction between the IM2 domains of IFITM1, IFITM2, and IFITM3 and the endocytic trafficking protein vesicle-associated membrane protein A (VAPA).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:2665..2991:sentences:9410589df385ad6e7d402211e0d01caf	VAPA|VAPA|OSBP|OSBP|OSBP|VAPA	VAPA|VAPA|oxysterol binding protein|OSBP|OSBP|VAPA	IFITM binding to VAPA may interfere with the interaction of VAPA with oxysterol binding protein (OSBP), a known regulator of cholesterol trafficking (Wyles et al., 2002) . Therefore, IFITMs are envisioned to compete with OSBP for binding to VAPA, producing elevated levels of cholesterol that block viral fusion.. INTRODUCTION.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:5942..6070:sentences:b740d94d1f8c28ebf6a4a3ac676196d4	KRT31|KRT35|KRT37	HA1|HA5|HA7	Therefore, we tested the effect of AmphoB on the infectivity of viral pseudoparticles that express the HA1, HA5, or HA7 proteins.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:6072..6496:sentences:5e5146424883000879702b1d6fc97e66	IFITM3|KRT31|IFITM3|KRT31	IFITM3|HA1|IFITM3|HA1	Consistent with its overcoming IFITM3, AmphoB treatment enhanced the infectivity of all of the HA-expressing particles ( Figure 1C) . Notably, the infectivity of particles bearing PR8's HA1 was uniquely increased in the vector cells treated with AmphoB, suggesting that the residual infectivity seen when IAV PR8 is used with IFITM3-depleted cells ( Figure 1A ) is the result of an intrinsic property of the PR8 HA1 envelope.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:7317..7567:sentences:0466e989f242020b1d187eb7316dd774	IFITM3|IFNA1|IFNA1	IFITM3|IFN|IFNa	Notably, therapeutically administered maximal concentrations of AmphoB and AmBisome range from 1 to 3 mM (Bellmann, 2007) . Given IFITM3's role in the IFN response, we determined the effect of AmBisome on IFNa-induced restriction of IAV ( Figure 1F ).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:7569..7868:sentences:1f5dc7c4b98dd01d96f82c00ebcc3d8a	IFNA1|IFNA1|IFITM3|IFNA1|IFITM3	IFN-a|IFN|IFITM3|IFN'|IFITM3	IFN-a inhibited IAV infection in both the vector and IFITM3 cells, with the addition of AmBisome rescuing >60% of IAV infectivity, consistent with the 60%-80% of the IFN response that is lost with IFITM3 depletion . Thus, AmBisome removes the majority of IFN's protection from IAV in vitro.. RESULTS.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:11224..11471:sentences:d40467c47054abc4c2429bf8968ec8ae	IFITM1|IFITM2|IFITM3	IFITM1|IFITM2|IFITM3	(B) A549 cells stably transduced with vector alone (Vector) or with IFITM1 (M1), IFITM2 (M2), or IFITM3 (M3) were incubated for 1 hr with increasing concentrations of AmphoB followed by infection with IAV WSN/33 for 12 hr and immunostaining for HA.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:11670..11725:sentences:8b2db1456f27f6dd4428ae378f1677c5	IFITM1|IFITM2|IFITM3	IFITM1|IFITM2|IFITM3	M1, IFITM1 (gray); M2, IFITM2 (green); M3, IFITM3 (red).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:13307..13437:sentences:5ffd9e38f47018b07ab5e4045687e714	IFITM1|IFITM2|IFITM3	IFITM1|IFITM2|IFITM3	To determine the specificity of AmphoB's actions, we compared its effect on A549 cells stably expressing IFITM1, IFITM2, or IFITM3.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:13439..13642:sentences:bf5b40b4ec3a71fc9c2f5d6e0f24b061	IFITM2|IFITM3|IFITM1	IFITM2|IFITM3|IFITM1	These experiments showed that while AmphoB effectively counteracts IFITM2 and IFITM3, its neutralization of IFITM1 was considerably less, with only a 1.4-fold increase in infection observed ( Figure 2B ).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:13751..13921:sentences:b23e5e751bb9b3a6324892ad13eb7d4f	IFITM3|FUZ|IFITM1|IFITM1|IFITM3|FUZ	IFITM3|NTD|IFITM1|IFITM1|IFITM3|NTD	IFITM3's N-terminal domain (NTD) was fused with the remaining portions of IFITM1 to generate M3M1, and the NTD of IFITM1 was fused to IFITM3 to produce M1M3 ( Figure 2C ).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:14320..14477:sentences:32dea3b5d0d92b4b79c4f66bf185ef6f	IFITM2|IFITM3|IFITM1|IFITM3	IFITM2|IFITM3|IFITM1|IFITM3	These results reveal that AmphoB impacts IFITM2 and IFITM3 greater than IFITM1 and that this susceptibility resides in amino acids 51-133 of IFITM3.. RESULTS.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:14921..15089:sentences:c0274774b1dc849a106ae6263a2e0ac8	||FPR2|IFITM3	RAB7|RAB7|RFP|IFITM3	To test this idea, HeLa-vector and HeLa-IFITM3 cells were stably transduced with a RAB7red fluorescent protein (RAB7-RFP) to identify their late endosomes and lysosomes.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:15257..15397:sentences:ce3ac3ee8296d1404e7a6b400182d0ad	IFITM3|	IFITM3|RAB7	Calculating the ratio of these two signals allowed us to determine that IFITM3 increased the acidity in the RAB7 compartments ( Figure S2A ).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:16684..16879:sentences:cf6bb371d990dd59fd62739dfe4a986f	ANGPT2|IFITM3	ANG-2|IFITM3	Vector and IFITM3 cells were treated with AmphoB, nystatin (a related heptaen), or three Na + ionophores, then incubated with a cell-impermeable fluorescent indicator, Asante Na + green 2 (ANG-2).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:16988..17231:sentences:05ee3219f43b1b8b393cb81092f18738	ANGPT2|ANGPT2|IFITM3|IFITM3|IFITM3	ANG-2|ANG-2|IFITM3|IFITM3|IFITM3	The HeLa-IFITM3 cells showed a higher ANG-2 signal than vector (normalized maximum ANG-2 intensity of IFITM3 cells = 1.28, vector = 1.0; p value = 2.2 3 10 5 ; Figure 3A ), indicating that IFITM3 increases endosomal salinity as well as acidity.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:19124..19680:sentences:40e70f786ab2bc69a1275df9ddc449dd	IFITM3|VAPA|IFITM3|IFITM1|IFITM3	IFITM3|VAPA|IFITM3|IFITM1|IFITM3	Because AmphoB binds cholesterol and overcomes IFITM3mediated restriction, we were intrigued by recent studies regarding the IFITMs and VAPA, cholesterol, and oleic acid; therefore, we tested the role of these factors in IFITM3-mediated Cell Reports 5, 895-908, November 27, 2013 2013 The Authors 899 However, lowering the levels of intracellular cholesterol in A549 cells using methyl-b-cyclodextrin (MbCD) or lovastatin resulted in no appreciable difference in restriction of IAV WSN/33 by IFITM1 or IFITM3, with or without AmphoB treatment ( Figure 4A ).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:19980..20332:sentences:dadb32371a2d8052935cb1d04afba867	IFITM1|IFITM3|VAPA|IFITM3|VAPA|IFITM3	IFITM1|IFITM3|VAPA|IFITM3|VAPA|IFITM3	Notably, treatment of the A549 cell lines with oleic acid had no effect on either IFITM1-or IFITM3-mediated restriction of IAV WSN/33 (Figure 4B) . Overexpression of both VAPA and IFITM3 in A549 cells, or VAPA alone in HeLa cells, generated a modest alleviation of IFITM3-mediated restriction of either IAV PR8 or IAV WSN/33 infection ( Figures 4D-4F ).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:20334..21138:sentences:8d4ede3e7c9862e8f8819a71676d19eb	PICK1|IFITM3|VAPA|IFITM3|VAPA|IFITM3	Pick|IFITM3|VAPA|IFITM3|VAPA|IFITM3	Neiman-Pick type c1 fibroblasts contain a mutation that results in high levels of cholesterol in late endosomal and lysosomal membranes, but this characteristic did not diminish IAV WSN/33 infection (Figures 4G and 4H; . Last, three alanine scan (AS) mutant A549 proteins, each possessing six contiguous residues changed to alanine collectively spanning the IM2 region of IFITM3 that interacts with VAPA, had no loss in restriction compared to WT IFITM3, nor did their respective mutations result in any alterations in lysosomal cholesterol levels (Figures S3D-S3G; John et al., 2013) . These data suggest that neither VAPA nor cholesterol nor the alleviation of a block to hemifusion by oleic acid plays a substantial role in either IFITM3-mediated restriction of IAV or its reversal by AmphoB.. RESULTS.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:21437..21579:sentences:8713e749d3fe42c7e4f73cae4d1bbaf6	IFITM1|MTOR	IFITM1|FRAP	To test this idea, we measured the membrane fluidity of cells stably expressing IFITM1 using fluorescence recovery after photobleaching (FRAP).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:21581..21926:sentences:f28cf31a38d6b47260783cee46ced60b	IFITM1|IFITM1|IFITM3|MTOR	IFITM1|IFITM1|IFITM3|FRAP	We chose to use COS-7 cells stably transduced with IFITM1 due to their planar morphology and because IFITM1 is predominantly cell-surface expressed as compared to IFITM3, which resides in late endosomes and lysosomes that were not amenable to FRAP studies due to their small size and continued movements (data not shown; Figure 5A ; Figure S4A ).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:22585..23153:sentences:87507bf24c61a9408c5d0baf87ee972e	IFITM1|CAV1|IFITM1|IFITM1|IFITM3	IFITM1|CAV1|IFITM1|IFITM1|IFITM3	Consistent with previous reports, and in contrast to IFITM1, CAV1 expression increased membrane fluidity, demonstrating the specificity of IFITM1's actions (Cai et al., 2004) . To test for a functional effect, we emulated elegant studies that established that IAV and other fusogenic viruses can induce tissue culture cells to form syncytia when exposed to low pH (White et al., 1981 (White et al., , 1982 . We incubated the COS-7 cell lines (vector, IFITM1, and IFITM3) with concentrated IAV PR8 on ice, followed by the addition of warm buffer at either pH 5.0 or 7.5.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:23261..23722:sentences:54f3ac9280c020ffa97a775ac667385a	IFITM1|IFITM3|IFITM3|ACTB	IFITM1|IFITM3|IFITM3|actin	Quantitation of syncytia, based on clustering of nuclei and the absence of intervening bands of actin ( Figure 5E ), showed there were less fusion events occurring among the IFITM1 cells (1.5%  0.4% fused cells) as compared to either the IFITM3 cells or the vector control cells (3.6%  0.6% fused cells, p < 0.05; Figures 5F and 5G) . We interpret the lack of effect by IFITM3 in this assay to be attributable to its location in the late endosomes and lysosomes.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:23724..23849:sentences:aae96908ba66abcd3f085c59501ff54d	IFITM1|IFITM3	IFITM1|IFITM3	The levels of the exogenously expressed IFITM1 and IFITM3 proteins were seen to be comparable by immunoblotting ( Figure 5H ).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:25843..26041:sentences:58b755a33068484e11d9ca0ef7ecf0fb	ANGPT2|IFITM3	ANG-2|IFITM3	(D) Confocal images of the relative levels of endosomal sodium based on the fluorescent signal of ANG-2 (green) in A549-vector or A549-IFITM3 cells with or without treatment with AmphoB, TEA, or ACh.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:26746..26940:sentences:9b773bd5631632fec364f34265e27aea	IFITM3|IFITM2	Ifitm3|Ifitm2	Similar to above, the Ifitm3 / cells treated with AmphoB demonstrated a slightly increased infection with X-31, suggesting that Ifitm2 or an additional component is also being overcome by AmphoB.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:27263..27684:sentences:16c64f3328c86b56b9db970b3d420d05	IFITM3|IFITM3|IFNA1	IFITM3|IFITM3|IFN'	Upon investigating this phenomenon, we found that overcoming IFITM3 is a principal component of AmphoB-enhanced IAV infection, both confirming and significantly extending a previous study reported during this investigation (Roethl et al., 2011) . Of consequence, we also showed that by neutralizing IFITM3's block to viral fusion, AmphoB removed more than 60% of IFN's protective effects against IAV in vitro.. DISCUSSION.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:28644..29826:sentences:e39a4b54e69dbecbb88f20de365af8a8	IFITM1|CD4	IFITM1|CD4	Consistent with this, IFITM1 inhibits both HCV and HIV-1 (Schoggins et al., 2011; Wilkins et al., 2013) , and a separate study has reported that the restricted mobility of one of the two HIV-1 host receptors, CD4, can inhibit viral fusion (Rawat et al., 2008) . Similarly, recent work has elegantly shown that the clustering of multiple viral envelopes is needed for IAV entry, suggesting that this activity may be hindered by IFITMs residing in the host-derived viral and/or host membranes (Ivanovic et al., 2013) . Second, IFITM homo-and heteromers within the membrane may stabilize membrane complexes by inhibiting dissociation, i.e., stabilizing the vacuolar ATPase may increase endosomal acidity and potentially salinity (Wee et al., 2012) . Third, the insertions of each IFITM's IM domains into the cytosolic-facing leaflet of the membrane may produce a positive curvature in the bilayer as well described for other membrane-associated proteins (Callan-Jones and Bassereau, 2012; Nikolaus and Herrmann, 2012; Voeltz et al., 2006; Yount et al., 2012) . Therefore, by producing a concave and rigid membrane, the IFITM proteins may create a barrier for the viral fusion machinery.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:31457..31708:sentences:a61ba4ccea1dca99602f2b4edb3e0685	IFITM1|IFITM3|IFITM3	IFITM1|IFITM3|IFITM3	Therefore, additional efforts will be needed to determine if the effect of IFITM1 on plasma membrane fluidity is the same as the effect of IFITM3 on endosomal membranes and if AmphoB's antagonism of IFITM3 results from alterations in membrane fluidity.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:31710..31849:sentences:3909c3a398a87286a6278a5a4f2ece7e	IFITM2|IFITM3|IFITM1	IFITM2|IFITM3|IFITM1	In this regard, we are unsure as to why AmphoB specifically overcomes IFITM2 and IFITM3 while leaving IFITM1's actions predominantly extant.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:32165..32280:sentences:2cb77c6c1381c70a937d84702368cccb	VAPA|IFITM3	VAPA|IFITM3	Intrigued by recent reports, we tested the role of VAPA, cholesterol, and oleic acid in IFITM3-mediated restriction.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:32282..32372:sentences:4e46fd6dc1fcc87ee4252f89f94763b7	VAPA|IFITM3	VAPA|IFITM3	Overexpression of VAPA modestly decreased IFITM3-mediated restriction of IAV in our assays.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:33007..33157:sentences:b4f0d8044b13ccaa9e7db8756b47909c	IFITM1|CAV1|IFITM3	IFITM1|CAV1|IFITM3	(A) COS-7 cells were stably transduced with retroviruses expressing the empty vector (Vector), IFITM1, CAV1-teal fluorescence protein (TFP), or IFITM3.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:33743..33938:sentences:4cc772e88b639c5d3e93c42e2c2d659a	CAV1|IFITM1	CAV1|IFITM1	(C) COS7-vector, COS7-CAV1, or COS7-IFITM1 cell fluorescence recovery was quantified using Leica Lite software, with each individual time point representing the average of ten normalized readouts.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:34336..34521:sentences:ad7b8c4f0977bd6a9ec3ca1c7dcc920f	IFITM3|VAPA|IFITM3	IFITM3|VAPA|IFITM3	Modulation of cholesterol levels had no appreciable effect on IFITM3-mediated restriction, suggesting that cholesterol mislocalization does not contribute to VAPA's antagonism of IFITM3.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:34523..34738:sentences:735bbc5de8dc799571bcf404b8493b9c	IFITM3|IFITM3|VAPA	IFITM3|IFITM3|VAPA	Furthermore, cells expressing either of three IFITM3 proteins containing mutations that span IM2, the reported interaction domain of IFITM3 with VAPA, exhibited WT levels of restriction and intracellular cholesterol.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:34740..34870:sentences:7ea98cf0864972142b5894eb41ccd52a	VAPA|IFITM3|VAPA	VAPA|IFITM3|VAPA	These results suggest that a direct interaction between VAPA and IFITM3 does not underlie the subtle effect of VAPA on restriction.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:35100..35236:sentences:b8b62a91ab079d86866a0104cd97ac14	IFITM1|IFITM3	IFITM1|IFITM3	Specifically, we found that oleic acid cannot overcome IFITM1-or IFITM3-mediated restriction of IAV in vitro under the conditions tested.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:35371..35613:sentences:eb6cf8c9a97c6083c140c847575bf4e6	IFITM3|IFITM1	IFITM3|IFITM1	Therefore, while these recent reports have improved our understanding of IFITM3-mediated restriction, we conclude that additional mechanistic studies are required.. Figure 5. IFITM1 Decreases Membrane Fluidity and Inhibits Cell-to-Cell Fusion.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:35999..36729:sentences:a4c7232e045f27948a5f8c6772361355	IFITM3|IFITM3|IFITM3|IFITM3|CD8A|IFITM3	IFITM3|IFITM3|IFITM3|IFITM3|CD8|IFITM3	Individuals with a variant of IFITM3 are more likely to be hospitalized with influenza, suggesting that IFITM3 plays a role in protecting human populations ; indeed, this IFITM3 allele (rs12254-C) was recently reported to convey a large population-attributable risk of 54.25% in the Chinese population (Zhang et al., 2013) . Moreover, IFITM3 is critical for protecting CD8 + resident memory T cell populations during IAV infections in vivo, arguing that AmphoB's antagonism of IFITM3 may impair the adaptive immune system as well (Wakim et al., 2013) . Collectively, these data suggest that patients receiving antifungal therapy with liposomal AmphoB may be functionally immunosuppressed and therefore more vulnerable to influenza.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:38056..38284:sentences:0809877c9c2b210e799e1f4afe102b14	IFITM1|IFITM3	IFITM1|IFITM3	Cell-to-Cell Fusion Assay Vector, IFITM1, or IFITM3 COS-7 cells and PR8 virus were chilled on ice before the addition of virus to cells (White et al., 1981 (White et al., , 1982 . Virus and cells were incubated at 4 C for 40 min.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:39905..40367:sentences:7ecf341e528a2543fc5306104d60074b	CAV1|IFITM1	CAV1|IFITM1	Before imaging, cells were incubated at 37 C for 1 hr with 5 mM of yellow/blue dextran (Life Technologies, 10,000 MW, L-22460) or 5 mM of Asante sodium green (TefLabs) in the presence or absence of 1 mM of (D) The COS7-vector, COS7-CAV1, or COS7-IFITM1 percent immobile fraction was calculated by first subtracting the normalized average of the 95 s postbleach images, then subtracting those values from 1 to determine the amount of membrane that did not recover.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:42531..42796:sentences:fdc72872e49f59f599820d0635a61d69	|FPR2||FPR2	RAB7|RFP|RAB7|RFP	For the ratiometric dextran experiments, we calculated the average ratios of pH-sensitive dextran signal to pH-insensitive dextran signal in the RAB7-RFP compartment normalized to this same ratio as determined for the vector-RAB7-RFP control cells.. Mouse Infection.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:43742..44073:sentences:7e23caad4fb798e13955180f637f3b3a	|FPR2|IFITM3|IFITM3	RAB7|RFP|IFITM3|IFITM3	HeLa-Vector or -IFITM3 cells stably transduced with RAB7-red fluorescence protein (RFP, red) were incubated with a mixture of both yellow (pH-sensitive, green) and blue (pH-insensitive, blue) dye-labeled dextrans with or without pretreatment with AmphoB.. Fig S2 Effect of IFITM3 and AmphoB on endosomal pH and HA acidification (A).
