Commit 1d6efd3f authored by Valentina Galata's avatar Valentina Galata
Browse files

notes: gdb_rgi_aro3004454_flye.md: rm one line which was from previous version (issue #124)

parent 3de3af71
......@@ -31,8 +31,6 @@ TCGATTCAAGTGCATCATGCCGTTTGTGACGGCTTTCATGTTTGCCGTTTTTTGGATGAATTACAAGACTTGCTGAATAA
## Matched proteins
Protein `contig_4930:1.0-5516.0_1` the first protein-coding gene on contig `contig_4930:1.0-5516.0` (LR, `Flye`).
Protein information from `Prodigal`'s FAA file:
```bash
grep "^>contig_5026:14.0-10236.0_" /scratch/users/vgalata/gdb/results/annotation/prodigal/lr/flye/proteins.faa
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment