config.yaml 3.6 KB
Newer Older
AntonieV's avatar
AntonieV committed
1
# This file contains everything to configure the workflow on a global scale.
2
# The sample based data must be complemented by a samples.tsv file that contains
AntonieV's avatar
AntonieV committed
3
4
# one row per sample. It can be parsed easily via pandas.
samples: "config/samples.tsv"
AntonieV's avatar
AntonieV committed
5
# The source of fastq files for every sequencing unit of all samples has to be provided in the units.tsv file.
6
units: "config/units.tsv"
Antonie Vietor's avatar
Antonie Vietor committed
7
single_end: False
AntonieV's avatar
AntonieV committed
8

9
10
resources:
  ref:
Antonie Vietor's avatar
Antonie Vietor committed
11
12
    # Number of chromosomes to consider for calling.
    # The first n entries of the FASTA will be considered.
Antonie Vietor's avatar
Antonie Vietor committed
13
    n_chromosomes: 16
Antonie Vietor's avatar
Antonie Vietor committed
14
    # Ensembl species name
Antonie Vietor's avatar
Antonie Vietor committed
15
    species: saccharomyces_cerevisiae
Antonie Vietor's avatar
Antonie Vietor committed
16
17
18
    # Ensembl release
    release: 101
    # Genome build
Antonie Vietor's avatar
Antonie Vietor committed
19
    build: R64-1-1
AntonieV's avatar
AntonieV committed
20
    # for testing data a single chromosome can be selected (leave empty for a regular analysis)
Antonie Vietor's avatar
Antonie Vietor committed
21
    chromosome:
22
    # specify release version number of igenomes list to use (see https://github.com/nf-core/chipseq/releases), e.g. 1.2.2
Antonie Vietor's avatar
Antonie Vietor committed
23
24
25
26
27
    igenomes_release: 1.2.2
    # if igenomes.yaml cannot be used, a value for the mappable or effective genome size can be specified here, e.g. macs-gsize: 2.7e9
    macs-gsize:
    # if igenomes.yaml cannot be used, a path to an own blacklist can be specified here
    blacklist:
Antonie Vietor's avatar
Antonie Vietor committed
28

29
30
31
32
33
34
trimming:
  threads: 2
  se: "--adapter1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"
  pe: "--adapter1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC --adapter2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT"
  others: "--gzip --trimqualities --trimns --minlength 35"

AntonieV's avatar
AntonieV committed
35
params:
Antonie Vietor's avatar
Antonie Vietor committed
36
37
  # choose "narrow" or "broad" for macs2 callpeak analysis, for documentation and source code please see https://github.com/macs3-project/MACS
  peak-analysis: "broad"
Antonie Vietor's avatar
Antonie Vietor committed
38
39
40
41
42
43
44
45
46
47
48
49
50
  # Number of biological replicates required from a given condition for a peak to contribute to a consensus peak
  min-reps-consensus: 1
  callpeak:
    p-value: 0.5
    q-value:
  deeptools-plots:
    # when activated the plot profile and heatmap plot are generated, this involves a matrix calculation that requires a lot of working memory.
    activate: False
  lc_extrap:
    activate: True
  picard_metrics:
    activate: True
  deseq2:
51
    # set to True to use the vst transformation instead of the rlog transformation for the DESeq2 analysis
Antonie Vietor's avatar
Antonie Vietor committed
52
53
54
55
56
57
58
    vst: False
  peak-annotation-analysis:
    activate: True
  peak-qc:
    activate: True
  consensus-peak-analysis:
    activate: True
AntonieV's avatar
AntonieV committed
59
  # samtools view parameter suggestions (for full parameters, see: https://www.htslib.org/doc/samtools-view.html):
Antonie Vietor's avatar
Antonie Vietor committed
60
61
62
  # if duplicates should be removed in this filtering, add "-F 0x0400" to the params
  # if for each read, you only want to retain a single (best) mapping, add "-q 1" to params
  # if you would like to restrict analysis to certain regions (e.g. excluding other "blacklisted" regions),
63
64
65
  # the -L option is automatically activated if a path to a blacklist of the given genome exists in the
  # downloaded "resources/ref/igenomes.yaml" or has been provided via the parameter
  # "config['resources']['ref']['blacklist']" in this configuration file
Antonie Vietor's avatar
Antonie Vietor committed
66
67
  samtools-view-se: "-b -F 0x004"
  samtools-view-pe: "-b -F 0x004 -G 0x009 -f 0x001"
68
  plotfingerprint:
AntonieV's avatar
AntonieV committed
69
    # --numberOfSamples parameter of deeptools plotFingerprint, see: https://deeptools.readthedocs.io/en/develop/content/tools/plotFingerprint.html#Optional%20arguments
70
71
72
73
    number-of-samples: 500000
  # optional parameters for picard's CollectMultipleMetrics from sorted, filtered and merged bam files in post analysis step
  # see https://gatk.broadinstitute.org/hc/en-us/articles/360037594031-CollectMultipleMetrics-Picard-
  collect-multiple-metrics: VALIDATION_STRINGENCY=LENIENT
74
75
76
  bowtie_path: "/usr/local/bin/"
  db_bowtie_path: "/scratch/users/aginolhac/FastQ_Screen_Genomes/"