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:45517..45671:sentences:8b76661532c3f31bcc155d02efde1aeb	|FPR2	RAB7|RFP	Human RAB7 was cloned in frame with RFP and expressed from the lentiviral vector pLVX-puromycin (Clontech), which contains a puromycin resistance cassette.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:45673..45837:sentences:055e70195caa9e0450afab0358dffa69	IFITM3|IFITM3|FUZ|IFITM1	IFITM3|IFITM3|NTD|IFITM1	IFITM3 chimeras were constructed as follows: IFITM3's N-terminal domain (NTD, amino acids 1-50) was fused in frame with IFITM1's amino acids 29-245 to generate M3M1.
+SARS:19d4a8102c9c60c132a3c64b4ae0beadd0895559:fulltext:eb29816bfa9a2922293128fc21891431:45839..46128:sentences:346a0ee847dda273e4c1e25a1771c25d	IFITM1|IFITM3|CAV1|FUZ	IFITM1|IFITM3|CAV1|NTD	The NTD of IFITM1, 6 amino acids 1-28, was fused to IFITM3, amino acids 51-119, to produce M1M3 . Human CAV1 was subcloned into the XbaI and BamHI sites of the pLVXpuromycin vector in frame with a C-terminal teal fluorescence protein (TFP), and the coding sequence was confirmed as correct.
+SARS:1d14fd3be698da4aa12b91523c9d099f76775604:abstract:ad59797ce3f9de04d4c5667254686481:986..1158:sentences:73b08c496d061af1d8927bf508188d76	AKT1||MAPK1	Akt|Erk1/2|p38	To determine the involvement of different signaling pathway, protein lysates were prepared and western blots were conducted to assess the activation of Akt, Erk1/2, and p38.
+SARS:1d14fd3be698da4aa12b91523c9d099f76775604:abstract:ad59797ce3f9de04d4c5667254686481:1813..1897:sentences:da7cd4377b14894f9638009a4b132c47	AKT1||MAPK1	Akt|Erk1/2|p38	In addition, astrocytes could augment Akt, Erk1/2, and p38 activation in neutrophils.
+SARS:1d319d99c47121e61e0a0b91a600b29020aafbd4:abstract:de962a739f7a1c8891f226bcee68b28a:377..545:sentences:cc529ad558928d42f41296a3172d529a	CASP3|PARP1	caspase-3|PARP	By measuring caspase-3/7 activation and cleavage of endogenous PARP, two hallmarks of apoptosis, the overexpression of p7 protein was shown to induce apoptosis in Huh7.5
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:966..1345:sentences:bd04982b7134909009bbf49ba9d53e0b	ACE|AGT|AGT	ACE|angiotensin II|Ang II	Recently, a local tissue-based RAS has also been described and appears to play a key role in injury/repair responses [2, 3] . The expression of RAS components and the elevation of angiotensin converting enzyme (ACE) in a number of lung diseases suggest the existence of a pulmonary RAS and that angiotensin II (Ang II) could mediate, at least in part, the response to lung injury.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:1347..1403:sentences:2bd38da715b40763d4d2dafcc7ff6ff5	ACE|AGT	ACE|Ang II	The central role of ACE is to generate Ang II from Ang I.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:1692..2024:sentences:d36c23a90a9d0b90280a6124d8d5ad87	ACE2|ACE|ACE2|ANG||AGT|ANGPT1	ACE2|ACE|ACE2|Ang|Ang1-9|Ang II|Ang1	ACE2, a close homologue of ACE, functions as a negative regulator of the angiotensin system and was identified as a key receptor for severe acute respiratory syndrome coronavirus infections [5, 6] . ACE2 reduces the generation of Ang II by catalysing the conversion of Ang I to Ang1-9 and facilitating hydrolysis of Ang II to Ang1-7.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:2026..2285:sentences:1100285a5ff0a1d46fae49ade9d8e083	ANGPT1|ACE|ANG|ANG	Ang1|ACE|Ang|Ang	Ang1-7 has been recognised as a potential endogenous inhibitor of the classical RAS cascade [7] . Hence, the ACE2Ang1-7 axis may be an important negative modulator of Ang II bioactivity, counteracting the effects of ACE in determining net tissue Ang II levels.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:2287..2682:sentences:7cb8893376f24f6dac39b7e1b9d12a07	ACE|ACE2||MMP2|MMP9|	ACE|ACE2|MMPs|MMP-2|MMP-9|MMPs	Abnormally elevated ACE combined with decreased ACE2 expression may be involved in fibrotic processes in vitro and in vivo, and the mechanism may involve expression and activation of specific MMPs [8] . Recently, abnormal pleural MMP levels, e.g., MMP-2 and MMP-9, have been reported, and the association between MMPs and development of pleurisy has been investigated [9, 10, 11] .. Introduction.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:2684..2834:sentences:8c1edcfe1fe596552597311cfd1815c4	ACE|ACE2|MMP2|MMP9	ACE|ACE2|MMP-2|MMP-9	Here we evaluated the association of two key enzymes in RAS, ACE and ACE2, with MMP-2 and MMP-9 in the pleural fluid of patients with pleural effusion.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:2836..3000:sentences:c516e42a2bbd747c33738aa5e52ece11	ACE|ACE2|MMP9	ACE|ACE2|MMP-9	We also detail discussed whether abnormal RAS, accompanied with high levels of ACE/ACE2, might be a cause of elevated MMP-9 activity in tuberculous pleural effusion.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:3002..3191:sentences:47e9499f8aaa1bd28d749f63a3e23b6a	ACE|ACE2|MMP9	ACE|ACE2|MMP-9	Finally, a high ratio of ACE to ACE2 combined with elevated MMP-9 detected in pleural fluid may be a potential indicator for the diagnosis of tuberculous pleurisy.. Pleural effusion samples.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:4647..4782:sentences:ba0416da9aaf24f26e3f228162039c7d	ACE|ACE2|MMP2|MMP9	ACE|ACE2|MMP-2|MMP-9	In addition, the activities of ACE, ACE2, and gelatinases (MMP-2 and MMP-9) in the pleural effusions were measured.. Gelatin zymography.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:4784..5054:sentences:82e77d7748d772a8da8698ffbfc6c37d	MMP2|MMP9	MMP-2|MMP-9	Gelatin zymography for detecting MMP-2 and MMP-9 activity was performed with gelatin-containing gels as our previous report [4] . Briefly, 10 l pleural fluid for each subject was loaded to a 10% SDS-PAGE containing 0.1 mgml -1 gelatin (Sigma-Aldrich, St. Louis, MO, USA).
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:5292..5553:sentences:29a8979b06c3eacb2d17bebce452a767	ACE|ACE2	ACE|ACE2	Enzyme activity was expressed as ngml -1 . [13] . The assay was performed in a micro-quartz cuvette with 20 l pleural fluid, 50 M fluorogenic substrate and protease inhibitor cocktail (1:200; Sigma-Aldrich) in a final volume of 100 l in ACE or ACE2 assay buffer.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:5708..6115:sentences:5dcde97f3dec7f69dc3fa390d7888d94	ACE|ACE2|ACE2|ACE	ACE|ACE2|ACE2|ACE	Data were fitted and plotted using Grafit v.4.0 (Sigma-Aldrich), and enzyme activity was expressed as RFUh -1 ml -1 . Parallel samples were incubated with the above-mentioned reaction mixture in the presence of 1 M captopril (Sigma-Aldrich), a specific ACE inhibitor for determining specific ACE activity, or 1 M DX600 (AnaSpec), a specific ACE2 inhibitor for determining specific ACE2 activity.. Statistics.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:6553..6997:sentences:82d49d7a7ce493b3f3cfe8a55112c988	ACE|ACE2	ACE|ACE2	The pleural fluid characteristics of 125 patients included in the study are presented in Table 1 . Generally, total protein, LDH, and the number of WBC in exudative effusions (n = 80) were significantly higher than those in transudative effusions (n = 45) (p < 0.001), whereas a lower glucose level was detected in the pleural fluid of exudates compared with that in transudates (p < 0.001).. ACE and ACE2 activities in transudates and exudates.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:6999..7079:sentences:5f5caa15fab4bc7ec9bb782635a6101b	ACE|ACE2	ACE|ACE2	ACE and ACE2 activities in the pleural effusions of all patients were determined.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:7388..7458:sentences:7dd50e06b631f18f0882c993c9e7f375	ACE|ACE2	ACE|ACE2	RFUh -1 ml -1 vs.. ACE and ACE2 activities in transudates and exudates.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:7563..7714:sentences:edd8f5625a98d80f03eac82e9f785dc7	ACE|ACE2	ACE|ACE2	The ratio of ACE/ACE2 activity in the pleural effusions was significantly higher in exudative effusions than in transudative effusions (0.49 (0.27-0.91)
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:7765..8084:sentences:118e6e9639a51e3dd30ec1174864f4e7	ACE|ACE2|ACE|ACE2|MMP2|MMP9	ACE|ACE2|ACE|ACE2|MMP-2|MMP-9	In transudates, a significant positive correlation was found between ACE and ACE2 activities (r 2 = 0.456, p < 0.001) (Figure 2A) . However, the ACE activity was not correlated with the ACE2 activity in exudative effusions (r 2 = 0.020, p = 0.214) ( Figure 2B ). . MMP-2 and MMP-9 activities in transudates and exudates.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:8086..8209:sentences:4d954d563f664f8b09c3284e3764fedd	MMP2|MMP9	MMP-2|MMP-9	The MMP-2 and MMP-9 activities in the pleural effusions of all patients were determined with gelatin zymography (Figure 3 ).
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:8957..9032:sentences:3280959f994224b53c86876c4b81da4d	ACE|ACE2	ACE|ACE2	. ACE and ACE2 activities in exudates from patients with different diseases.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:9034..9123:sentences:15a186ef90549841a2657b77552806d7	ACE|ACE|ACE2	ACE|ACE|ACE2	Elevated ACE activity and an elevated ACE/ACE2 ratio were observed in exudative effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:9125..9279:sentences:c5dd2b43980733b6bb2aab40b8a8e9cf	ACE|ACE2	ACE|ACE2	We then differentiated both ACE and ACE2 activities in the exudates according to different diseases, including tuberculosis, pneumonia, and adenocarcinoma.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:9685..9837:sentences:1cadbc5606974d70a5bf0e9c94287850	ACE|ACE2|ACE|ACE2	ACE|ACE2|ACE|ACE2	According to the changes we detected in ACE and ACE2, a significantly higher difference in the ACE/ACE2 ratio in tuberculous effusions (1.72 (1.09-2.52))
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:9930..10059:sentences:cef01a7dd654f6679fbaf4f22a855676	ACE|ACE2	ACE|ACE2	effusions was also observed (p < 0.001) ( Figure 4C ).. ACE and ACE2 activities in exudates from patients with different diseases.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:10061..10173:sentences:c96fc5bd9ca706c6cc343e9241505dc7	ACE|ACE2	ACE|ACE2	The pleural ACE and ACE2 activities among transudates, tuberculosis, pneumonia and adenocar-cinoma were compared.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:10175..10418:sentences:ce23cf25c3ce6db6e14154cc772a0647	ACE|ACE2	ACE|ACE2	The ACE and ACE2 activities in transudates, tuberculous, pneumonia and adenocarcinoma effusions were 0.67  0.52, 2.16  0.97, 0.74  0.77 and 0.82  0.43 RFU/hour/ml, and 2.19  1.31, 1.38  0.58, 2.05  1.40 and 2.38  1.86 RFU/hour/ml, respectively.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:10420..10646:sentences:c996cd042f9fd5c43bb80dec5a3f3a7b	ACE|ACE2|MMP2|MMP9	ACE|ACE2|MMP-2|MMP-9	It is noted that both of ACE and ACE2 activities in pneumonia and adenocarcinoma effusions were similar to the activities in transudative effusions.. MMP-2 and MMP-9 activities in exudates from patients with different diseases.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:10648..10790:sentences:e06c22e59c409b74e475838eaf6bc68b	MMP2|MMP9	MMP-2|MMP-9	The MMP-2 and MMP-9 activities in exudative effusions from the patients with different diseases were assayed by gelatin zymography (Figure 5 ).
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:10984..11214:sentences:f35c9225f5a196fc392c66a6c600e1a3	MMP2|MMP9|MMP9	MMP-2|MMP-9|MMP-9	Similar to MMP-2, MMP-9 activity in tuberculous effusions was significantly higher than MMP-9 activity in pneumonia and adenocarcinoma effusions by 1.62 (p < 0.01) and 1.77 fold (p < 0.01), respectively ( Figure 5B ). . Discussion.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:11216..11390:sentences:3999eaee85557218cf6125fb7d6a66a0	ACE|ACE2|MMP2|MMP9	ACE|ACE2|MMP-2|MMP-9	In the present study, major components of RAS and extracellular matrix (ECM) metabolism, pleural ACE, ACE2, MMP-2, and MMP-9, were measured in patients with pleural effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:11392..11658:sentences:7554fd3ff0a3f2e1728b859bcaefce79	ACE|MMP9|ACE|ACE2|MMP9|ACE|ACE2	ACE|MMP-9|ACE|ACE2|MMP-9|ACE|ACE2	Our main findings are: (1) significantly higher the ACE, MMP-9 activity and ACE/ACE2 ratio in exudative effusions; (2) increased MMP-9 and ACE activities combined with decreased ACE2 activity in tuberculous effusion compared to pneumonia and adenocarcinoma effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:11660..11890:sentences:e4b921fcbe5c4d4aef4f0c7b13013668	MMP9|ACE|ACE2	MMP-9|ACE|ACE2	The increased MMP-9 activity found in tuberculous effusion is in agreement with previous reports [9, 14, 15] . Herein, we first report that the changes of ACE and ACE2 activity are associated with tuberculous pleurisy.. Discussion.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:12560..12632:sentences:fb0a293423143f0f347f28f5bced3933	ACE2|ACE	ACE2|ACE	Some of the physiological functions of ACE2 are opposite to those of ACE.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:12634..12788:sentences:4976cda2a512b0940a15b84e10e746c2	ACE|ACE2|ACE|ACE2	ACE|ACE2|ACE|ACE2	The significant positive correlation between ACE and ACE2 activities in the transudates suggests that ACE and ACE2 maintain a normal physiological balance.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:13070..13282:sentences:bbd453096c4aa2b0cd7900c05d8bebee	ACE|ACE2|ACE|ACE2	ACE|ACE2|ACE|ACE2	ACE activity was increased (p < 0.001) and ACE2 was decreased (p < 0.05) in tuberculosis specifically, but the ACE and ACE2 activities were no difference between transudate, pneumonia and adenocarcinoma effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:13284..13603:sentences:453bab3c4288c0a3adc194fe0f6c77d8	ACE|ACE2|ACE|ACE|ACE2|ACE|ACE2	ACE|ACE2|ACE|ACE|ACE2|ACE|ACE2	These results indicated that ACE and ACE2 maybe a biomarker for tuberculosis diagnosis in pleural effusion and it could be emphasized that the increased ACE activity and ratio of ACE/ACE2 in the exudates are mainly contributed from a higher ACE level and lower ACE2 enzyme activities in the tuberculous pleural effusion.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:14863..15007:sentences:7b9782dc4a406f5525f82e679f4ce080	ACE|ACE2	ACE|ACE2	It is interesting that significantly increased ACE activity combined with markedly decreased ACE2 activity was measured in tuberculous effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:15117..15809:sentences:0869593166f8458283c8d5051fd473d4	ACE2|MMP9|ACE2|MMP9|ANG|MMP9|MAPK8|MAPK14|ACE|MMP9|ACE2|ANGPT1|MMP9|ANG	ACE2|MMP-9|ACE2|MMP-9|Ang|MMP-9|JNK|p38|ACE|MMP-9|ACE2|Ang 1|MMP-9|Ang	It was reported that overexpression of ACE2 may inhibit MMP-9 activity [19] , and ACE2 deficiency leads to increased MMP-9 levels [20] . In inflammatory signalling pathways study, Ang II could stimulate human monocytic U-937 cells to increase MMP-9 expression and activity significantly via activated NF-B, JNK, and p38 [21] . The ACE inhibitor, captopril, was administrated to isoprenaline-induced left ventricular fibrosis rats and showed that captopril significantly enhanced the isoprenaline-induced myocardial fibrosis and augmented the isoprenaline-induced MMP-9 expression [22] . In addition, ACE2 and Ang 1-7, the regulators in RAS opposed Ang II effect, could affect MMP-9 expression.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:15811..16239:sentences:1baba0664f18d013008d97dbd459c76f	ACE2|MMP2|MMP9|AKT1|MAPK14|MAPK8|MMP2|MMP9|ACE2|MMP9|ANG	ACE2|MMP-2|MMP-9|Akt|P38|JNK|MMP-2|MMP-9|ACE2|MMP-9|Ang	Overexpression of ACE2 reduces the invasive ability in vitro according to the down-regulation of MMP-2 and MMP-9 [23] . Ang 1-7 revealed the anti-migration and anti-invasion effect mediated through inactivation of the PI3K/Akt, P38 and JNK signal pathways to reduce the expression and activity of MMP-2 and MMP-9 [24] . According to our results, we conclude that reduction in ACE2 along with induction of MMP-9 activity occurred.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:16241..16366:sentences:65309adc5bf7ce6b22b70ba2b0bc84b9	ACE2|MMP9	ACE2|MMP-9	Our observations of decreased ACE2 and increased MMP-9 activity in tuberculous effusions confirm this conclusion.. Discussion.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:16368..17533:sentences:2b07a814e81e4c7ffe248e8732838834	ACE2|ANGPT1|||||	ACE2|Ang1|MMPs|MMPs|MMPs|MMPs|MMPs	A number of studies have indicated that the ACE-Ang II axis and ACE2-Ang1-7 axis not only regulate the metabolism of ECM proteins, but also modulate MMP expression and activity levels [8] . MMPs have been implicated in the pathogenesis of various lung diseases, including pleural effusions [25, 26] . The activity of MMPs within the pleural space may play a role in the formation of pleural effusions by altering the integrity of the mesothelial and endothelial cell layers and by increasing vascular permeability [10, 27] . Proteolysis by MMPs may be involved in the formation of pleural effusions by increasing vascular permeability, and thus by facilitating fluid influx into the pleural space [28] . Therefore, the presence and enzymatic activities of MMPs have been identified in pleural effusions [15, 25, 29] . Previous studies have shown that the expression of MMPs in the pleural space is altered in a variety of inflammatory and malignant diseases, suggesting that certain members of the MMP family may participate in the formation of pleural effusions [10, 15, 29] . Tissue damage is a characteristic manifestation of Mycobacterium tuberculosis infection.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:17792..18302:sentences:5a126fb2007316ce324dbad288c5979d	MMP9||MMP9	MMP-9|MMPs|MMP-9	Several studies have reported that macrophages and monocytes release MMP-9 in response to tuberculosis or its cellular components [30, 31] . Studies have evaluated MMPs in tuberculous pleural effusions and found that the MMP activity in pleural fluid are higher in patients with tuberculosis compared with patients with transudative effusions [10, 32] . Our results are in agreement with the above findings, as the MMP-9 activity was highest in tuberculous effusions among the exudates we examined.. Discussion.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:18304..18392:sentences:948e021f7d912d1ceff43afb37c5b003	ACE|ACE2	ACE|ACE2	The present study is the first report about the ACE/ACE2 ratio in tuberculosis diagnosis.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:18394..18487:sentences:a8491eeb9e43a0c0071dde81af0d57fd	ACE|MMP9	ACE|MMP-9	Although increased ACE and MMP-9 could be specifically determined in the tuberculous effusion.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:18489..18887:sentences:97390b31dd3b7dd941db98561b78a8f7	ACE|MMP9|ACE|MMP9|ACE2|ANG|ACE|AGT	ACE|MMP-9|ACE|MMP-9|ACE2|Ang|ACE|Ang II	There are still few concerns should be addressed using ACE and MMP-9 as biomarker for tuberculosis diagnosis, because (1) elevated ACE levels may also be seen in several other cardiovascular disorders, and (2) MMP-9 is an inflammation-induced target in several cases [33] . In the RAS, ACE2/Ang-(1-7) axis has been recently highlighted as the counter balancing arm of the RAS to the ACE/Ang II axis.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:18889..19126:sentences:14129c9192b9ce741e04ae7b22cefaba	ACE|ACE2|ACE2	ACE|ACE2|ACE2	The regulatory mechanisms focused on the alternating ACE and ACE2 regulation are still lack; therefore, the mechanism of reduced ACE2 found in the pleural effusion of patients with tuberculosis remains to be further explored.. Conclusion.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:19128..19309:sentences:45f64402594584abbcf14744fce1dc7e	ACE|ACE2	ACE|ACE2	Our data suggest that the interplay between ACE and ACE2, an essential function in RAS, and the change in gelatinase activity may be involved in the development of pleural effusions.
+SARS:1b58422e266ab9339c919119923229d080f27360:fulltext:4a3ee8ec0b85034580d65b6fd3d4233c:19311..19494:sentences:294eebc124480b51a115b021c632fb28	ACE|MMP9|ACE2	ACE|MMP-9|ACE2	Our findings suggest that increased ACE and MMP-9 activities and decreased ACE2 activity in pleural fluid are features of pleural space infection in patients with pleural tuberculosis.
+SARS:1cf4faa405e1bd03ac04596491a0261cfdd68449:fulltext:ac1e90d83c3e6a41b85f669f50e5ae0a:11005..11071:sentences:0e9fd34b2de9d78c806cc0d8968cef05	GTPBP1|GP2	GP1|GP2	The GP spike is composed of disulfide linked subunits, GP1 and GP2.
+SARS:1cf4faa405e1bd03ac04596491a0261cfdd68449:fulltext:ac1e90d83c3e6a41b85f669f50e5ae0a:14223..14692:sentences:f27bafd49b88cb59f9940b05c78a4289	GTPBP1|GP2	GP1|GP2	Once in the endosome, proteolytic processing is initiated by cathepsin proteases, after which GP1 binds to receptors on endosomal membranes, predominantly the Niemann-Pick C1 protein [34] . Cleavage of the mucin-like domain and the glycan cap on G1 are required for receptor binding to occur [23] . At low pH, conformational rearrangement of GP2 exposes a hydrophobic fusion loop which is inserted into the endosome membrane followed by internalization of the viral RNA.
+SARS:1cf4faa405e1bd03ac04596491a0261cfdd68449:fulltext:ac1e90d83c3e6a41b85f669f50e5ae0a:14694..14947:sentences:23d85c57eb4872ba65dc199ada64d680	GTPBP1|GTPBP1|GP2	GP1|GP1|GP2	Neutralization of Ebola virus by antibody involves multiple different mechanisms, including blocking cathepsin-mediated proteolytic cleavage of GP1, blocking binding of GP1 to Niemann Pick C1 receptors, and inhibition of GP2 mediated fusion [35, 36] . n.
+SARS:1cf4faa405e1bd03ac04596491a0261cfdd68449:fulltext:ac1e90d83c3e6a41b85f669f50e5ae0a:19149..19269:sentences:23f6661845f04c9da53c43c21ad84fb3	CXCL10|CXCR6	IP-10|CXCR6	Predominant among the independent markers were IP-10 and CXCR6 expression on NK cells on day 1 as independent correlates.
+SARS:1cf4faa405e1bd03ac04596491a0261cfdd68449:fulltext:ac1e90d83c3e6a41b85f669f50e5ae0a:51576..51780:sentences:e467aefd5ca965da05858de890fde9c4	CCL2|CCL2|CCL4|CCL4|IL6|TNF|IL1RN|IL10	MCP-1|CCL2|MIP1-b|CCL4|IL-6|TNF-a|IL-1Ra|IL-10	The majority are mild to moderate in intensity This syndrome is associated with viremia and a signature of monocyte-activation cytokines/chemokines (MCP-1/CCL2, MIP1-b/CCL4, IL-6, TNF-a, IL-1Ra and IL-10).
+SARS:1d3a67e49bdb16a0319860af08bed80c6e800c5e:abstract:a4e014892c60896f43b83ac9d740e87e:554..715:sentences:4616b1017e92f9c87bfc6b1eb8d4e505	ACE|AGT	ACE|angiotensin I	In particular, it has been found that the catalytic mechanisms of the two active sites of somatic ACE in the cleavage of angiotensin I and bradykin are different.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:7313..7589:sentences:fcf01213a17a4d0142b90808e2a2eac3	NACC1|INS|INS	NaC1|proinsulin|insulin	Although all experiments shown included 0.4 M NaC1 to minimize the sedimentation of high molecular weight protein complexes unrelated to hormones, preliminary studies (not shown) indicated the use of 0.4 M NaCI did not alter the relative sedimentation of proinsulin or insulin.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:21871..22246:sentences:ce29b70f432788e4521e729d04931f3b	CTSB|CTSB|INS	cathepsin B|cathepsin B|insulin	As expected, when pulse-labeled pancreatic islets were chased overnight to allow labeled proteins to reach their final destinations, there was quantitative intracellular processing of cathepsin B from precursor to mature lysosomal form; secretagogue addition at this time induced a stimulated discharge of labeled insulin without detectable release of mature cathepsin B (Fig.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:23096..23601:sentences:988bb0b5b8fb44555981e176bae4b568	INS|INS|CTSB	proinsulin|insulin|cathepsin B	The absolute magnitude of the stimulus-dependent secretion (i.e., stimulated minus control) of procathepsin B varied between experiments, resulting in a large standard deviation (Table I) . Nevertheless, between different pairs as well as by overall averaging, the stimulus-dependent fraction of labeled procathepsin B tended to parallel the regulated exocytosis of proinsulin/ insulin (Table I) . This regulated secretory behavior suggested that the secretion of cathepsin B precursor originated from IGs.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:24458..24888:sentences:d8130b4a76bd721e907717d5d8319061	INS|CTSB|INS|CTSB|INS|INS	proinsulin|cathepsin B|proinsulin|cathepsin B|insulin|insulin	The chase media and islet lysates were then analyzed by immunoprecipitation for both proinsulin plus insulin, and cathepsin B. Prolonged secretory collection helped to minimize effects of differences in ER exit rates for proinsulin and cathepsin B. In the experiment shown, the stimulus-dependent release of labeled (pro)insulin present in islets at each chase time averaged 17.3 %, which was not inhibited as the chase progressed.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:24890..25094:sentences:bdf2d304c268154763b1d6b56cf6feac	CTSB|INS	cathepsin B|proinsulin	By contrast, the stimulus-dependent fraction of cathepsin B precursor, which was 73 % of the stimulus-dependent fraction of proinsulin secreted from 20-80 min, declined rapidly as a function of chase time.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:25857..26110:sentences:490dc0475a366698f7e59ef233ba3ac7	CTSB|CTSB|INS	cathepsin B|cathepsin B|insulin	The media and cell lysates were each analyzed by immunoprecipitation using an anti-insulin serum as well as an antiserum to cathepsin B. The fraction (%) of labeled cathepsin B secreted into the medium corresponded exclusively to the precursor form (Fig.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:26606..26929:sentences:8dc43c367ead5d72b751ce4dc8240464	CTSB|CTSD|CTSL	cathepsin B|cathepsin D|cathepsin L	To determine whether this behavior of cathepsin B, a moderately abundant B-cell hydrolase, is a special case or is generally representative of lysosomal enzyme trafficking, the stimulus-dependent secretion was also measured for newly made cathepsin D and cathepsin L, whose expression levels range '~100-fold in these cells.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:27136..27432:sentences:e57ed84be7812aadc4300efa954a25eb	INS|INS|CTSD|CTSL	proinsulin|insulin|cathepsin D|cathepsin L	7) . When normalized to the release of labeled proinsulin and insulin, an extremely high fraction of these newly synthesized hydrolases were found to enter the stimulus-dependent pathway: 87% for cathepsin D; >95% for cathepsin L; and a comparably high value for /~-glucuronidase (data not shown).
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:27777..28082:sentences:95d67e89a39e51539d6049d8fbcf0452	CTSD|CTSL	cathepsin D|cathepsin L	The observation that different lysosomal enzymes at all levels of expression appear to enter IGs, represents a pattern other than that found in nonregulated secretory cells, where Figure 7 . Entry of newly synthesized cathepsin D and cathepsin L into the regulated secretory pathway of pancreatic /3-cells.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:28185..28315:sentences:562bf6aa286aca9533a0185dd6539408	CTSD|CTSL	Cathepsin D|cathepsin L	6 . Cathepsin D (~54 kD) and cathepsin L (,,o40 kD) were specifically immunoprecipitated and analyzed by SDS-PAGE and fluorography.
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:32462..32577:sentences:97f3a409a306d6e53fdf62adc2f9d8e2	CTSL|INS	cathepsin L|proinsulin	kD) cathepsin L actually exceeded the stimulus-dependent fraction of labeled proinsulin, which ranged from 18.4-21.3
+SARS:17c30925f6e62319c5049126e8fddbc1410e9983:fulltext:bb8cbf9406a5b2e173fd73a7ef95de33:36271..36899:sentences:7ad827cc24e0b4756a6ab1ac60b04c50	INS|CTSB|INS	proinsulin|cathepsin B|proinsulin	These data are entirely consistent with earlier biophysical studies indicating that randomly coiled C-peptides interfere with close-packing of soluble proinsulin hexamers (Steiner, 1973; Weiss et al., 1990) , thereby rendering proinsulin incapable of forming large, insoluble complexes in an aqueous environment above pH 3 (Fullerton et al., 1970; Grant et al., 1972) . While we do not preclude the possibility that some proteins in some cell types might undergo complex Figure 9 . Nonglycosylated cathepsin B is converted from a lysosomal enzyme to a permanent resident of the regulated secretory pathway in pancreatic /3-cells.
+SARS:1d75590848a42f84359d8ff9631fdc3145efd631:abstract:96947943b1b486df12008f502b23873b:387..575:sentences:5c1320bef5342f2a506ed4d925042584	EIF4G1|EIF4A2|EIF4E|EIF4G1	eIF4F|eIF4A|eIF4E|eIF4G	We have demonstrated that loss-of-function of the three components of eIF4F, including eIF4A, eIF4E and eIF4G, remarkably promotes the levels of rotavirus genomic RNA and viral protein VP4.
+SARS:1d75590848a42f84359d8ff9631fdc3145efd631:abstract:96947943b1b486df12008f502b23873b:577..737:sentences:41a1d039ee9bd4f76b54e5d6318fff95	EIF4G1|PDCD4	eIF4F|PDCD4	Consistently, knockdown of the negative regulator of eIF4F and programmed cell death protein 4 (PDCD4) inhibits the expression of viral mRNA and the VP4 protein.
+SARS:1d75590848a42f84359d8ff9631fdc3145efd631:abstract:96947943b1b486df12008f502b23873b:739..913:sentences:3ae56a1e50ddc1b91975706b29400239	EIF4G1|IRF1|IRF7	eIF4F|IRF1|IRF7	Mechanically, we confirmed that the silence of the eIF4F complex suppressed the protein level of IRF1 and IRF7 that exert potent antiviral effects against rotavirus infection.
+SARS:1da4278cead869b78e5bf6205013a8407944f1f6:fulltext:217525bad09b259d2f5358d72bda7bbc:16799..16940:sentences:ce1234d063bdb5e6d349708ce3f70586	ABCC2|ABCC3|ABCB11	MRP2|MRP3|BSEP	To assess the inhibition of the MRP2, MRP3 and BSEP efflux transporters, an in vitro vesicular transporter assay from Solvo Biotechnology Inc.
+SARS:1da4278cead869b78e5bf6205013a8407944f1f6:fulltext:217525bad09b259d2f5358d72bda7bbc:17252..17356:sentences:d989dc1f9cefe74d55cf664e4993a277	ABCC2|ABCC3	MRP2|MRP3	In the case of MRP2 and MRP3 transporters reactions were carried out in the presence of 2 mM glutathione.
+SARS:1da4278cead869b78e5bf6205013a8407944f1f6:fulltext:217525bad09b259d2f5358d72bda7bbc:18154..18272:sentences:7b918945e8dc77a5010ae0219bdd8bd6	PGP|ABCB1	Pgp|MDR1	To assess the inhibition of the P-glycoprotein (Pgp/MDR1) transporter, an in vitro ATPase assay from Cyprotex was used.
+SARS:1db4560940a913194230a37755d10fa154b09d15:abstract:3bd3f53ce070b1ed14277ac27721a705:640..779:sentences:11fbdf3a2eb88dd4592ef1c5c625d090	DDX58|RNF135	RIG-I|RNF135	Chickens (but not ducks) lack the intracellular receptor for viral ssRNA, RIG-I and the gene for an important RIG-I binding protein, RNF135.
+SARS:1db4560940a913194230a37755d10fa154b09d15:abstract:3bd3f53ce070b1ed14277ac27721a705:1243..1406:sentences:19474eb96826c329ebb679fd5d0e5217	|IFITM3	IFITM1 and 2|IFITM3	Clustering of gene expression profiles suggests IFITM1 and 2 have an anti-viral response and IFITM3 may restrict avian influenza virus through cell membrane fusion.
+SARS:1db4560940a913194230a37755d10fa154b09d15:abstract:3bd3f53ce070b1ed14277ac27721a705:1408..1584:sentences:6b88b3395f2c316a80d5bca419b980be	IFITM1|IFITM3	IFITM1|IFITM3	We also show, through molecular phylogenetic analyses, that avian IFITM1 and IFITM3 genes have been subject to both episodic and pervasive positive selection at specific codons.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:600..789:sentences:c40ee9f4047d2345ff4f78cdc4a35f5f	IFNA1|IFNB1|IFNE|IFNK|IFNAR1|IFNAR2	IFN-a|IFN-b|IFN-e|IFN-k, and IFN-o|IFNAR1|IFNAR2	Type-I IFNs include a panel of IFN-a subtypes, IFN-b, IFN-e, IFN-k, and IFN-o, all of which signal through a ubiquitous IFNAR receptor complex, consisting of the IFNAR1 and IFNAR2 receptors.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:791..920:sentences:811ee83fb991b38d0053abfbde32d4ca	IFNG|IFNGR1|IFNGR1|IFNGR2|IFNA1	IFN-g|IFNGR|IFNGR1|IFNGR2|IFN	IFN-g, the only known type-II IFN, signals through its own receptor complex, IFNGR, consisting of the IFNGR1 and IFNGR2 receptors.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:922..1140:sentences:38ae06ef78654dea8917bc44318aceb2	IFNLR1|IL10RB|IL10	IFNLR1|IL10R2|IL-10	Type-III IFNs (IFN-l1-4) signal through the IFNLR receptor complex, which consists of the IFNLR1 receptor specific to type-III IFNs, and the IL10R2 receptor shared by all type-III IFNs and the IL-10 family of cytokines.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:1493..1827:sentences:6d24bf3395f60b06650cb416fac9a34f	IFNL4|IFNA1	IFN-l4|IFN	A recently discovered type-III IFN, IFN-l4 (Prokunina-Olsson and others 2013) reviewed in (O'Brien and others 2014), can be created only in the presence of the DG allele of a dinucleotide genetic variant rs368234815-TT/DG; this variant is polymorphic in humans, but only the ancestral DG allele seems to be present in nonhuman species.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:4381..4563:sentences:e2939cd04c7da1706e98f64fe2d59b8e	IFNL4|IFNA1	IFN-l4|IFN	Although the function of human IFN-l4 is not completely understood, its ability to induce IFN signaling and antiviral response against several pathogens has been clearly demonstrated.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:4851..5010:sentences:177a4ec625835b5b886990326a275ada	IFNL4|IFNA1	IFN-l4|IFN	Studies of IFN-l4 across species should help improve our understanding of the biology of this clinically important IFN in normal and disease conditions.. Cells.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:11627..11824:sentences:3aaffb82485e8575d12cad0070eda7cd	IFNL4|IFNL3|IFNA1	IFN-l4|IFN-l3|IFN	IFN-l4 is a novel type-III IFN with moderate similarity to other type-III IFNs; it has 29% amino acid identity with IFN-l3, the most related member of this family (Prokunina-Olsson and others 2013).
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:12874..13154:sentences:98b8afc0caf070de075a21ecc1ee8e3f	IFNL4|IFNL4|	IFN-l4|IFN-l4|IFN-l2 and IFN-l3	Complete ORFs encoding IFN-l4 proteins were found in several mammalian species, but not in nonmammals (Key and others 2014) . The regions corresponding to IFN-l4 could not be found in the mouse and rat genomes, although orthologs for IFN-l2 and IFN-l3 are present in these species.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:13530..13735:sentences:b63ef7067a2de3216986b234a13e2e2b	IFNL4|IFNLR1|IL10RB|IFNA1	IFN-l4|IFNLR1|IL10R2|IFN	We recognize that a human cell line may not be optimal for all IFN-l4 orthologs because the human receptors (IFNLR1 and IL10R2) and other signaling components may not work efficiently with nonhuman IFN-l4s.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:14526..14804:sentences:9a7f872b25d44749389bda3e97edd1dd	IFNL4|IFNL3|IFNL4|IFNL4	IFN-l4|IFN-l3|IFN-l4|IFN-l4	(Table 1) . However, a swap of leader peptides between the poorly secreted IFN-l4 and highly secreted IFN-l3 did not affect the secretion of IFN-l4 (Hamming and others 2013), suggesting that the predicted strength of the leader peptide might not be relevant for IFN-l4 secretion.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:15160..15307:sentences:6b6a458d6eb1810af13039aca899bd76	IFNL4|IFNA1	IFN-l4|IFN	Despite being only poorly secreted, human IFN-l4 can efficiently activate IFN signaling (Prokunina-Olsson and others 2013; Onabajo and others 2015).
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:16425..16674:sentences:e60e94eb7e02b925cc2cb7d4647b5383	IFNL4|IFNA1	IFN-l4|IFN	Because all of the IFN-l4 orthologs are predicted to have leader peptides and showed biological activity for induction of IFN signaling, which is typical for exogenously acting IFNs, it is likely that at least a portion of these proteins is secreted.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:17442..17746:sentences:dae49bbf00014c84d4109ce8a5ea88e0	IFNL4|R3HCC1L	IFN-l4|PSORT	PSORT analysis (Nakai and Horton 1999) identified nuclear localization signals within IFN-l4, and some of the orthologs were predicted to be nuclear proteins (Supplementary Table S2 ); however, there was no correlation between these predictions and intracellular localization observed by confocal imaging.
+SARS:176fa00106dc0e7b0ef19c0b606aa80cd14e4057:fulltext:69dd6ea0777936128eebf6f05a4cfbfe:17868..18234:sentences:86a006d625890680b7c54e5d57c25b53	IFNG|IRF3|IFNL4	IFN-g|IRF3|IFN-l4	Cytoplasmicnuclear shuttling has been reported for some factors involved in immune response ( Jans and Hassan 1998) , including IFN-g (Subramaniam and others 1999) and IRF3 (Kumar and others 2000) , and the possible functional effects associated with nuclear translocation of IFN-l4 should be further explored in relevant experimental models.. Results and Discussion.
+SARS:1bfeba839c9c98eb6e49ceb13cfcdba28620a61d:fulltext:24c330bd7a060370126c0d6f916387ed:37078..37357:sentences:cd980f921c92a8fda882d79ded584ae2	GIN1|ACTB|GML	Gin1|Actin|Gml	9 B) . This suggested that removing part of the cytoplasmic tail of Gml does not disrupt the oligomer, and further supports the possibility that digestion of SDS-resistant material gives rise to the larger band.. The Cytoplasmic Tails of Oligomerized Gin1 May Interact with Actin.
+SARS:1bfeba839c9c98eb6e49ceb13cfcdba28620a61d:fulltext:24c330bd7a060370126c0d6f916387ed:37359..37514:sentences:e2973686435ecd56e833b08b7603852c	GML|ACTB	Gml|actin	We tested the possibility of cytoskeletal involvement in SDS resistance of Gml by pretreating cells with drugs that disrupt microtubules or actin filaments.
+SARS:1bfeba839c9c98eb6e49ceb13cfcdba28620a61d:fulltext:24c330bd7a060370126c0d6f916387ed:38329..38623:sentences:4f01114cce2d023c51952d4bc015f41e	GIN1|ACTB|GML|ACTB	Gin1|Actin|Gml|actin	This observation suggests that oligomer formation and SDS-resistance are separable characteristics, and furthermore implies that SDS-resistance may result from interaction between Gml and an actin-based matrix or cytoskeleton.. The Cytoplasmic Tails of Oligomerized Gin1 May Interact with Actin.
+SARS:1bfeba839c9c98eb6e49ceb13cfcdba28620a61d:fulltext:24c330bd7a060370126c0d6f916387ed:39671..39889:sentences:c0407635832b0ff53bfe8868704986a8	GML|ACTB	Gml|actin	8 A. We therefore conclude that the larger Gml species does indeed represent material digested from SDSresistant oligomers, and furthermore, that the oligomers may interact with an actin-based cytoskeleton.. Discussion.
+SARS:1bfeba839c9c98eb6e49ceb13cfcdba28620a61d:fulltext:24c330bd7a060370126c0d6f916387ed:41549..41783:sentences:ad590160d9177f9f63c247b372d6ebb7	GML|ACTB	Gml|actin	Interestingly, cell treatment with cytochalasin D blocked the formation of SDS-resistant oligomers, suggesting that the acquisition of SDS resistance may reflect association of the Gml cytoplasmic tail with an actin-based cytoskeleton.
+SARS:1bfeba839c9c98eb6e49ceb13cfcdba28620a61d:fulltext:24c330bd7a060370126c0d6f916387ed:42933..43063:sentences:ec168d42aca978356b6e3ff61994c3f9	GML|ACTB	Gml|actin	It is possible that some of the Gml oligomer is covalently crosslinked to itself or to an actin-based structure via the VSV G tail.
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:fulltext:6905311b502b61b19d767d4ce7d4417b:5638..5888:sentences:d3c90582d2b8c039fb4f83a553fa5e78	|THBS1	hAd5|glycoprotein G	In this work, we describe the construction and immunogenic characterization of an oral prion vaccine based on a replication-incompetent human adenovirus expressing a truncated rabies glycoprotein G recombinant fusion with the RL epitope (hAd5:tgG-RL).
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:fulltext:6905311b502b61b19d767d4ce7d4417b:6029..6487:sentences:fa77a8d433d923e5953e4864950a4dec	PRNP|	PrP C|Ad5	The vaccine showed a satisfactory safety profile as characterized by limited vector shedding and non-reactivity of the induced antibodies to PrP C . Collectively, through strategies of formulation that have proven effective for other wildlife vaccines, these efforts provide a potential PrP Sc -specific oral CWD vaccine as well as providing a platform for the generation of other peptide-based oral CWD vaccines.. Characterization of Recombinant Ad5: tgG-RL.
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:fulltext:6905311b502b61b19d767d4ce7d4417b:10456..10942:sentences:768aa9d2e52b1dfddd49a7e1628fc7e8	|PRNP|PRNP||PRNP|PRNP	hAd5|PrP C|PrP|hAd5|PrP C|PrP	peptide-specific antibody responses in animals receiving hAd5:tgG-RL immunizations could be supported by T-helper cells recognizing the tgG carrier protein.. Immune Sera Specificity to PrP C. To determine if the antibodies induced by oral immunization retained the same PrP Sc specificity as previously characterized for the parenteral vaccine, serum from hAd5:tgG-RL vaccinated animals was assayed for PrP C reactivity by ELISA, using recombinant cervid PrP 90-231 for antibody capture.
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:fulltext:6905311b502b61b19d767d4ce7d4417b:11590..11796:sentences:a346fc3c4b7efdb65540494e53c6e85d	|PRNP	hAd5|PrP C	Serum samples from animals receiving hAd5: tgG-RL did not display detectable reactivity with cervid PrP C as the group titers were calculated to be less than 10 1 , similar to the control serum samples [Fig.
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:fulltext:6905311b502b61b19d767d4ce7d4417b:11798..12026:sentences:3d9e7181cd6d00db9e564c6805c3a398	PRNP|PRNP|	PrP C|PrP|hAd5	4A ].. Immune Sera Specificity to PrP C. The PrP Sc specificity and reactivity of the serum antibodies induced by hAd5:tgG-RL were also analyzed with immunoprecipitation assays, using both healthy and prion-infected brain tissue.
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:fulltext:6905311b502b61b19d767d4ce7d4417b:12778..13063:sentences:63fceb9cebf2c85c6d4c4d80a4e57878	PRNP||PRNP|PRNP	PrP|hAd5|PrP|PrP C	The YML antibody has demonstrated reactivity with PrP Sc in immunoprecipitation assays 37 Pooled serum samples collected from animals six weeks after hAd5:tgG-RL vaccination demonstrated reactivity with PrP Sc brain tissue but failed to react with PrP C in healthy brain material [ Fig.
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:fulltext:6905311b502b61b19d767d4ce7d4417b:13071..13183:sentences:09350a45a1bcd5e347a1bece590c3033	|PRNP	hAd5|PrP	Further, pre-immune serum from the hAd5:tgG-RL vaccinated animals failed to react with PrP Sc .. Vector Shedding.
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:fulltext:6905311b502b61b19d767d4ce7d4417b:14049..14276:sentences:955e8829c2b737dfe43645ae03a25bff	|PRNP	hAd5|PrP C	Pooled serum from deer orally immunized with hAd5:tgG-RL was assessed for reactivity with PrP Sc and PrP C . Serum antibodies were cross-linked to magnetic beads and incubated with non-infected and infected 10% brain homogenate.
+SARS:1cfa24297a36bcd526ad00635440d59bce705a17:fulltext:6905311b502b61b19d767d4ce7d4417b:23199..23641:sentences:ce9a9fe6e789d6e69227c22356d52da0	||DEGS1||	hAd5|hAd5|mL D|hAd5|hAd5	Both hAd5 and hAd5:tgG-RL viruses was amplified following several passages in HEK293 cells, purified by CsCl gradient centrifugation and concentration was determined from the formula: viral particles/mL D (optical density at 260 nm)  (dilution factor)  10 12 ). 52 Isolation of Recombinant Adenoviral DNA from Infected Tissue Culture HEK293 cells in T75 format were infected (1  10 5 vp) with hAd5:tgG-RL, hAd5 control virus, or mock infected.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:901..2070:sentences:86f9fd6e62e876f7acdd3bebb1a0e1ae	DPP4|DPP4|DPP4|DPP4|DPP4|DPP4|INS|INS|INS	DPP4|DPP4|DPP4|Dpp4|DPP4|DPP4|insulin|insulin|insulin	DPP4 is a serine protease that cleaves a variety of substrates including incretin hormones, chemokines, growth factors, and neuropeptides [4] . It is ubiquitously expressed on the apical surface of many cell types and also occurs as a soluble form (sDPP4) in the circulation and other body fluids [5, 6] . There is accumulating evidence that DPP4 is involved in the development of chronic liver disease [5, 7, 8] . DPP4 is highly expressed in the liver, and its expression as well as circulating levels are increased in NAFL and NASH [8e10] . sDPP4 is suggested as biomarker of NAFLD [11] and was shown to be a valid measure for hepatocyte apoptosis and fibrosis [12] . Genetic ablation of Dpp4 in mice [13] and rats [14] results in improved insulin sensitivity and liver function, and pharmacological inhibition of DPP4 causes reduction of hepatic steatosis and improvement of insulin sensitivity in mouse models of obesity [15, 16] and diabetes [17] . Beside its role in the degradation of incretin hormones, DPP4 was shown to exert incretin-independent functions such as the induction of insulin resistance [18e21] and inflammation [22] in different cellular systems.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:2072..2243:sentences:0f4364b9310392d85c18198841948425	DPP4|DPP4|INS	DPP4|DPP4|insulin	However, whether elevated DPP4 and in particular hepatic DPP4 triggers insulin resistance and NAFLD or simply reflects the state of liver disease is not entirely clarified.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:2245..2854:sentences:bef538462d4c860d9ece2fd9c9e71f9e	DPP4|DPP4|DPP4|DPP4|INS|INS	DPP4|Dpp4|DPP4|Dpp4|insulin|insulin	We recently demonstrated in diet-induced obesity mice that expression and release of DPP4 is substantially increased in liver when compared to adipose depots [23] . We further showed that elevated expression of Dpp4 in livers of 6-week-old mice associates with early insulin resistance, which, in turn, triggers later liver steatosis [23] . In the current study, we analyzed the DPP4 activity in plasma of healthy and NAFLD subjects and elucidated the effect of hepatocyte-specific Dpp4 overexpression on the development of insulin resistance and liver steatosis in mice under obese conditions.. Human samples.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:4062..4242:sentences:e20241ec43efa2fb24cc7780e0b9c8f4	DPP4|HPRT1	Dpp4|Hprt	Hepatocyte-specific Dpp4 transgenic mice (Dpp4-Liv-Tg) were generated by the company genOway (Lyon, France) via Hprt (hypoxanthine phosphoribosyl-transferase) targeted transgenesis.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:5336..5489:sentences:51e51bd7a2997cc5284889ce3aeaa72e	ADIPOQ|ADIPOQ|LEP|LEP|ADIPOQ	Adiponectin|Acrp30|Leptin|leptin|adiponectin	Plasma adiponectin and leptin levels were measured by Mouse Adiponectin/Acrp30 (DY1119, R&D Systems) and Mouse/Rat Leptin (MOB00, R&D Systems) ELISA kits.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:5915..6158:sentences:63804363ad5ab0a5d77fb5e8e4f13226	SLC17A5|	AST|T2449	Plasma triglyceride (T2449, F6428, G7793, Sigma), free fatty acid (91096, 91898, 91696, Wako), cholesterol (10017, Human), ALT (12212, Human), AST (12211, Human), and GGT (12213, Human) levels were measured according to manufacturer's protocol.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:7576..7676:sentences:ba89d06204c04cc37961cc6c43da19e8	AKT1|INS	Akt|insulin	For relative Akt-phosphorylation, untreated insulin-stimulated controls were set to 100%.. Histology.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:8969..9154:sentences:e6f1b53d7532422c60b9fb112a534c46	DPP4|INS	DPP4|insulin	Cells were treated with various concentrations of recombinant human DPP4 (1180-SE-010, R&D Systems) for 48 h before being serum-starved (3 h) and insulin-stimulated (10 min, 100 nmol/l).
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:10392..10563:sentences:1afab895e947bfff70d0d3baa742b3e3	DPP4|INS	DPP4|insulin	Significance levels were set for pvalues of less than 0.05 (*), 0.01 (**) and 0.001 (***).. Plasma DPP4 activity is increased in patients with NAFLD and insulin resistance.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:11284..11480:sentences:56e71b347d8084f5e1473c3edae32a6e	DPP4|DPP4|INS	DPP4|DPP4|insulin	26.6 AE 0.6, p < 0.001), increased plasma DPP4 activity could also be originated from elevated adipose tissue mass.. Plasma DPP4 activity is increased in patients with NAFLD and insulin resistance.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:11487..11779:sentences:6209795389b1410c3f7c3858e4ba455d	DPP4|DPP4|GLP1R|DPP4|DPP4	Dpp4|DPP4|GLP-1|DPP4|Dpp4	Liver-specific Dpp4 overexpression results in elevated plasma DPP4 activity and diminished GLP-1 levels To investigate whether elevated levels of DPP4 in fatty livers are cause or consequence of the disease, we generated a transgenic mouse model with a hepatocyte-specific Dpp4 overexpression.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:12338..12769:sentences:1459faa05b3630c0dac7dd32ebe2400b	DPP4|DPP4|DPP4|DPP4|CDH1|DPP4	DPP4|DPP4|DPP4|Dpp4|E-cadherin|DPP4	Moreover, comparing endogenous DPP4 levels in different metabolic tissues of WT mice reveal the highest expression of DPP4 in the liver (Figure 2A,B) . Immunohistochemical staining of DPP4 in liver sections suggests increased membrane localization in Dpp4-Liv-Tg mice indicated by a co-staining with the plasma membrane marker E-cadherin , and plasma DPP4 activity (C) of ageand sex-matched subjects with or without (control) NAFLD.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:12819..12961:sentences:69a248070b996afbcc57e6af6bef7dd5	DPP4|INS	DPP4|insulin	One-tailed t-test was performed to test whether liver fat, insulin sensitivity index, and plasma DPP4 activity are increased in NAFLD subjects.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:12963..13068:sentences:4ae552df3daf8ba975d71dc253eeb71c	DPP4|INS	DPP4|insulin	*p < 0.05, ***p < 0.001.. Plasma DPP4 activity is increased in patients with NAFLD and insulin resistance.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:13407..13751:sentences:27dabe35c015048ff746b9658cec1aa8	DPP4|DPP4|DPP4|DPP4|GLP1R	Dpp4|DPP4|DPP4|Dpp4|GLP-1	In addition, cell supernatants of primary hepatocytes from Dpp4-Liv-Tg mice showed higher DPP4 concentration and activity than those from WT controls (Supplementary Figure 1C,D) . Since incretin hormones are known substrates of DPP4, we next analyzed the effect of hepatic Dpp4 overexpression on the half-life of glucagon-like peptide 1 (GLP-1).
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:13753..13975:sentences:3bcb7de4903ac280aab1c421d504e150	GLP1R|DPP4|GLP1R	GLP-1|Dpp4|GLP-1	Fifteen minutes after oral glucose gavage, portal vein concentration of the active form of GLP-1 was similar in WT and Dpp4-Liv-Tg animals, indicating no differences in GLP-1 secretion from intestinal L-cells ( Figure 2E ).
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:13977..14217:sentences:2ce1ab5b6584ef3a784fcf722e001682	GLP1R|DPP4|GLP1R|DPP4	GLP-1|Dpp4|GLP-1|DPP4	However, analysis of blood obtained from vena cava (after liver passage) revealed a 2-fold reduction of active GLP-1 in Dpp4-Liv-Tg mice, suggesting an increased cleavage and inactivation of GLP-1 by hepatocyte originated DPP4 ( Figure 2E ).
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:14219..14468:sentences:67c47b1e6fa1efcedbb436a912a9e2ae	DPP4|DPP4|GLP1R|DPP4|INS	Dpp4|DPP4|GLP-1|DPP4|insulin	Together, these data indicate that hepatic overexpression of Dpp4 results in elevated plasma DPP4 activity, which, in turn, leads to reduced post-prandial GLP-1 levels.. Plasma DPP4 activity is increased in patients with NAFLD and insulin resistance.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:15197..15393:sentences:bf71f60e0e0d4cf1d3e9e0f3b3241b24	EMR1|TNF|TNF|CCL2|CCL2|DPP4	Emr1|TNFa|Tnf|MCP1|Ccl2|Dpp4	Indeed, the expression of the macrophage marker F4/ 80 (Emr1) and of proinflammatory cytokines (TNFa (Tnf) and MCP1 (Ccl2)) were increased in white adipose tissue of Dpp4-Liv-Tg mice ( Figure 3E ).
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:16547..16875:sentences:ee9a0e17909b6b644ee5f46c9f72a2bf	PLIN2|DPP4	perilipin 2|Dpp4	As a consequence, liver weight showed a tendency to be higher than of WT mice (Figure 4 B) . Histological examinations confirmed the increased accumulation of ectopic fat ( Figure 4C ,D) and larger lipid droplets, indicated by staining of the lipid droplet coating protein perilipin 2 in livers of Dpp4-Liv-Tg mice ( Figure 4E ).
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:16877..17502:sentences:dab4f4b61bea193cde297d9b0c8cee51	GGTLC1|SLC17A5|DPP4|DPP4|PPARG|CD36|DPP4	gamma-glutamyl transpeptidase|AST|Dpp4|DPP4|PPARg|CD36|DPP4	Plasma analysis of markers for liver damage showed significantly elevated levels of gamma-glutamyl transpeptidase (GGT, p < 0.05) and numerical increased alanine aminotransferase (ALT, p  0.171) and aspartate aminotransferase (AST, p  0.132) levels (Table 1) . However, markers for inflammation and fibrosis were similar in livers of WT and Dpp4-Liv-Tg animals (Supplementary Figure 2) . Taken together, elevated levels of DPP4 in the liver cause hepatic steatosis with indications of liver damage but not inflammation and fibrosis in mice on a HFD.. PPARg and CD36 expression in the liver is induced by elevated hepatic DPP4.
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:17771..18326:sentences:c32a55a22392a7940174a0432b37c790	SREBF1|CPT1A|APOB|DGAT2|DPP4|PPARG|PPARG|CD36|DPP4	Srebf1|Cpt1a|Apob|Dgat2|Dpp4|peroxisome proliferator activated receptor gamma|Pparg|Cd36|Dpp4	Focusing on genes involved in lipid metabolism, we detected no changes in genes of triglyceride hydrolysis, de novo lipogenesis (except Srebf1), and only slightly elevated mRNA levels of Cpt1a, Apob, and Dgat2 in Dpp4-Liv-Tg mice (Supplementary Figure 3) . The most striking effect was observed for the transcription factor peroxisome proliferator activated receptor gamma (Pparg) and its downstream target fatty acid translocase (Cd36), which were both significantly increased in livers of Dpp4-Liv-Tg mice (2.2-fold and 2.3fold, Supplementary Figure 3 ).
+SARS:19b86cf16403e695203854d598ff4bc4dbfcff86:fulltext:b08c37e47f8accaa2777d32c4e9a7c47:18328..18672:sentences:3df2d5380f07e876c46cb6e66385ec57	MOGAT1|MOGAT1|PPARG|DPP4|PPARG|CD36|MOG